Duyuru

Collapse

Devamını görüntüle
See less

Gilaburu Mix Extract

Collapse
X
  • Filtrele
  • Zaman
  • Göster
Hepsini Sil
new posts

  • Gilaburu Mix Extract


    Gilaburu Suyu Nedir, Başlıca Faydaları Nelerdir?

    Geçmişten günümüze kadar kullanılmış olan pek çok doğal bitki kaynağı bulunmaktadır. Sağlık açısından büyük bir öneme sahip olan bu kaynakların bir yenisi ise gilaburu suyu olarak öne çıkıyor. Bir meyve olarak öne çıkan Gilaburu, aynı zamanda suyu üzerinden de oldukça yüksek bir fayda sunmaktadır. Peki, gilaburu suyu nedir, başlıca faydaları nelerdir? İşte bu konu hakkında bilinmesi gerekenler.

    Zayıflama üzerinden güzelliğe, sağlık açısından pek çok farklı konuda her derde deva olarak bilinen Gilaburu özel bir meyvedir. Kayseri çevresinde yetişen ve şekli ise kiraza benzeyen bir meyve olarak öne çıkar. Osmanlı dönemine kadar uzanan tarihi ile beraber, beyaz yaprakları nedeniyle kartopu olarak da bilinmektedir.

    Gilaburu Suyu Nedir?

    Meyvesi kadar gilaburu suyu ile de ön plana çıkıyor. Meyvesi üzerinden elde edilen bu su kaynağı içilmek suretiyle güvenli şekilde tüketilebilmektedir. Yaklaşık olarak 3 metre uzunluğunda ve ortalama 30 tane meyve veren bir ağaçtan elde edilen Gilaburu, aynı zamanda özel olarak hazırlanmak suretiyle suyu üzerinden de tüketilmektedir. Böylece meyvesinde bulunan tüm besin kaynakları aynı şekilde su üzerinden de elde edilebiliyor. Tadı genel olarak üzüme ya da sirkeye benzetilen Gilaburu suyu, son dönemlerde uzmanların da tavsiye ettiği en özel besin kaynakları içerisinde yer almaktadır.

    Gilaburu Suyu Başlıca Faydaları Nelerdir?

    Her derde deva olan ve şifa kaynağı olarak Gilaburu suyu, günümüzde başlıca besin kaynakları içerisinde yer alıyor. Özellikle pek çok önemli rahatsızlıklar için kullanım imkanı sağlayan gilaburu suyu, Türkiye'nin dört bir tarafında tüketilmeye başlandı.

    - Özellikle böbrek taşı ile beraber kumları eritme noktasında ön plana çıkıyor.
    - Antioksidan etkisi ile ödeme ve vücuttaki zararlı maddeleri atmak mümkün.
    - Stres ile beraber gerginliği ve yorgunluğu atma konusunda birebir çare üretir.
    - Ağrı kesici özelliği bulunur.
    - Romatizma ağrılarını gidermede bile bir olanak tanır.
    - İdrar yolu enfeksiyonlarına karşı çözüm üretir.
    - Kanser hücrelerinin çoğalmasını engeller ve uzman doktorlar tarafından tedavi amaçlı değerlendirilir.
    - Safra kesesi problemleri engeller ve karaciğeri korur.


    Gilaburu Suyu Zayıflatır mı?

    Hem ödem atma hem de bağırsakları çalıştırma konusunda Gilaburu suyu büyük bir etki sağlar. Böylece vücuttaki ödem atıldığı için zayıflama imkanı elde edilir. Aynı zamanda metabolizmayı hızlandırdığı için sağlıklı şekilde ve dengeli kilo verme imkanı elde edilir. Tabii bunu yarım saat ya da 1 saat süreyle günlük tempolu yürüyüş eşliğinde desteklemek gerekir. Mutlaka dozunda kullanılmalı ve uzman bir doktora danışmak suretiyle değerlendirilmelidir.





    Gilaburu Nedir? Faydaları Nelerdir?

    "Gilaburu faydaları ile son zamanlarda sık duyduğumuz bir bitki. Gilaburu faydaları ile özellikle kadın hastalıklarına karşı da önemli bir bitki. Peki gilaburu nedir? Nasıl kullanılır? Gilaburunun faydaları nelerdir?"


    Gilaburu nedir?

    Gilaburu aslında çalı şeklinde bodur bir ağacın adıdır. Genellikle İç Anadolu bölgemizde yetişen gilaburu kırmızı salkım şeklinde meyveler verir. Sohbaharda toplanan gilaburu meyveleri su için de salamura yapılır ve ilk başta sahip olduğu acı tadını bu sayede kaybeder.

    Gilaburu neye iyi gelir?

    Gilaburu yüksek miktarda C vitamini içerir. Sonbaharda toplanan gilaburu meyvesi ve gilaburu suyu böbrek hastalıklarına, astım, romatizma, yüksek tansiyon, kabakulak, uyku bozukluğu gibi sorunlara iyi gelir.



    Regl ve menopoz döneminde gilaburu kabuğu

    Gilaburu kabuğu da meyvesi kadar faydalı olduğu bilinen bir bölümüdür. Gilaburu kabuğunun kramplara ve kas gerginliklerine iyi geldiği söylenmektedir. Yumurtalık ve dölyatağı kasları ile ilgili problemlere karşı etkili olan gilaburu kabuğu dölyatağını yatıştırıcı ve adet sancısını azaltıcı etki gösterir. Gilaburu kabuğunun fazla görülen regl kanamaları ve menopoz döneminde yaşanabilecek aşırı kanamalara karşı da etkili olduğu söylenmektedir.

    Gilaburu kabuğu çayı nasıl hazırlanır?

    Dölyatağı ve yumurtalık ağrılarına karşı eşit miktarda gilaburunun ve kediotu kökü çayının karıştırılarak kullanılabileceği söyleniyor. Yarım tatlı kaşığı gilaburu kabuğu ile yarım bardak suda gilaburu çayı hazırlayabilirsiniz. Ardından yarım tatlı kaşığı kediotu kökünü yarım bardak kaynar suda haşlayıp 10 dakika demlendirebilir ve eşit oranda bu iki çayı karıştırabilirsiniz.
    Bitkisel Tedavi - İbrahim Gökçek Ürünleri Resmi Satış Sitesidir.

  • #2
    Meyve, Çiçek ve Viburnum opulus Kabuğunun Kimyasal Bileşimi ve Antioksidan Kapasitesinin Karşılaştırılması


    Öz

    Bu çalışmada Viburnum opulus'un (VO) meyveler, çiçekler ve kabuğundaki fenolik, lif, pektin, şeker, organik asit ve karotenoid, C vitamini, kül, protein ve yağ içeriklerinin profilleri ile antioksidan kapasitesi karşılaştırılmıştır. . Antioksidan kapasite ABTS, hidroksil, peroksil ve süperoksit serbest radikallerine karşı ve in vitro kullanımla indirgeyici bir güç olarak değerlendirildi.Ölçek. Sonuçlar, test edilen VO morfolojik parçalarının bileşiminde büyük niceliksel farklılıklar gösterdi. Meyveler en yüksek konsantrasyonlarda yağ, organik asit, şeker, çözünür diyet lifi (sırasıyla 10.57 ± 0.54; 7.34 ± 0.06; 32.27 ± 1.25; 6.82 ± 0.38 g / 100 g DW) ve karotenoid (2.70 ± 0.07 mg / 100 g) içerir. DW). Oysa kabuk, antioksidan kapasitesi, kül (9,32 ± 0,17 g / 100 g DW), toplam (59,34 ± 0,75 g / 100 g DW) ve çözünmeyen diyet lifi (58,20 ± 0,73 g / m2) açısından VO'nun kalan kısımlarını aşmıştır. 100 g DW) içerikleri ve ayrıca fenolik bileşikler (3.98 ± 0.04 g / 100 g DW). Bu çalışmada ölçülen fenolik bileşikler arasında klorojenik asit ve (+) - kateşin sırasıyla çiçekler ve ağaç kabuğunda en yüksek konsantrasyonlara (> 1 g / 100 g DW) sahipti.
    Giriş

    Yaygın olarak Avrupa guelder olarak bilinen Viburnum opulus L. (Adoxaceae), Türkiye'de ayrıca Avrupa yabanmersini otu, karaçalı gülü, yabani kartopu gülü, kiraz ağacı, gül yaşlısı, krampbark ağacı ve kartopu çalısı ve gilaburu olarak da adlandırılır [ 1 , 2 , 3 ]. Avrupa, Kuzey ve Orta Asya ve Kuzey Afrika'da yaygındır [ 2 , 4 ]. Viburnum opulus (VO) değerli bir dekoratif, tıbbi ve gıda bitkisidir. Rusya, Ukrayna ve birçok Sibirya ülkesinde VO meyveleri, buruk-acı-ekşi tatlarına rağmen geleneksel mutfakta marmelat, reçel, likör ve "Kalinnikov" turtalarının yanı sıra bitki çaylarının bir bileşeni olarak kullanılmaktadır [ 5]. Ayrıca İskandinavya'da meyveler konservelerde pişirildiğinde popülerdir, Kanada'da ise kızılcıkların yerini alabilirler [ 3 ]. Türkiye'nin İç Anadolu bölgesinde ticari bir ürün olarak VO meyvelerinden elde edilen meyve suyu üretilmektedir [ 6 ].

    VO meyveleri ve meyve suyu kanama, kalp hastalığı, yüksek tansiyon, öksürük ve soğuk algınlığı, nevroz ve diyabet dahil çok çeşitli hastalıkları tedavi etmek için kullanılmıştır [ 3 , 7 , 8 , 9 ]. Hayvan çalışmalarında, VO meyvelerinin özleri, taksanların neden olduğu hasarlara karşı erkek üreme sistemini önlemiş ve anti-endometriotik aktivite göstermiştir [ 6 , 10 ]. Dahası, in vitro çalışmalar VO meyve, dal, yaprak ve kabuk özlerinin antioksidan özelliklerini göstermiştir [ 11 , 12 , 13 , 14 , 15 , 16 ]. Sağlık yararlarıV. opulus , bitkide fenolik bileşikler, C vitamini, karotenoidler, triterpenler, iridoidler, uçucu yağlar, saponinler ve diyet lifi gibi biyoaktif bileşenlerin varlığından kaynaklanır [ 5 , 16 , 17 , 18 ]. Birkaç yazar tarafından bildirildiği üzere, biyoaktif bileşiklerin seviyeleri meyve genotipleri ve bitkinin kısımları arasında değişiklik gösterir [ 1 , 18 , 19 ].

    Şimdiye kadar, araştırmaların çoğu VO meyvesi ve meyve suyunun kimyasal bileşimini karakterize etmek için yapıldı. Bununla birlikte, sağlığı geliştirici etkilerinin de gösterilmiş olduğu bitkinin diğer kısımlarının kimyasal özellikleri hakkında hiçbir bilgi yoktur veya çok az şey bilinmektedir. Bu çalışmanın amacı, ilaç, kozmetik ve / veya fonksiyonel gıdalarda en değerli VO parçalarının kullanılmasını önermek için kötü tanımlanmış çiçeklerin ve kabuğun biyokimyasal bileşenlerini ve antioksidan potansiyelini iyi bilinen VO meyveleriyle karşılaştırmaktır.

    Malzemeler ve yöntemler

    Materyal ve yöntemler bölümü ek materyal olarak sunulmuştur

    1 . Sonuçlar ve tartışma

    VO Meyveleri, Çiçekleri ve Kabuğunun Makrobesinlerinin Karşılaştırılması


    En iyi bilgimize göre, VO kabuğu ve çiçeklerin temel kimyasal bileşimi hakkında herhangi bir rapor bulunmamaktadır. Bununla birlikte, VO meyvelerindeki makro besinlerin içeriği daha önce diğer yazarlar tarafından analiz edilmiştir [ 1 , 4 , 18 , 19 , 20 ]. VO'nun farklı morfolojik kısımlarının ana bileşenlerinin konsantrasyonları Tablo 1'de verilmiştir . İstatistiksel olarak önemli farklılıklar ( p <0.05) protein, kül, organik asit, şeker, diyet lifi ve pektin içerikleri açısından VO meyveler, kabuk ve çiçekler arasında gözlenmiştir. VO meyvesi, önemli ölçüde en yüksek yağ içeriği (10.57 g / 100 g DW), toplam organik asit (7.34 g / 100 g DW) ve toplam şeker (32.27 g / 100 g DW) ve en düşük konsantrasyon ile karakterize edilmiştir. kül (2.96 g / 100 g DW) ve toplam elyaf (38.44 g / 100 g DW). Bu arada, VO çiçeği, protein ve pektin bakımından en zengin olanıydı (sırasıyla 9.72 ve 8.58 g / 100 g DW). Test edilen üç VO anatomik parçası arasında, ağaç kabuğu en yüksek kül içeriğine (9,32 g / 100 g DW) ve toplam lif (59,34 g / 100 g DW) sahipti. Türkiye'de yetiştirilen taze VO meyvelerinde proteinin küle oranı 1.8 idi ve bu çalışmada test edilen VO kurutulmuş meyveler için hesaplanan değerle tutarlıydı [ 20]. Ek olarak, test edilen VO meyveleri kül ve protein içerikleri açısından diğer meyvelerle karşılaştırılabilirdi, ancak yağ ve lif içeriği açısından bunları aştı [ 21 ]. Oysa VO çiçekleri, Roselle çiçeklerine benzer bir protein içeriği ile karakterize edildi [ 22 ]. Öte yandan, VO çiçeklerindeki kül içeriği yukarıda belirtilen çiçeklerden 2-3 kat daha düşüktü. Fereira vd. [ 23 ] , VO kabuğu sonuçlarımıza kıyasla Quercus faginea kabuğunda daha büyük miktarda kül (14.6 g / 100 g DW) elde ettiler .


    Tablo 1 Kurutulmuş çiçekler, ağaç kabuğu ve Viburnum opulus meyvelerinin temel kimyasal bileşimi[/h]
    Gönderen: Meyve, Çiçek ve Viburnum opulus Kabuğunun Kimyasal Bileşimi ve Antioksidan Kapasitesinin Karşılaştırılması
    Faktör Çiçekler Kabuk Meyveler
    g / 100 g kurutulmuş ağırlık (DW)
    Kül 4.07 ± 0.06 b 9.32 ± 0.17 c 2.96 ± 0.22 a
    Protein 9,72 ± 0,53 c 3.26 ± 0.10 a 5,40 ± 0,16 b
    Yağ 5.39 ± 0.26 a 10.06 ± 0.01 b 10,57 ± 0,54 b
    Toplam organik asit 1.81 ± 0.02 a 1.84 ± 0.05 a 7,34 ± 0,06 b
    Oksalik asit 0.54 ± 0,02 a 0.85 ± 0.01 b -
    Sitrik asit - - 3.09 ± 0.01
    Tartarik asit 0.18 ± 0.01 a - 0,37 ± 0,02 b
    Malik asit 0.61 ± 0.03 a - 3.13 ± 0.02 b
    Kinik asit - - 0.75 ± 0.04
    Süksinik asit 0.48 ± 0.03 a 0,97 ± 0,06 b -
    Fumarik asit - 0.02 ± 0.00 -
    Toplam şeker 11.92 ± 0.41 b 1.52 ± 0.10 a 32,27 ± 1,25 c
    Fruktoz 4.57 ± 0.01 a - 10.72 ± 0.09 b
    Glikoz 2.01 ± 0.06 a - 15.29 ± 0.74 b
    Sakaroz 5,34 ± 0,35 b 1.52 ± 0.10 a 6.26 ± 0.43 c
    Fiber toplamı 45,39 ± 2,07 b 59,34 ± 0,75 c 38.44 ± 0.41 a
    SDF UA 1.87 ± 0.12 b 0.19 ± 0.01 a 2.10 ± 0.08 c
    SDF NS 1.06 ± 0.05 a 0.95 ± 0.05 a 4.72 ± 0.30 b
    SDF toplamı 2.93 ± 0.16 b 1.13 ± 0.06 a 6.82 ± 0.38 c
    IDF UA 0.35 ± 0.03 a 9,93 ± 0,26 c 2.35 ± 0.10 b
    IDF NS 12.61 ± 0.21 b 22.60 ± 1.11 c 9.72 ± 0.16 a
    IDF KL 29.50 ± 2.23 c 25,67 ± 1,71 b 19.54 ± 0.24 a
    IDF toplamı 42,46 ± 2,05 b 58.20 ± 0.73 c 31.62 ± 0.18 a
    Toplam pektin 8.58 ± 0.29 c 4.15 ± 0.06 a 6.23 ± 0.26 b
    WSP 1,96 ± 0,15 b 0.63 ± 0.08 a 4.17 ± 0.28 c
    CSP 4.29 ± 0.08 c 1,92 ± 0,06 b 1.69 ± 0.07 a
    HSP 2.33 ± 0.16 c 1.60 ± 0.14 b 0.37 ± 0.04 a
    Kuru madde * 94.05 ± 0.33 c 93.02 ± 0.28 b 88.09 ± 0.28 a
    Değerler, ortalama ± SD ( n  = 3) olarak ifade edilir ; * g / 100 g ürün olarak ifade edilir; SDF - çözünür diyet lifi, IDF - çözünmeyen diyet lifi, UA - üronik asit, NS - nötr şekerler, KL –Klason ligninleri, WSP - suda çözünür pektinler, CSP - şelatörde çözünür pektinler, HSP - hidroksitte çözünür pektinler; farklı harflerle bir satırdaki ortalama değerler p  <0.05'te önemli ölçüde farklıdır

    Şeker analizi için elde edilen sonuçlar Tablo 1'de gösterilmektedir . VO'nun meyvelerinde ve çiçeklerinde sükroz, glikoz ve fruktoz bulunurken, kabuk sadece sükroz içeriyordu. Toplam şeker içeriği en yüksek VO meyvelerindeydi (32.27 g / 100 g DW), ardından VO çiçekleri (yaklaşık üç kat daha düşük) ve meyveye kıyasla yirmi katın üzerinde daha düşük içerikle kabuk geldi. Glikoz, VO meyvelerinde baskın şekerdi (toplam şekerin% 44.8'i) ve VO çiçeklerinde sükroz (toplam şekerin% 47.4'ü) baskındı. Glikoz ayrıca Perova ve diğerleri tarafından VO meyvelerinde baskın şeker olarak bulunmuştur. [ 5 ]. Daha önce, taze VO meyvelerinin sukrozdan yaklaşık 9 kat daha fazla indirgen şeker içerdiği bildirilmişti [ 18]. Bununla birlikte, mevcut sonuçlar, kurutulmuş VO meyvelerinde bu oranın yaklaşık dört olduğunu göstermektedir; bu, kurutma sırasında şekerlerde kantitatif değişikliklere işaret edebilir. Slatnar ve arkadaşları [ 24 ], kuruma yöntemlerinin incir meyvelerinde monomer şeker / sakkaroz oranını etkilediğini, taze incirde 49.4, güneşte kurutulan meyvelerde 88.2 ve fırında kurutulan incirde etkili olduğunu göstermişlerdir. 38.9.

    Tablo 1'deki veriler, organik asit profilinin ve konsantrasyonunun VO fabrikasının bir kısmına bağlı olduğunu göstermiştir. Numunelerde ölçülen toplam asit 1.81 ila 7.34 g / 100 g DW aralığındaydı. Malik ve sitrik asitler meyvelerde bulunan ana organik asitlerdi ve toplam içeriğin% 84.7'sini oluşturdular. Perova ve ark. Tarafından sağlanan verilerle uyumludur. [ 5 ] ancak diğer çalışmalarla uyumsuz [ 1 , 4 , 19] malik ve tartarik asitlerin hakim olduğu yer. Laboratuvarımızda incelenen meyvelerde bahsedilen çalışmaların aksine oksalik asit, fumarik ve süksinik asit tespit edilmemiştir. VO kabuğundaki baskın organik asit süksinik asit (toplam içeriğin% 52.7'si) iken çiçeklerde malik asittir (toplam içeriğin% 33.7'si).

    Çözünür (SDF) ve çözünmez (IDF) diyet lifi fraksiyonlarının içeriği ve bileşimi, test edilen VO bitkisinin parçalarıyla değişti (Tablo 1 ). Toplam diyet lifi (DF) içeriği, meyvelerde 38.44 g / 100 g DW ile kabukta 59.34 g / 100 g DW arasında değişmiştir. VO meyvesinin değeri, karpuzda 8.83'ten cloudberry'de 38.27 g / 100 g DW'ye kadar DF ​​içeriğine sahip farklı yenilebilir meyveler için elde edilen verilerden daha yüksektir [ 21 , 25 ]. VO çiçeklerindeki DF içeriği Roselle çiçeklerindeki seviyesini% 34 oranında aştı [ 22 ]. Bu çalışmada, VO'nun morfolojik kısımları sırasıyla meyvelerde, çiçeklerde ve ağaç kabuğunda DF'nin% 82.3, 93.5 ve% 98.1 IDF'sini içeriyordu. IDF'nin SDF içeriğine göre avantajı diğer meyvelerde de bulundu [ 25]. IDF, DF'nin kıvam ve dışkı ağırlığını etkileyen ve sonuç olarak bağırsak geçiş süresini azaltan fraksiyonudur [ 26 ]. VO tesisinin analiz edilen tüm kısımlarında, belirli IDF fraksiyonlarının içeriklerinin azalan sıralaması aşağıdaki gibiydi: IDF KL> IDF NS> IDF UA. VO'nun meyve ve kabuğundaki SDF'ye nötr şeker (NS) fraksiyonu hakimken, çiçeklerde üronik asit (UA) fraksiyonu hakim olmuştur. Yutulduktan sonra SDF, bağırsaktaki bakteriyel flora tarafından fermente edilir ve çeşitli yararlı sağlık etkileri ile kısa zincirli yağ asitleri asetat, propiyonat ve bütirat üretimine yol açar [ 27 ]. SDF'nin bir kısmı, içeriği Tablo 1'de gösterilen pektinlerdir.. Toplam miktarları, sırasıyla 4.15 ila 8.58 g / 100 g DW VO kabuğu ve çiçekler arasında önemli ölçüde değişmiştir. CSP (şelatörde çözünür pektin) değerinin yansıttığı gibi, çiçeklere ve ağaç kabuğuna iyonik olarak çapraz bağlı pektin hakim olmuştur. VO meyvelerinin pektini, meyve ve kabuğundaki toplam pektin içeriğine katkısı en düşük olan suda çözünür pektin (WSP) içerir.

    VO Meyveleri, Çiçekleri ve Kabuğunun Doğal Antioksidanları

    Bitkiden elde edilen bileşiklerin sağlığın iyileştirilmesine katkısı kısmen antioksidan kapasitelerine bağlanmıştır. Doğal bitki antioksidanları esas olarak fenolik bileşikler, karotenoidler ve C ve E vitaminleridir. Bu nedenle, test edilen VO ticari ürünlerindeki bu fito-bileşik içeriklerini belirlemek için bir çalışma yapılmıştır (Tablo 2 ). İstatistiksel olarak önemli farklılıklar ( p <0.05) kuru meyveler, kabuklar ve çiçekler arasında toplam fenolikler, flavonoidler ve proantosiyanidinler açısından gözlenmiştir. Karotenoid içeriği, VO meyvelerinde en yüksektir ve kabuk ve çiçeklerde benzerdir. Ticari olarak temin edilebilen VO kabuğu, bitkinin diğer kısımlarına kıyasla en yüksek seviyede toplam fenolikler, flavonoidler ve proantosiyanidinlerle karakterize edildi. Aksine, test edilen VO parçalarının hiçbirinde L-askorbik asit bulunamadı. Literatüre göre, taze VO meyve, askorbik asit ve karotenoidler konsantrasyon aralığı 12,4-164,0 mg ve 1,4-2,8 mg başına 100 gr taze ağırlık (FW) [ 1 , 4 , 5 , 16 , 18]. Bu verileri sonuçlarımızla karşılaştırdığımızda, kurutmanın bu antioksidanlar üzerindeki olumsuz etkisi hakkında sonuca varabiliriz. Kamiloglu vd. [ 28 ], meyvelerdeki doğal antioksidanların stabilitesi üzerindeki etki kurutma sürecinin gözden geçirilmesinde, sıcak hava / fırında kurutmanın C vitamini içeriğinde% 30-72 ve karotenoidlerin 0'dan 90'a düşmesine neden olduğu sonucuna varmıştır. %. Kurutma sırasında C vitamini ve karotenoidlerin bozunması, oksidasyona karşı yüksek duyarlılıklarının yanı sıra, kuruma sırasında polifenollerin oksidasyonunu korumak için kullanılmaları nedeniyle bu bileşiklerin tükenmesine bağlanabilir. Kurutulmuş VO meyveleri, kabuğu ve çiçekleri için karşılaştırmalı veriler mevcut değildir. Ayrıca, bu çalışmada incelenen VO kuraklığını elde etmek için kullanılan kurutma yöntemlerini bilmiyorduk.
    Tablo 2 Kurutulmuş çiçekler, ağaç kabuğu ve Viburnum opulus meyvelerindeki antioksidan içeriği


    Gönderen: Meyve, Çiçek ve Viburnum opulus Kabuğunun Kimyasal Bileşimi ve Antioksidan Kapasitesinin Karşılaştırılması
    Antioksidan Çiçekler Kabuk Meyveler
    Karotenoidler (mg β-karoten / 100 g DW) 1.12 ± 0.06 a 1.13 ± 0.03 a 2.70 ± 0.07 b
    Toplam fenolikler (g GAE / 100 g DW) 3.51 ± 0.13 a 3,98 ± 0,04 c 3.73 ± 0.16 b
    Flavonoidler (g CE / 100 g DW) 1.67 ± 0.07 a 2.25 ± 0.12 c 2.01 ± 0.11 b
    Proantosiyanidinler (g CYE / 100 g DW) 0.22 ± 0.00 a 1,03 ± 0,03 c 0,52 ± 0,02 b
    Değerler ortalama ± SD ( n  = 3) olarak ifade edildi . GAE - gallik asit eşdeğerleri, CE - (+) - kateşin eşdeğerleri, CYE - siyanidin eşdeğerleri; farklı harflerle bir satırdaki ortalama değerler p  <0.05'te önemli ölçüde farklıdır.

    Elde edilen sonuçlar, VO farklı morfolojik kısımlardaki toplam fenolik içeriğinin 3.51–3.98 g / 100 g DW aralığında olduğunu ve karotenoid konsantrasyonunu önemli ölçüde aştığını gösterdi. Karşılaştırma için, fenolik içeriğinin Çek Cumhuriyeti'nde yetiştirilen 0.68-0.83 g FW VO meyvesi ve Rusya'dan 0.40-0.73 g / 100 g FW meyve olduğu tahmin edilmiştir [ 5 , 16 ]. Türkiye veya Litvanya'da yetiştirilen taze meyvelerdeki toplam fenolikler sırasıyla 0,62–0,99 ve 0,75–1,46 g / 100 g FW olarak belirlenmiştir [ 4 , 18 ]. Literatürde bulunan VO meyvelerindeki toplam flavonoidler kolorimetrik teste göre 100 g FW başına 0,20-0,49 g rutin eşdeğeri arasındadır [ 4 , 16] ve HPLC yöntemine [ 5 ] göre 0,004 ila 0,255 g / 100 g FW . Çalışmamızda toplam flavonoidler 1.67 (çiçekler) ile 2.25 (ağaç kabuğu) g (+) - kateşin eşdeğeri / 100 g DW arasında değişmektedir. Flavonoidler, sırasıyla VO çiçeklerinde, meyvelerinde ve kabuğundaki toplam fenoliklerin% 47.6, 53.9 ve 56.5'ini oluşturdu. Yayınlanmış veriler flavonoidlerin taze VO meyvelerindeki toplam polifenol içeriğinin% 27.3-37.4'ünü oluşturduğunu göstermektedir [ 4 ]. Çam vd. [ 19 ], VO tohumlarının 3,5 ve 6,8 kat daha az fenolik ve flavonoid içeren meyve etinden daha iyi toplam fenolik ve flavonoid kaynağı olduğunu gösterdiler. Perova ve ark. [ 5] VO meyvelerindeki proantosiyanidin içeriği 0.20 ila 0.53 g / 100 g FW arasında değişmekte ve toplam fenoliklerin% 49.9-100.0'ını oluşturmaktadır. Çalışmamızda, test edilen VO ticari ürünlerindeki toplam proantosiyanidinler 0,22 (çiçek) ila 1,03 g / 100 g DW (ağaç kabuğu) arasında değişmiştir ve toplam fenoliklerin çiçeklerinde% 6,3, meyvelerde% 13,9 ve kabuğunda% 25,9'dur.

    Bireysel fenolik bileşiklerin bileşimi hakkındaki veriler çok önemlidir çünkü fenoliklerin yapısı, özelliklerini önemli ölçüde etkiler. Yukarıdakilerle bağlantılı olarak, VO meyvelerinin, çiçeklerin ve kabuğun etanolik özütleri, UPLC sistemi kullanılarak ayrı ayrı fenolik bileşiklerin içeriği açısından analiz edildi. VO numunelerindeki kalitatif ve kantitatif fenolik bileşimin sonuçları Tablo 3'te özetlenmiştir.. Çalışmamızda, VO'nun farklı biyolojik kısımları, test edilen bireysel fenolik bileşiklerin miktarında büyük bir varyasyon ile karakterize edildi. Sonuçlar, hidroksisinnamik asitlerin VO meyvelerinde ve çiçeklerinde (toplam fenoliklerin% 88.26 ve% 97.23'ü), VO kabuğunda ise flavanollerin (toplam fenoliklerin% 80.06'sı) baskın olduğunu gösterdi. Ek olarak, VO kabuğunda flavonol bulamadık. Tek ve iki boyutlu kağıt ve ince tabakalı preparatif kromatografi kullanan VO kabuğunun polifenol bileşimi hakkındaki tek raporun yazarları, kafeik, klorojenik, p- hidroksibenzoik ve gallik gibi asitlerin varlığını bildirmişlerdir [ 12 ]. Galya standartlarına sahip olmamıza rağmen, p-hidroksibenzoik ve kafeik asitler, bu bileşikler kurutulmuş VO kabuğunda tespit edilmemiştir. Bu çalışmada, alıkonma süresi ve UV-Vis absorpsiyon spektrumlarının referans bileşiklerinkilerle karşılaştırılması, VO kabuğundaki dört flavanol ve dört hidroksisinnamik asidi baskın fenolik bileşikler olarak (+) - kateşin (1062.43 mg / 100 g DW) ardından prosiyanidin B1 (437.79 mg / 100 g DW) ve klorojenik asit (352.49 mg / 100 g DW). VO kabuğundaki flavanol bileşimi hakkında ilk raporu sunuyoruz.
    Tablo 3 Kurutulmuş çiçekler, ağaç kabuğu ve Viburnum opulus meyvelerindeki fenolik bileşiklerin içeriği (mg / 100 g DW)


    Gönderen: Meyve, Çiçek ve Viburnum opulus Kabuğunun Kimyasal Bileşimi ve Antioksidan Kapasitesinin Karşılaştırılması
    Bileşik Çiçekler Kabuk Meyveler
    Procyanidin B1 25,46 ± 0,10 b 437,79 ± 0,19 c 14.02 ± 0.64 a
    (+) - Kateşin 46.87 ± 0.11 a 1062,43 ± 1,27 b -
    Procyanidin B2 - 116,47 ± 0,48 -
    (-) - Epikateşin - 95,87 ± 1,00 -
    Toplam flavanol 72,33 ± 0,18 c 1712,55 ± 2,23 1712 14.02 ± 0.64 b
    Neoklorojenik asit 17,22 ± 0,03 b 41,51 ± 0,04 c 7.22 ± 0.22 a
    Klorojenik asit 1535,42 ± 5,53 c 352.49 ± 0.33 a 752,59 ± 2,07 b
    Kriptoklorojenik asit 6.78 ± 0.01b 18.44 ± 0.30 c 3.51 ± 0.01 a
    p -Kumarik asit - 14.17 ± 0.25 -
    Toplam hidroksisinnamik asit 1559.42 ± 5.56 1559 426.61 ± 0.33 a 763,32 ± 2,07 b
    Rutin 10.05 ± 0.02 b - 5,39 ± 0,03 a
    İzorhamnetin 58,84 ± 0,10 b - 0.71 ± 0.01 a
    İzorhamnetin 3-O-rutinosid - - 1.60 ± 0.02
    İzorhamnetin 3-O-glukozit 47.06 ± 0.08 - -
    Quercetin 3-O-glukozit 19.18 ± 0.04 - -
    Toplam flavonoller 135,13 ± 0,23 b - 7.70 ± 0.02 a
    Fenolik bileşiklerin toplamı 1766,88 ± 5,97 1776 2139,16 ± 2,36 2139 784.94 ± 1.52 a
    Değerler ortalama ± SD ( n  = 3) olarak ifade edilir , farklı harflerle bir satırdaki ortalama değerler p  <0.05'te önemli ölçüde farklıdır.

    VO meyvesinin en çok çalışılan fenolik profili ile ilgili olarak, hidroksibenzoik ve hidroksisinnamik asitler, kateşinler ve prosiyanidinlerin yanı sıra flavonoller ve antosiyaninler HPLC-MS-TOF ve HPLC yöntemleriyle tanımlanmıştır [ 1 , 3 , 5 ]. Bununla birlikte, kantitatif analizin sonuçları tartışmalıdır. Özrenk ve ark. [ 1 ] meyvelerde en bol bulunan bileşenler (+) - kateşin (28-35 mg / 100 g FW) ve gallik asittir (11-12 mg / 100 g FW), klorojenik asit konsantrasyonu ise 8-10 kat daha düşüktü. (+) - kateşin içeriği. Öte yandan, Velioğlu ve ark. [ 3], klorojenik asidi (204 mg / 100 g FW) VO meyvelerinin ana bileşeni olarak gösterdi ve bunu (+) - kateşin (29 mg / 100 g FW) takip etti. Bu çalışmada, test edilen VO kurutulmuş meyvelerde klorojenik asit (752.59 mg / 100 g DW) baskındır. Ek olarak, diğer yazarlar gibi VO meyvelerinde quercetin ve isorhamnetin glikozitleri bulduk [ 3 , 5 ]. Ne yazık ki, bu çalışmada, taze meyvelerde tanımlanmış olmalarına rağmen, kurutulmuş VO meyvelerinde antosiyaninlere rastlanmamıştır [ 4 , 5 , 18 ]. Yayınlanan veriler, VO meyvelerinin 10 ila 31 mg / 100 g FW arasında değişen farklı siyanidin glikozitleri içerdiğini göstermektedir [ 5]. Kurutulmuş VO meyvelerindeki antosiyanin eksikliğinin meyvenin kurutma işleminden kaynaklanmış olabileceği varsayılabilir. Farklı meyvelerin sıcak hava / fırında kurutulması, toplam antosiyanin içeriğini% 42-92 aralığında azaltmıştır [ 28 ]. Örneğin, 62-64 ° C'de 24 saat havada kurutma, incirdeki siyanidin-3-rutinosid içeriğinde% 26-61 azalmaya neden olurken, 70 ° C'de kurutma kırmızı renkte% 97 siyanidin-3-glukozit kaybına neden oldu. guava, 50–70 ° C'de kurutulmuş vişne, taze meyvelere kıyasla% 27–38 daha az siyanidin-3-glukozit içeriyordu.

    VO çiçeklerinin fenolik bileşimi ile ilgili daha önce hiçbir çalışma ve referans yoktur. Burada VO çiçeklerinin ilk UPLC profilini rapor ediyoruz. Verilerimize göre çiçekler, meyvelere göre hidroksisinnamik asitler, flavonoller ve flavanollerde daha bol miktarda bulunuyordu. Çiçeklerdeki ana fenolik bileşikler, klorojenik asit (1535.42 mg / 100 g DW) ve ardından izorhamnetin (58.84 mg / 100 g DW), izorhamnetin 3-glukozit (47.06 mg / 100 g DW) ve (+) - kateşin (46.87 mg / 100 g DW). VO Meyveleri, Çiçekleri ve Kabuğunun Antioksidan Kapasitesi


    Antioksidan bakımından zengin bitkilerin kullanılması, reaktif oksijen türlerini içeren süreçler yoluyla bulaşıcı olmayan hastalıkların gelişimini önleyebilir veya geciktirebilir. Biyolojik sistemde süperoksit, hidroksil radikalleri gibi reaktif oksijen türleri DNA'ya zarar verebilir ve hücresel lipid ve proteinlerin oksidasyonuna yol açabilir [ 29 ]. VO çiçeklerinin, kabuğunun ve meyvelerinin antioksidan özellikleri, kararlı, sentetik ABTS • + radikal katyon (ABTS) ve aşağıdaki gibi reaktif oksijen türlerine karşı süpürme potansiyeli olarak beş farklı yöntemle tahmin edilmiştir: OH radikali (HORS), O 2 • -süperoksit anyon radikali (SORS), peroksil radikali (ORAC) ve ferrikten ferröz iyona indirgeme potansiyeli (FRAP). Suda çözünür bir E vitamini analoğu olan Trolox, Trolox eşdeğerini (TE) belirlemek için bir antioksidan standardı olarak kullanıldı. İstisnai olarak, (+) - kateşin, kateşin eşdeğerini (CE) belirlemek için SORS testinde antioksidan standart olarak kullanıldı. TE ve CE değerleri ne kadar yüksekse antioksidan potansiyeli de o kadar büyüktür. % 70 etanol ile ekstrakte edilebilen VO doğal antioksidanların antioksidan kapasitesi için sonuçlar Tablo 4'te sunulmuştur . Önemli farklılıklar ( p <0.05), SORS testinde VO çiçekler ve meyveler dışında antioksidan kapasitede analiz edilen VO kısımları arasında bulundu. TE değerleri, ABTS testinde 16,18 ila 40,21 mM / 100 g DW ürün, HORS yönteminde 5,91 ila 10,05 mM / 100 g DW, ORAC testinde 10,93 ila 108,17 mM / 100 g DW arasında ve 13,65 aralığında değişmiştir. Sıkı bağlama yönteminde –23,47 mM / 100 g DW. CE olarak SORS testinde VO ürünlerinin antioksidan potansiyeli 89.77 ile 115.44 mM / 100 g DW ürün arasında değişmektedir. HORS, SORS ve ORAC testlerinde incelenen VO farklı parçalarının antioksidan kapasitesi aşağıdaki sıradaydı: kabuk> çiçekler> meyveler ve ABTS ve FRAP tahlillerinde sıra ağaç kabuğu> meyveler> çiçeklerdi. Elde edilen değerler, kullanılan yöntem ne olursa olsun, VO kabuk bileşenlerinin en yüksek antioksidan kapasitesini gösterdiğini açıkça göstermektedir.• + , DPPH (2,2-difenil-1-pikrilhidrazil), OH, O 2 • - ve NO (nitrik oksit) radikalleri literatürde rapor edilmiştir [ 11 , 16 , 19 ]. Rop vd. [ 16 ], VO meyvelerinin farklı serbest radikaller üzerinde süpürücü etkisi durumunda çeşit çeşitliliğini fark ettiler. VO meyvelerinin O 2 - radikaline karşı antioksidan kapasitesi, DPPH testinde VO dal ve yaprak aktivitelerinden daha düşük ancak VO yaprak aktivitesinden daha yüksekti [ 11 ]. Meyvelerin aksine, VO kabuğunun antioksidan kapasitesi yalnızca Andreeva ve ark. [ 12] katot voltametri yöntemini kullanarak. Bildiğimiz kadarıyla VO çiçeklerinin antioksidan özelliklerine ilişkin veri bulunmamaktadır. Bu çalışmada gözlemlenen VO çiçekler için TE değerleri, sırasıyla ABTS, FRAP ve ORAC testlerinde Roselle çiçekleri için elde edilenlerden yaklaşık iki ve üç kat daha yüksektir [ 22 ]. Kolorimetrik deneylerle test edilen fenolik bileşiklerle antioksidan aktivite deneyleri arasındaki korelasyonlar (Tablo 2 ) Tablo 5'te sunulmaktadır . ABTS ve FRAP testleri ile toplam fenolikler, flavonoidler ve proantosiyanidinler arasında yüksek korelasyonlar bulundu ( r  0.97). Korelasyon analizi ayrıca toplam fenolik, flavonoid ve proantosiyanidin içerikleri arasında SORS testi ile pozitif bir ilişki olduğunu kanıtladı ( r ≥ 0,78). Öte yandan, Tablo 5'te listelenen Pearson katsayıları , fenolik bileşik içerikleri ile ORAC testi arasında haftalık korelasyon ve HORS testi ile negatif korelasyon önermektedir.
    Tablo 4 Viburnum opulus'un kurutulmuş çiçekleri, kabuğu ve meyvelerinin antioksidan kapasitesi


    Gönderen: Meyve, Çiçek ve Viburnum opulus Kabuğunun Kimyasal Bileşimi ve Antioksidan Kapasitesinin Karşılaştırılması
    Tahlil Birim Çiçekler Kabuk Meyveler
    ABTS mM TE / 100 g DW 16.18 ± 1.35 a 40.21 ± 0.67 c 26,57 ± 1,71 b
    ATLAR mM TE / 100 g DW 8.23 ± 0.39 b 5.91 ± 0.33 a 10.05 ± 0.31 c
    ORAC mM TE / 100 g DW 61,82 ± 2,04 b 108.17 ± 3.38 c 10.93 ± 0.39 a
    SIKI BAĞLAMAK mM TE / 100 g DW 13.65 ± 0.64 a 23,47 ± 1,50 c 19,29 ± 0,83 b
    SORS mM CE / 100 g DW 91.13 ± 3.40 a 115,44 ± 5,28 b 89.77 ± 2.56 a
    Değerler ortalama ± SD ( n  = 3), TE - trolox eşdeğerleri, CE - (+) - kateşin eşdeğerleri olarak ifade edilir, farklı harflerle bir satırdaki ortalama değerler p  < 0.05'te önemli ölçüde farklıdır
    Tablo 5 Toplam fenolikler, flavonoidler ve prosiyanidin içeriği ile Viburnum opulus ticari ürünlerinin antioksidan kapasitesi arasındaki Pearson korelasyon katsayıları ( r )


    Gönderen: Meyve, Çiçek ve Viburnum opulus Kabuğunun Kimyasal Bileşimi ve Antioksidan Kapasitesinin Karşılaştırılması
    ABTS SIKI BAĞLAMAK ORAC ATLAR SORS
    Toplam fenolikler 0.999 0,993 0.510 0,589 0.861
    Flavonoidler 0.984 1 0.389 −0.474 0.784
    Proantosiyanidinler 0.998 0.973
    0.603
    0,676 0.912
    Sonuç

    Sonuç olarak, bu araştırma Viburnum opulus'un farklı kısımlarının (meyveler, çiçekler ve kabuk) kimyasal bileşimini ve antioksidan kapasitesini kapsamlı bir şekilde araştırmıştır.(VO) ticari olarak Polonya'da mevcuttur. Bu, VO çiçeklerinin fitokimyasalları ve antioksidan özelliklerinin yanı sıra VO kabuğundaki makro besinler hakkında ilk ayrıntılı rapordur. Sonuçlar, temel kimyasal ve biyoaktif bileşiklerin bileşimindeki farklılıkları ve VO'nun farklı morfolojik kısımlarının antioksidan özelliklerini gösterdi. Kabuk bileşenleri, en yüksek fenolik bileşik içerikleri, özellikle proantosiyanidinler ve flavanol monomerleri ile tutarlı olan, serbest radikallere karşı en aktif olanıydı. Ek olarak, sonuçlarımız, VO kabuğunun ve çiçeklerin yüksek diyet lifi ve fenolik içerikleri nedeniyle yüksek ticari potansiyele ve VO meyvelerine kıyasla daha düşük şeker konsantrasyonuna sahip olduğunu göstermektedir. Biyolojik aktivite arasındaki ilişkiye dair yayınlanmış sayısız veriyi dikkate alarak,

    Kısaltmalar

    SES: Kartopu opulus ABTS: ABTS • + radikal katyon süpürme kapasitesi CE+) - kateşin eşdeğerleri CSP:Şelatörde çözünür pektinler CYE: Cyanidin eşdeğerleri DW: Kuru ağırlık SIKI BAĞLAMAK: Ferrik indirgeme gücü FW: Taze ağırlık GAE: Gallik asit eşdeğerleri ATLAR: Hidroksil radikal süpürme kapasitesi HSP: Hidroksitte çözünen pektinler IDF: Çözünmeyen diyet lifi KL: Klason ligninleri NS: Nötr şekerler ORAC: Oksijen radikal süpürme kapasitesi SDF: Çözünür diyet lifi SORS: Süperoksit anyon radikal süpürme kapasitesi TE: Trolox eşdeğerleri UA: Üronik asit WSP: Suda çözünür pektinler Referanslar
    1. 1.
      Özrenk K, Gündoğdu M, Keskin N, Kaya T (2011) Erzincan yöresindeki gilaburu ( Viburnum opulus L.) meyvelerinin bazı fiziksel ve kimyasal özellikleri . Iğdır Üniv J Inst Sci Technol 1: 9–14

      Google Scholar
    2. 2.
      Sagdic O, Ozturk I, Yapar N, Yetim H (2014) Geleneksel bir Türk fermente Avrupa yaban mersini fidanı ( Viburnum opulus L.) meyve içeceği olan gilaburudan izole edilen laktik asit bakterilerinin çeşitliliği ve probiyotik potansiyelleri . Gıda Res Int 64: 537–545

      makale CAS PubMed Google Scholar
    3. 3.
      Velioğlu Y, Ekici L, Poyrazoğlu E (2006) Avrupa yaban mersini fidanı ( Viburnum opulus L.) meyvelerinin fenolik bileşimi ve ticari suyunun burukluğunun giderilmesi. Int J Food Sci Technol 41: 1011–1015

      makale CAS Google Scholar
    4. 4.
      Ersoy N, Ercişli S, Gündoğdu M (2017) Avrupa kızılcık çalı ( Viburnum opulus L.) genotiplerinin Türkiye'deki agro-morfolojik, biyokimyasal ve biyoaktif özellikler açısından değerlendirilmesi. Folia Hort 29: 181–188

      makale Google Scholar
    5. 5.
      Perova I, Zhogova A, Cherkashin A, Éller K, Ramenskaya G, Samylina I (2014) Avrupa guelder meyvelerinden biyolojik olarak aktif maddeler. Pharm Chem J 48: 332–339

      makale CAS Google Scholar
    6. 6.
      Sarıözkan S, Türk G, Eken A, Bayram L, Baldemir A, Doğan G (2017) Gilaburu ( Viburnum opulus L.) meyve özü, taksan bazlı kemoterapötiklerin neden olduğu testis ve sperm hasarlarını hafifletir. Biomed Pharmacother 95: 1284–1294

      makale CAS PubMed Google Scholar
    7. 7.
      Česonienė L, Daubaras R, Viškelis P, Šarkinas A (2012) Viburnum opulus meyve suyunun toplam fenolik ve antosiyanin içeriklerinin ve antimikrobiyal aktivitesinin belirlenmesi . Bitki Gıdaları Hum Nutr 67: 256–261

      makale CAS PubMed Google Scholar
    8. 8.
      Erdem G, Kesik V, Honca T, Özcan A, Uğuz S, Akgϋl EÖ, Aykutlug Ö, Alp BF, Korkmazer N, Saldir M, Bayrak Z (2016) Persea americana (avokado) ve Viburnum opulus'un (guelder rose) antinefrolitik aktivitesi sıçanlarda etilen glikol kaynaklı nefrolitiyazise karşı. Afr J Tradit Complement Altern Med 13: 110–119

      makale CAS Google Scholar
    9. 9.
      Zayachkivska O, Gzhegotsky M, Terletska O, Lutsyk D, Yaschenko A, Dzhura O (2006) Viburnum opulus proantosiyanidinlerin stres kaynaklı gastrointestinal mukozal hasar üzerindeki etkisi. J Physiol Pharmacol 57: 155-167

      PubMed Google Scholar
    10. 10.
      Saltan G, Süntar I, Ozbilgin S, Ilhan M, Demirel M, Oz B, Akkol E (2016) Viburnum opulus L .: a rmedy for the treatment of endometriosis expated by rat model of Surgated endometriosis. J Ethnopharmacol 193: 450–455

      makale CAS PubMed Google Scholar
    11. 11.
      Altun M, Çitoğlu G, Yılmaz B, Çoban T (2008) Türkiye'de yetişen Viburnum opulus ve Viburnum lantana'nın antioksidan özellikleri . Int J Food Sci Nutr 59: 175–180

      makale CAS PubMed Google Scholar
    12. 12.
      Andreeva TI, Komarova EN, Yusubov MS, Korotkova EI (2004) Kızılcık ağacının ( Viburnum opulus L.) kabuğu ekstraktının antioksidan aktivitesi . Pharm Chem J 38: 548–550

      makale CAS Google Scholar
    13. 13.
      Česonienė L, Daubaras R, Viškelis P (2008) Farklı Viburnum girişlerinin meyvelerinde üretkenlik ve biyokimyasal bileşenlerin değerlendirilmesi . Biologija 54: 93–96

      makale Google Scholar
    14. 14.
      Erdoğan-Orhan I, Altun M, Sever-Yılmaz B, Saltan G (2011) Anti-asetilkolinesteraz ve ana bileşenlerin (salisin, amentoflavon ve klorojenik asit) antioksidan varlıkları ve Viburnum opulus ve Viburnum lantana ekstraktları ve bunların toplam fenolü ve flavonoid içerikleri. J Med Food 14: 434–440

      makale CAS PubMed Google Scholar
    15. 15.
      Kraujalytė V, Venskutonis P, Pukalskas A, Esonienė L, Daubaras R (2013) Farklı Avrupa kızılcık çalılarından ( Viburnum opulus L.) genotiplerinden elde edilen meyvelerin antioksidan özellikleri ve polifenolik bileşimleri . Gıda Kimyası 141: 3695–3702

      makale CAS PubMed Google Scholar
    16. 16.
      Rop O, Reznicek V, Valsikova M, Jurikova T, Mlcek J, Kramarova D (2010) Avrupa kızılcık çalı meyvesinin ( Viburnum opulus var. Edule) antioksidan özellikleri . Moleküller 15: 4467–4477. https://doi.org/10.3390/molecules15064467

      makale CAS PubMed PubMed Central Google Scholar
    17. 17.
      Rychlińska I (2008) Viburnum opulus L. yapraklarında Steroller ve triterpenler . Herba Pol 54: 59-65

      Google Scholar
    18. 18.
      Česonienė L, Daubaras R, Venclovienė J, Viškelis P (2010) Viburnum opulus genotiplerinin biyokimyasal ve agrobiyolojik çeşitliliği . Open Life Sci 5: 864–871

      Google Scholar
    19. 19.
      Çam M, Hisil Y, Kuscu A (2007) Viburnum opulus meyve eti ve tohumunun organik asit, fenolik içeriği ve antioksidan kapasitesi . Chem Nat Compd 43: 460–461

      makale CAS Google Scholar
    20. 20.
      Kalyoncu IH, Ersoy N, Elidemir AY, Karali ME (2013) Türkiye'deki gilaburu ( Viburnum opulus L.) meyvelerinin bazı fiziko-kimyasal özellikleri ve mineral içerikleri . Int Scholarly Sci Res Innov 7: 424–426

      Google Scholar
    21. 21.
      Garcia-Amezquita LE, Tejada-Ortigoza V, Heredia-Olea E, Serna-Saldívar SO, Welti-Chanes J (2018) Geleneksel ve entegre AOAC resmi metodolojileri ile ölçülen meyvelerin ve yan ürünlerinin diyet lifi içeriğindeki farklılıklar. J Food Compos Anal 67: 77–85

      makale CAS Google Scholar
    22. 22.
      Sáyago-Ayerdi SG, Arranz S, Serrano J, Goñi I (2007) Roselle çiçeğindeki ( Hibiscus sabdariffa L.) diyet lifi içeriği ve ilişkili antioksidan bileşikler . J Agric Food Chem 55: 7886–7890

      makale CAS PubMed Google Scholar
    23. 23.
      Ferreira JP, Miranda I, SousaVB PH (2018) Quercus faginea ağaçlarından gelen kabukların kimyasal bileşimi ve lipofilik ve polar özütlerinin karakterizasyonu. PLoS One 13: e0197135. https://doi.org/10.1371/journal.pone.0197135

      makale CAS PubMed PubMed Central Google Scholar
    24. 24.
      Slatnar A, Klancar U, Stampar F, Veberic R (2011) İncirlerin ( Ficus carica L.) kurutulmasının şeker, organik asit ve fenolik bileşik içerikleri üzerine etkisi . J Agric Food Chem 59: 11696–11702

      makale CAS PubMed Google Scholar
    25. 25.
      Pastell H, Putkonen T, Rita H (2019) Baklagiller, tohumlar, sebzeler, meyveler ve mantarlarda diyet lifi: geleneksel ve yarı otomatik filtrasyon tekniklerinin karşılaştırılması. J Food Compos Anal 75: 1–7

      makale CAS Google Scholar
    26. 26.
      Montagne L, Pluske JR, Hampson D (2003) Diyet lifi ve bağırsak mukusu arasındaki etkileşimlerin ve bunların genç geviş getiren hayvanlarda sindirim sağlığı üzerindeki sonuçlarının gözden geçirilmesi. Anim Feed Sci Technol 108: 95–117
    27. 27.
      Tuohy KM, Conterno L, Gasperotti M, Viola R (2012) Bütün bitki besinleri, polifenoller ve / veya lif kullanarak insan bağırsak mikrobiyomunu yukarı düzenleyen. J Agric Food Chem 60: 8776–8782

      makale CAS PubMed Google Scholar
    28. 28.
      Kamiloglu S, Toydemir G, Boyacioglu D, Beekwilder J, Hall RD, Capanoglu E (2016) Kurutmanın meyve ve sebzelerin antioksidan potansiyeli üzerindeki etkisi üzerine bir inceleme. Crit Rev Food Sci Nutr 56: 110–129

      makale CAS Google Scholar
    29. 29.
      Xu DP, Li Y, Meng X, Zhou T, Zhou Y, Zheng J, Zhang JJ, Li HB (2017) Gıdalarda ve şifalı bitkilerde doğal antioksidanlar: ekstraksiyon, değerlendirme ve kaynaklar. Int J Mol Sci 18: 96–127

      makale CAS PubMed Central Google Scholar

    Yorum yap


    • #3


      Gilaburu Suyu Nedir, Başlıca Faydaları Nelerdir?


      Geçmişten günümüze kadar kullanılmış olan pek çok doğal bitki kaynağı bulunmaktadır. Sağlık açısından büyük bir öneme sahip olan bu kaynakların bir yenisi ise gilaburu suyu olarak öne çıkıyor. Bir meyve olarak öne çıkan Gilaburu, aynı zamanda suyu üzerinden de oldukça yüksek bir fayda sunmaktadır. Peki, gilaburu suyu nedir, başlıca faydaları nelerdir? İşte bu konu hakkında bilinmesi gerekenler.

      Zayıflama üzerinden güzelliğe, sağlık açısından pek çok farklı konuda her derde deva olarak bilinen Gilaburu özel bir meyvedir. Kayseri çevresinde yetişen ve şekli ise kiraza benzeyen bir meyve olarak öne çıkar. Osmanlı dönemine kadar uzanan tarihi ile beraber, beyaz yaprakları nedeniyle kartopu olarak da bilinmektedir.

      Gilaburu Suyu Nedir?

      Meyvesi kadar gilaburu suyu ile de ön plana çıkıyor. Meyvesi üzerinden elde edilen bu su kaynağı içilmek suretiyle güvenli şekilde tüketilebilmektedir. Yaklaşık olarak 3 metre uzunluğunda ve ortalama 30 tane meyve veren bir ağaçtan elde edilen Gilaburu, aynı zamanda özel olarak hazırlanmak suretiyle suyu üzerinden de tüketilmektedir. Böylece meyvesinde bulunan tüm besin kaynakları aynı şekilde su üzerinden de elde edilebiliyor. Tadı genel olarak üzüme ya da sirkeye benzetilen Gilaburu suyu, son dönemlerde uzmanların da tavsiye ettiği en özel besin kaynakları içerisinde yer almaktadır.

      Gilaburu Suyu Başlıca Faydaları Nelerdir?

      Her derde deva olan ve şifa kaynağı olarak Gilaburu suyu, günümüzde başlıca besin kaynakları içerisinde yer alıyor. Özellikle pek çok önemli rahatsızlıklar için kullanım imkanı sağlayan gilaburu suyu, Türkiye'nin dört bir tarafında tüketilmeye başlandı.

      - Özellikle böbrek taşı ile beraber kumları eritme noktasında ön plana çıkıyor.
      - Antioksidan etkisi ile ödeme ve vücuttaki zararlı maddeleri atmak mümkün.
      - Stres ile beraber gerginliği ve yorgunluğu atma konusunda birebir çare üretir.
      - Ağrı kesici özelliği bulunur.
      - Romatizma ağrılarını gidermede bile bir olanak tanır.
      - İdrar yolu enfeksiyonlarına karşı çözüm üretir.
      - Kanser hücrelerinin çoğalmasını engeller ve uzman doktorlar tarafından tedavi amaçlı değerlendirilir.
      - Safra kesesi problemleri engeller ve karaciğeri korur.


      Gilaburu Suyu Zayıflatır mı?

      Hem ödem atma hem de bağırsakları çalıştırma konusunda Gilaburu suyu büyük bir etki sağlar. Böylece vücuttaki ödem atıldığı için zayıflama imkanı elde edilir. Aynı zamanda metabolizmayı hızlandırdığı için sağlıklı şekilde ve dengeli kilo verme imkanı elde edilir. Tabii bunu yarım saat ya da 1 saat süreyle günlük tempolu yürüyüş eşliğinde desteklemek gerekir. Mutlaka dozunda kullanılmalı ve uzman bir doktora danışmak suretiyle değerlendirilmelidir.
      Bitkisel Tedavi - İbrahim Gökçek Ürünleri Resmi Satış Sitesidir.

      Yorum yap


      • #4
        İnsan kolorektal karsinomunda Viburnum opulus ve aktif bileşiği p-kumarik asidin antikarsinojenik özelliklerinin karşılaştırılması

        Serdar KARAKURT , *, 1 Gülsüm ABUŞOĞLU , 2 ve Zekiye Ceren ARITULUK 3
        Yazar bilgileri Makale notları Telif hakkı ve Lisans bilgileri Sorumluluk reddi
        Şuraya gidin:

        Öz
        Terapötik ajanlara direnç ve sentetik ilaçların oldukça toksik yan etkileri, yüksek morbidite ve mortalite oranlarına sahip olan kolon kanserinin tedavisinde yeni araştırmaları teşvik etmiştir. Bu çalışma, Viburnum opulus L. (EVO) metanol ekstraktının antikarsinojenik özelliklerinin moleküler mekanizmalarını ve ana aktif bileşeni olan trans-p -kumarik asit ( p -CA), insan kolon kanseri hücreleri (DLD-1, HT-29, SW-620, Caco-2) ve sağlıklı kolon epitel hücreleri (CCD-18Co) üzerinde. EVO'nun kontrollü hücre ölümü (apoptoz) ve hücre bölünme döngüsü üzerindeki etkileri akış sitometrisi ile belirlendi. Kolorektal karsinomda (APC, MLH1, TP53, SMAD4, KRAS ve BRAF) mRNA ve anahtar genlerinin protein ekspresyonlarındaki değişiklik, sırasıyla qRT-PCR ve Western blot ile belirlendi. Sonuçlarımız, EVO'nun güçlü bir azaltma kapasitesine ve serbest radikal temizleme aktivitesine sahip olduğunu göstermektedir. HPLC analizleri, p -CA'nın EVO'nun ana bileşiği olduğunu kanıtlamaktadır . EVO ve p -CA, insan kolon kanseri hücreleri DLD-1 ve HT-29'un çoğalmasını doza bağlı bir şekilde inhibe eder. EVO, DLD-1 hücrelerinin apoptozunu arttırır ve HT-29 hücrelerinde G2 aşamasında hücre döngüsünü durdurur. p53 ve SMAD-4'ün mRNA ve protein ekspresyonları yukarı regüle edilirken, BRAF'ler aşağı regüle edilir. Sonuçlar doğrudan p- CA ile orantılıydı . EVO ve p -CA, diğer 186 genin ekspresyonunu değiştiren DLD-1 hücrelerinin genlerini ve protein ekspresyonlarını değiştirir. Bu, insan kolon kanserinde V.opulus'un farmakolojik keşfinin ilk çalışmasıdır . Antiproliferatif etkileri, p- CA varlığına bağlı olabilir .

        Anahtar Kelimeler: Kolorektal karsinom, Viburnum opulus, p-kumarik asit, TP53, BRAF, apoptoz, hücre döngüsü
        Şuraya gidin: 1. Giriş


        Kanser, tüm dünyada morbidite ve mortalitenin önde gelen nedenlerinden biridir. Dünya Sağlık Örgütü'nün 2015 verilerine göre kanserden ölüm oranı 8,8 milyona ulaştı ve önümüzdeki 20 yıl içinde% 70 artması bekleniyor DSÖ (2015). Kanser [çevrimiçi]. Web sitesi: u1d7f [erişim tarihi 30 Temmuz 2015] .. Hem erkeklerde hem de kadınlarda görülen kolorektal kanser (CRC), dünya çapında üçüncü en yaygın ölüm nedenidir (Globocan, 2014). İnflamatuar bağırsak hastalığı, kolon tutulumu, epigenetik değişiklikler ve aile öyküsü gibi birçok faktör, CRC'nin ilerlemesi ile yakından ilişkilidir (Johnson ve ark., 2013). Artan yaş ve yüksek et tüketimi, düşük sebze tüketimi, düşük fiziksel aktivite ve yüksek alkol ve gıda tüketimini içeren bir yaşam tarzı, CRC gelişimini etkileyen başlıca faktörlerdir (Cunningham ve diğerleri, 2010). Moleküler çalışmalar CRC'nin KRAS, BRAF, APC, p53 ve SMAD-4'ün kritik öneme sahip olduğu Wnt / β-catenin, NF-κB, Nrf2 ve PI3K / Akt / mTOR gibi sinyal yollarının kontrolü altında olduğunu göstermiştir ( Zhang vd., 2015; Dawood vd., 2019; Sheng vd., 2019; Wang vd., 2019). APC, MLH1, TP53, SMAD4, KRAS ve BRAF genlerindeki mutasyonlar, CRC ilerlemesinde çok önemli bir rol oynar ve CRC insidansının artmasının bir nedenidir (Namani ve diğerleri, 2017). Bu genler toplam 184 genle etkileşim halindedir; bu genlerin değişimi, CRC'nin ilerlemesini etkiler. SMAD4, KRAS ve BRAF genleri, CRC ilerlemesinde çok önemli bir rol oynar ve CRC insidansının artmasının bir nedenidir (Namani ve diğerleri, 2017). Bu genler toplam 184 genle etkileşim halindedir; bu genlerin değişimi, CRC'nin ilerlemesini etkiler. SMAD4, KRAS ve BRAF genleri, CRC ilerlemesinde çok önemli bir rol oynar ve CRC insidansının artmasının bir nedenidir (Namani ve diğerleri, 2017). Bu genler toplam 184 genle etkileşim halindedir; bu genlerin değişimi, CRC'nin ilerlemesini etkiler.

        CRC'yi tedavi etmek için cisplatin dahil çeşitli kemot
        erapötik ilaçlar uygulanmıştır. Bununla birlikte kemoterapinin yan etkileri yüksek mortalite ve reaktif oksijen türlerinin üretimi ile bağlantılıdır (Wu ve ark., 2019) .Ameliyat en etkili tedavi yöntemi olmasına rağmen, ameliyat sonrası tekrarlama olasılığının yüksek olması nedeniyle ameliyat sonrası kemoterapi veya radyoterapi gereklidir. . KRK'de sağkalım oranını artırmak için yeni ve alternatif tedavi seçeneklerinin araştırılması gerekmektedir. Bu nedenle, CRC'ye karşı mücadele edecek yeni bir tedavi belirlemek kritik derecede önemlidir. Bitkiler böceklere, mantarlara, çeşitli memelilere ve pek çok hastalığa karşı savunma mekanizması olarak yüzlerce ikincil metabolit sentezler. Bununla birlikte, bu metabolitlerin moleküler mekanizmaları daha fazla araştırma gerektirir. Hastalıklara ve oksidatif yıkıma karşı koruyan bol miktarda antioksidan içeren sebze ve meyvelerin tüketimini teşvik etmek için önemli bir argüman vardır (Çelik vd., 2016; Karakurt vd., 2016). Cins Adoxaceae ailesinin bir üyesi olan Viburnum L., Güney Amerika'dan Güneydoğu Asya'ya kadar ılıman ve subtropikal bölgelerde yayılmış 230'dan fazla türden oluşur. Türkiye'de Viburnum cinsi 4 türler ile temsil edilir: V. lantana L., V. opulus L., V. orientale . Pall ve tinus V. L. V.opulus gibi polifenoller, yüksek miktarlarda içeren yenilebilir meyve darkred varlıklar sahip klorojenik asit, kateşin, epikateşin ve antosiyaninler ve askorbik ve oksalik asitler gibi organik asitler (Cam ve Hisil, 2007). V. opulus'taki polifenoller hem in vitro hem de in vivo antiinflamatuar bileşik olarak kullanılan gümüş nanopartiküllerin sentezi için de kullanılmıştır (Moldovan ve diğerleri, 2017). V. opulus'un meyveleri geleneksel olarak bazı ülkelerde gerginlik, mesane rahatsızlıkları, duodenal ülserler, öksürük, soğuk algınlığı, böbrek ve adet ve mide krampları gibi bazı sağlık sorunlarını tedavi etmek için kullanılmıştır (Ezov ve Koncejev, 2000; Moldovan ve ark. , 2012). Yaygın olarak Orta Anadolu'da yetişen V. opulus'un ürolitiyazis ve iltihaplanmaya karşı koruyucu işlevlere sahip olduğu gösterilmiştir (Kızılay ve ark., 2019). V. opulus özü, Ehrlich ascites tümör taşıyan farelerde antikanser özelliklerini sundu (Ceylan ve diğerleri, 2018). 1,2 dimetilhidrazin ile indüklenen kolonik lezyonların fare kolonunda V. opulus tarafından inhibe edildiği bulunmuştur (Ulger ve ark., 2013). Bununla birlikte, V. opulus'un insan kolon kanseri üzerindeki etkilerini inceleyen çok az çalışma vardır . Dahası, moleküler etki mekanizması ve hücre ölümü mekanizması ne in vivo ne de in vitro olarak aydınlatılmamıştır. Bitkilerdeki o-oksijenasyon ve metilasyon reaksiyonlarını takiben, p içeren hidroksisinnamik asit türevleri -kumarik ve kafeik asit üretilir (Russell ve Duthie, 2011). Bu fenolik bileşikler, serbest radikallerin temizlenmesinde, gen ve protein ekspresyonunun düzenlenmesinde, ksenobiyotik metabolizmasında ve apoptoz, hücre proliferasyonu ve DNA onarım sistemi ile ilgili hücresel sinyallemede çok önemli bir role sahiptir. P -kumarik'in Caco-2, HT-29 ve SW-480 gibi çeşitli insan CRC hücrelerine karşı antikarsinojenik özellikleri birçok çalışmada araştırılmıştır (Janicke ve diğerleri, 2011). Burada V. opulus ve aktif bileşiği p- CA'nın in vitro antikarsinojenik etkileri karşılaştırılmıştır.

        Bu çalışmada, EVO ve p -CA'nın DLD-1, HT-29, SW-620 ve Caco-2 gibi insan kolorektal hücre dizileri üzerindeki sitotoksik etkisini araştırmayı ve moleküler mekanizmaları netleştirmeyi hedefliyoruz.

        Şuraya gidin: 2. Malzemeler ve yöntemler

        2.1. Kimyasallar


        Trans - p -kumarik asit (55823) Sigma'dan (Sigma-Aldrich, St. Louis, MO, ABD) satın alındı ​​ve 100 pmol primer BM Laboratuvar sistemleri (Ankara, Türkiye) tarafından sentezlendi. CCD-18Co hücreleri (ATCC-CRL-145), modifiye McCoy's 5a ortamı (ATCC-30-2007), EMEM (ATCC-30-2003), RPMI 1640 ortamı (ATCC-30-2001) ve fetal sığır serumu (FBS ATCC-30-2020) ATCC'den (American Tissue Culture Company, Manassas, VA, ABD) temin edildi. SMAD4 (10231-1-AP), KRAS (12063-1-AP), BRAF (20899-1-AP) ve TP53 (10442-1-AP) birincil antikorları (1/1000 seyreltilmiş) Proteintech'ten satın alındı ​​( Proteintech Laboratories, Manchester, İngiltere). BD Biosciences'dan (Woburn, MA, ABD) bir apoptoz kiti elde edildi. Çözücüler, HPLC derecesiydi; diğer tüm kimyasallar analitik sınıftadır. 2.2. Bitki malzemeleri


        V. opulus'un meyveleri Eylül 2017'de Kayseri'de ekili bir alandan hasat edilmiştir. Bitki yazarlar tarafından tanımlanmış ve kupon örnekleri Hacettepe Üniversitesi Eczacılık Fakültesi Herbaryumuna (Ankara, Türkiye) HUEF17039. 2.3. çıkarma


        Taze meyveler (her biri 50 g) 3 gün boyunca 3 kez metanol ile ekstrakte edildi ve süzüldü. Konsantre özler, 40 ° C'de indirgenmiş basınç altında kurutuldu ve liyofilize edildi. 2.4. Yüksek performanslı sıvı kromatografi (HPLC) analizi


        2.4.1. HPLC ile bireysel fenolik bileşiklerin belirlenmesi


        EVO'nun fenolik bileşikleri, bir Shimadzu LC-20AD HPLC sistemi (Kyoto, Japonya) ile analiz edildi. Yetmiş mg metanol özütü, metanol ile 40 kat seyreltildi ve HPLC analizi için bir filtre diskinden süzüldü. Fenolik bileşiklerin ayrılması, bir Inertsil ODS-3V C18 kolonu (GL Sciences Inc., Tokyo, Japonya) (5 um; 4.6 x 250 mm id) ile gerçekleştirildi. Mobil faz akış hızı 1.0 mL / dakikada tutuldu. Mobil faz A,% 0.05 gAc içeren su ve mobil faz B, asetonitrildi. Gradyan koşulları aşağıdaki gibiydi: 0–0.10 dk,% 8 B; 0.10–2 dk,% 8-10 B; 2–27 dk,% 10-% 30 B; 27–37 dk,% 30–% 56 B; 37–45 dakika,% 56–% 80 B. Kolonun sıcaklığı 30 ° C'de kontrol edildi. Enjeksiyon hacmi 20 μL idi. Fenolik bileşikler, bir SPD-20A UV-Vis detektörü ile 280 nm'de izlendi. EVO'daki fenolik bileşikler, gerçek standartlar kullanılarak ve tutma süreleri ve UV verileri açısından standart bileşiklerle karşılaştırılarak tanımlandı. Fenolik bileşiklerin kantitatif analizi, her bir ticari standart için oluşturulan bir kalibrasyon eğrisi kullanılarak gerçekleştirildi, yani gallik asit, protokatekuik asit, kateşin hidrat, 4-hidroksibenzoik asit, kafeik asit, siringik asit, rutin trihidrat, trans-p -kumarik asit, trans- ferulik asit, trans- resveratrol, trans- sinnamik asit ve naringenin. Standart fenolik bileşikler metanol içinde çözüldü; Stok solüsyonu seyreltilerek 1 ila 65 ppm arasında değişen her bir bileşiğin 8 farklı konsantrasyonu hazırlandı. Her konsantrasyon seviyesi için üç enjeksiyon gerçekleştirildi ve konsantrasyona karşı pik alanı çizilerek kalibrasyon eğrileri oluşturuldu. Sonuçlar ppm (milyonda parça) olarak ifade edilir.

        2.4.2. Organik asitlerin HPLC ile tayini


        EVO'da organik asitlerin kantifikasyonu, Shimadzu LC-20AD HPLC sistemi (Kyoto, Japonya) ile gerçekleştirildi. Altmış mg metanol özütü, suyla 20 kat seyreltildi ve HPLC analizi için bir filtre diskinden süzüldü. 0.6 mL / dakika akış hızında ayırma için bir MetaCarb 87H Koruyucu Sütun (50 × 4.6 mm) ile birleştirilmiş bir MetaCarb 87H Kolonu (300 × 7.8 mm; Agilent Technologies, Santa Clara, CA, ABD) kullanıldı. 0.1 NH 2 SO 4. Organik asitler, SPD-20A UV-Vis ile 210 nm'de izlendi. EVO'daki organik asitler, orijinal standartlar kullanılarak ve tutma süreleri ve UV verileri standart bileşiklerle karşılaştırılarak tanımlandı. Organik asitlerin kantitatif analizi, her bir ticari standart için oluşturulan bir kalibrasyon eğrisi kullanılarak elde edildi - yani sitrik asit, tartarik asit, maleik asit, süksinik asit, formik asit, asetik asit ve fumarik asit. Standart bileşikler deiyonize su içinde çözüldü; Stok solüsyonu seyreltilerek 1 ila 100 ppm arasında değişen her bir bileşiğin 6 farklı konsantrasyonu hazırlandı. Her konsantrasyon seviyesi için üç enjeksiyon gerçekleştirildi ve konsantrasyona karşı tepe alanı çizilerek kalibrasyon eğrileri oluşturuldu. Sonuçlar ppm (milyonda parça) olarak ifade edildi. 2.5. Antioksidan aktivite


        2.5.1. DPPH radikal temizleme kapasitesi analizi


        DPPH radikal süpürme kapasitesi deneyi, Brand-Williams ve diğerleri tarafından tarif edilen yöntemin biraz değiştirilmiş bir versiyonuna göre gerçekleştirildi. (1995). Ekstrakt ve çeşitli konsantrasyonlarda (150 uL) metanol içerisinde çözündürülen referans, metanol (50 uL) içerisinde 1 mM DPPH solüsyonu ile karıştırıldı ve 30 dakika inkübe edildi. Absorbanstaki değişiklik 517 nm'de ölçüldü. DPPH radikal süpürme kapasitesi aşağıda verildiği gibi hesaplanmıştır:

        İnhibisyon% = [(Ablank − Asample) / Boş] × 100.

        Quercetin referans olarak kullanılmıştır. Üç tekrarlı reaksiyonlar gerçekleştirildi. Ekstraktın yutma kapasitesi yarı maksimal inhibisyon konsantrasyonunun (IC olarak ifade edildi 50 ).

        2.5.2. Bakır iyon azaltıcı antioksidan kapasite (CUPRAC) testi


        EVO'nun bakır iyon azaltıcı antioksidan kapasitesi, Apak et al. (2004) küçük değişikliklerle. Reaksiyon karışımı, CuCl, 10 mM, eşit miktarlarda ihtiva 2 çözeltisi, neokuproin çözelti 7.3 uM, NH 1 M 4 pH 7.0'da Ac tampon çözeltisi. Son hacmi 200 uL yapmak için, karışıma 25 uL numune ve 25 uL damıtılmış su ilave edildi. Nihai çözelti, oda sıcaklığında (oda sıcaklığı) 30 dakika süreyle inkübe edildi ve numuneler, 450 nm'de ölçüldü. Sonuç, gallik asit eşdeğeri olarak sunuldu.

        2.5.3. Toplam fenolik içeriklerin belirlenmesi


        EVO'nun toplam fenolik içeriği, Folin-Ciocalteau reaktifi kullanılarak Slinkard ve Singleton (1977) tarafından açıklanan yönteme göre tahmin edildi; UL özü, etanol içinde eritildi ve% 7.5 ile 20 (ağırlık / hacim) Na 2 CO 3 çözeltisi Folin-Ciocalteau reaktifinin (1:10) ile karıştırılmıştır. Reaksiyon karışımı 2 saat oda sıcaklığında inkübe edildi ve 765 nm'de ölçüldü. Sonuç, gallik asit eşdeğeri olarak sunuldu.

        2.5.4. Toplam flavonoid içeriğinin belirlenmesi


        EVO'nun toplam flavonoid içeriği alüminyum klorür kolorimetrik yöntem kullanılarak belirlenmiştir (Chang ve diğerleri, 2002). AICI% 95 etanol,% 10 ile karıştırılmış thesamplewas yirmi beş uL 3 ve 1 M KCH 3 COO. Oda sıcaklığında 30 dakikalık inkübasyonun ardından, absorbans 415 nm'de ölçüldü. Sonuç quercetin eşdeğeri olarak sunuldu. 2.6. Hücre kültürü


        İnsan CRC hücre hatları (DLD-1, HT-29, SW-620, Caco-2) ve insan kolon fibroblast hücre çizgisi CCD-18Co, RPMI-1640, McCoy's 5a, Leibovitz'in L-15 ve EMEM büyüme ortamlarında ( sırasıyla ve% 5 CO, 37 ° C'de 2 mM L-glutamin (Sigma-Aldrich),% 10 fetal sığır serumu (FBS) ve% 1 penisilin / streptomisin ile takviye edilmiş ATCC), 2 90% -95% nemde.

        2.6.1. Hücre canlılığı deneyi


        1 x 10 4 hücre büyüme ortamı ile, 96 oyuklu bir plaka içerisine tohumlanır ve% 5 CO içinde 37 ° C'de inkübe edildi 2 tabanına tutturulmuş hücreler kadar 24 saat boyunca ısıtılır. Hücreler daha sonra 1 ug / mL ila 1000 ug / mL arasında değişen ve 0 ila 1000 uM arasında değişen p- CA çeşitli EVO konsantrasyonları ile işleme tabi tutuldu . Hücre canlılığı ve proliferasyonu Alamar Blue deneyi ile ölçüldü (Karakurt ve Adali, 2016). Absorbans, bir çok oyuklu tarama spektrofotometresi (Multiskan Go; Thermo Scientific Co., Waltham, MA, ABD) kullanılarak 570 nm ve 610 nm'de ölçüldü. IC 50 EVO'nun değerleri inhibisyon oranı (%) genel EVO konsantrasyonunun log sigmoid grafiğinden hesaplandı. 2.7. Apoptoz deneyi


        30 x 10 4 DLD-1 hücreleri, 6 gözlü bir plakanın içine ekildi ve bir eşdeğer IC ile muamele edildi 50 EVO'nun konsantrasyonu ve p % 5 CO içinde 37 ° C 'de -CA ve 48 saat daha inkübe 2 . Tripsinize edilmiş ve yıkanmış (10 mM PBS ile) hücreler, FITC Annexin V ve 7-Aminoactinomycin D (7-AAD) ile çift boyanmıştır. EVO'nun apoptoz ve nekroz geçirmiş DLD-1 ve HT-29 hücrelerinin yüzdesi üzerindeki etkileri, üreticinin talimatlarına göre belirlendi (BD Bioscience, San Jose, CA, ABD). Erken apoptotik, geç evre apoptotik veya nekrotik hücreler, bir NovoCyte akış sitometresi (Acea Biosciences Inc, San Diego, CA, ABD) kullanılarak incelenmiştir. 2.8. Hücre döngüsü analizi


        15 x 10 4 DLD-1 hücreleri, 6 gözlü bir plakanın içine ekildi ve eşdeğer IC ile muamele edildi 50 EVO'nun konsantrasyonu ve p -coumaric asit ve tripsinizasyon ile toplandı. % 70 buz soğukluğunda etanol içinde 2 saat fiksasyondan sonra, hücre peletleri 100 μg / mL RNase A ve 50 μg / mL PI ile 30 dakika inkübe edildi. NovoCyte akış sitometresini kullanarak, her gruptan 50.000 hücre hücre döngüsü analizine tabi tutuldu. 2.9. Hücre lizatlarının hazırlanması ve Western blot analizi


        30 x 10 4 DLD-1 hücrelerinde, 100 cm2 bir Petri tabaklarında tohumlanmış ve eşdeğer IC ile muamele edildi 50 EVO'nun ve konsantrasyonu p -kumarik asit. İnkübasyonun ardından hücreler, önceden soğuk PBS ile yıkandı ve 1 mM PMSF ile RIPA tamponunda (Cell Signaling Technology, Beverly, MA, ABD) lize edildi. Lizatlar, 14,000 g'de 4 ° C'de 15 dakika süreyle santrifüjlendi. Süpernatan, BCA yöntemi ile belirlenen protein konsantrasyonunu belirlemek için kullanıldı. On beş ug protein numunesi SDS-PAGE (% 4 istifleme jeli ve% 7.5 ayırma jeli) ile ayrılmış, PVDF membranı üzerine lekelenmiş ve poliklonal (tavşan) anti-APC, anti-TP53, anti-BRAF, anti- SMAD4, anti-KRAS antikorları (Bio-Rad Laboratories, Hercules, CA, ABD) gece boyunca 4 ° C'de ve keçi anti-tavşan IgG ikincil antikoru ile RT'de 1 saat. Tespit için ECL tespit sistemleri (Thermo Scientific Co.) kullanıldı. Jeller, Syngene GBOX Chemi XRQ görüntüleme sistemi (Frederick, MD, 2.10. Toplam RNA izolasyonu, cDNA sentezi ve qRT-PCR analizi


        DLD-1 hücrelerinin toplam RNA'sı, üreticinin talimatlarına göre QIAzol Lizis Reaktifi (Qiagen, Hilden, Almanya) kullanılarak özümlendi. Toplam RNA'nın miktarı ve kalitesi bir Agilent 2100 Bioanalyzer kullanılarak ölçüldü ve daha yüksek RIN (> 7) içeren numuneler cDNA sentezi için kullanıldı. cDNA, üreticinin talimatlarına (Bio-Rad Laboratories, Hercules, CA, ABD) göre bir iScript Ters Transkripsiyon cDNA sentez kiti kullanılarak ters transkripsiyon yoluyla 1 ng toplam RNA'dan sentezlendi. Sentezlenen cDNA'lar, Tablo l'de gösterildiği gibi tasarlanmış spesifik primerler kullanılarak amplifikasyona tabi tutuldu. GAPDH ekspresyonu, normalizasyon için dahili kontrol olarak kullanılan bir referans gen olarak kullanıldı. qRT-PCR, optik 96 oyuklu plaka (Bio-Rad Laboratories) ile bir CFX Connect Gerçek Zamanlı PCR Saptama Sistemi ile gerçekleştirildi. 10 μL SYBR GREEN PCR Master Mix, 2 μL seyreltilmiş cDNA şablonu ve her bir primerden 0,4 μL içeren 20 μL reaksiyon karışımı her kuyuya eklenmiştir. Termal döngü profili, üretici tarafından önerilmiştir: 30 s için 98 ° C, 15 s için 98 ° C'de 40 döngü, 30 s için 60 ° C. Primerlerin özgüllüğünü doğrulamak için, amplifikasyondan sonra erime eğrileri dahil edildi. Tüm reaksiyonlar üç kez gerçekleştirildi ve mRNA ifadesinin kat değişimi, delta delta (2 30 saniye için 98 ° C, 15 saniye için 98 ° C'de 40 döngü, 30 saniye için 60 ° C. Primerlerin özgüllüğünü doğrulamak için, amplifikasyondan sonra erime eğrileri dahil edildi. Tüm reaksiyonlar üç kez gerçekleştirildi ve mRNA ifadesinin kat değişimi, delta delta (2 30 saniye için 98 ° C, 15 saniye için 98 ° C'de 40 döngü, 30 saniye için 60 ° C. Primerlerin özgüllüğünü doğrulamak için, amplifikasyondan sonra erime eğrileri dahil edildi. Tüm reaksiyonlar üç kez gerçekleştirildi ve mRNA ifadesinin kat değişimi, delta delta (2[−ΔΔCt] ) yöntemi. tablo 1


        Kolorektal kanser ilerleme anahtar genlerinin primer dizisi.
        APC NM_001127510.3 F- TGAGGCACTGAAGATGGAGA
        R- TCTGTCCAGAAGAAGCCATAG
        60 158
        MLH-1 NM_000249.4 F- TGTTAAAGAGGGAGGCCTGA
        R- CTCACCTCGAAAGCCATAGG
        60 157
        TP53 NM_001276696.2 F- CACATGACGGAGGTTGTGAG
        R- TAGGGCACCACCACACTATG
        60 158
        SMAD4 NM_005359.6 F- CACAGGACAGAAGCCATTGA
        R- ACGCCCAGCTTCTCTGTCTA
        60 150
        KRAS NM_001369786.1 F- TGCAATGAGGGACCAGTACA
        R- TCCTGAGCCTGTTTTGTGTCT
        60 201
        BRAF NM_001374258.1 F- TCAACCACAGGTTTGTCTGC
        R- TCACTCGAGTCCCGTCTACC
        60 164
        GAPDH NM_001357943.2 F-AATCCCATCACCATCTTCCA
        R-TGGACTCCACGACGTACTCA
        60 82
        2.11. İstatistik


        Her deney en az 3 kez tekrarlandı. Niceliksel veriler GraphPad Prism (GraphPad Software v5.0, San Diego, CA, ABD) ile işlendi. Sonuçlar ortalama ± SD olarak temsil edilir. Gruplar arasında istatistiksel karşılaştırmalar, iki yönlü tekrarlı ölçüm varyans analizi (ANOVA) ve iki kuyruklu Student t-testi kullanılarak yapıldı, burada P <0.05 istatistiksel olarak anlamlı kabul edildi.

        Şuraya gidin: 3. Sonuçlar ve tartışma


        V.opulus (Şekil 1a), metanol ekstraksiyonuna tabi tutuldu ve EVO'nun fenolik içeriği, HPLC ile belirlendi. Çözücü tipine bağlı olarak, EVO'nun HPLC-UV kromatogramları, çözücülerin yapısal farklılığından dolayı oldukça farklı profiller gösterebilir. Bu çözücüler karşılaştırıldığında, EVO en yüksek miktarda fenolik / flavonoid bileşikleri ve en yüksek antioksidan aktiviteyi gösterirken, V. opulus'un su ve asetonitril özleri düşük miktarda fenolik bileşiğe ve düşük antioksidan aktiviteye sahiptir (Karacelik vd., 2015). Türevlendirmeden sonra EVO'nun kromatogramı Şekil 1b ve 1c'de gösterilmektedir. Fenolik bileşiklerin ve organik asitlerin tepe noktaları kromatogramda tespit edilmiştir ve EVO'nun bileşimi Tablo 2'de listelenmiştir. Tablo 2'de gösterildiği gibi, EVO yüksek miktarda p- CA (280,5 ± 10,8 ppm) ve kateşin hidrat (235,9 ± 5,8 ppm) ve sitrik asit (1198,1 ± 16,9 ppm) ve formik asit (349,6 ± 5,1 ppm).
        Resim, illüstrasyon vb. İçeren harici bir dosya. Nesne adı turkjbio-44-252-fig001.jpg
        Şekil 1
        EVO'nun HPLC parmak izi profili. a) V. opulus'un görüntüleri . b) EVO'nun 280 nm'de fenolik bileşik içeriğinin belirlenmesi: 1. Gallik asit (6.33 dakika); 2. Protokatekuik asit (10.05 dakika); 3. Kateşin hidrat (12.81 dak); 4. 4-Hidroksibenzoik asit (14.09 dakika); 5. Kafeik asit (15.89 dakika); 6. Şırıngalı asit (16.50 dak); 7. Rutin trihidrat (20.24 dakika); 8. p- CA (21.19 dakika); 9. Trans- ferulik asit (23.20 dakika); 10. Trans- resveratrol (31.34 dakika); 11. Naringenin (36.41 dakika). c) EVO'nun 210 nm'de organik asit içeriği: 12. Sitrik asit (9.02 dak); 13. Maleik asit (12.5 dak); 14. Formik asit (15.2 dakika); 15. Fumarik asit (18.6 dakika). d) p -CA'nın yapısı . Tablo 2


        Tablo 2. EVO'nun HPLC ile belirlenen fenolik ve organik asit bileşimleri.
        1 6.33 gallik asit 0.8 ± 0.02
        2 10.05 Protokatekuik asit 18.5 ± 1.90
        3 12.81 Kateşin hidrat 235.9 ± 5.80
        4 14.09 4-Hidroksibenzoik asit 41.7 ± 3.40
        5 15.89 Kafeik asit 5.2 ± 1.20
        6 16.50 Siringik asit 3.4 ± 0.20
        7 20.24 Rutin trihidrat 13.1 ± 0.20
        8 21.19 Trans-p-kumarik asit 280.5 ± 10.80
        9 23.20 Trans-ferulik asit 1.2 ± 0.05
        10 31.34 Trans-resveratrol 0.4 ± 0.01
        11 36.41 Naringenin 20.3 ± 1.20
        12 9.02 Sitrik asit 1198.1 ± 16.90
        13 12.5 Maleik asit 1.2 ± 0.20
        14 15.2 Formik asit 349.6 ± 5.10
        15 18.6 Fumarik asit 0.73 ± 0.10
        SS: Standart sapma; RT: Saklama süresi; ppm: Milyon başına parça; min: Dakika.

        Kateçin hidrat önemli IC ile insan servikal ve göğüs kanseri hücre hatlarının çoğalmasını inhibe 50 196,07 ug / mL ve 127,62 ug sırasıyla / mL değerleri (Alshatwi, 2010; El-Hazzani ve Alshatwi, 2011) .Citric asit, bir iyi- bilinen antioksidan bileşik, reaktif oksijen türlerini (ROS) temizleyerek makromoleküllerin oksidasyonunu önler. 400-1600 µg / mL aralığında sitrik asit muamelesinin hücre apoptotik indeksini artırdığı bulunmuştur (Chen ve diğerleri, 2017). Karacelik vd. (2015) ayrıca EVO'nun rutin, epikateşin, kateşin, prosiyanidin B2, prosiyanidintrimer ve proantosiyanidin dimer monoglikozidine sahip olduğunu göstermiştir. Ayrıca Velioğlu ve ark. (2006) EVO'da kateşin ve kuersetin konsantrasyonlarını sırasıyla 290.4 mg / kg ve 52.1 mg / kg olarak bildirmişlerdir. p- CA, insan kolon ve rahim ağzı kanserleri üzerinde antikarsinojenik etkilere sahiptir ve HT-29 ve SW-480 hücrelerinin proliferasyonunu inhibe ettiği gösterilmiştir (Sharma ve diğerleri, 2018). Dahası, EVO, sitrik asidin mitokondriyal yolla apoptozu indüklediği sınırlı miktarda organik asit içerir (Ying ve diğerleri, 2013).

        EVO daha sonra Tablo 3'te gösterildiği gibi DPPH ve CUPRAC deneyleri kullanılarak antioksidan kapasitesi açısından değerlendirildi. Bitki özütünün, DPPH radikallerine karşı konsantrasyona bağlı inhibe edici aktiviteye sahip olduğu bulundu. DPPH radikal Evo inhibisyonu yüzdesi 24.53 ± 0, 30.02 ± 0.34, 43.02 ± 1.74, 61.14 ± 1.98, ve 25 ° C'de 89.99 ± 0.78, 50, 100, 200, ve 400 ug / ml konsantrasyonlarda, sırası IC edildi 50 EVO'nun DPPH radikal temizleme kapasitesi değeri 156.51 ± 1.12 µg / mL idi. Bitki ekstraktının bakır iyon azaltıcı antioksidan kapasitesi 44.06 ± 1.55 gallik asit eşdeğeri (mg / g ekstrakt) olarak belirlendi. Altun vd. (2008) V. opulus'un farklı kısımlarından hazırlanan su ekstraktlarının antioksidan özelliklerini araştırdılar. . Meyve özü, IC ile DPPH süpürücü aktivite gösterdi 50 57 ug / mL değerine. Toplam fenolik içerik gallik asit standart eğrisinden (y = 0.0074x + 0.1064; R2 = 0.9957) elde edilen denkleme göre belirlenirken, toplam flavonoid içeriği quercetin standart eğrisinden elde edilen denkleme göre hesaplandı (mg / g özü) (y = 0.0043x + 0.0588; R2 = 0.9991). EVO'nun toplam fenolik içeriği 310.07 ± 2.20 mg GAE / g özüt olarak hesaplandı ve toplam flavonoid içeriği 5.86 ± 0.40 mg QE / g özüt olarak bulundu. Önceki bir çalışmada, V. opulus'un taze ve pastörize edilmiş meyve sularının toplam fenolik içerikleri sırasıyla 351.26 ± 27.73 ve 330.40 ± 29.46 mg GAE / 100 mL idi (Cam ve Hisil, 2007). Ayrıca Karacelik ve ark. (2015), meyve suyu ile tohum ve kabuklardan hazırlanan metanol, asetonitril ve su ekstraktlarının antioksidan aktivitesini ayrı ayrı araştırmıştır. Meyve suyunda en yüksek aktiviteyi buldular (bizim sonucumuzdan 2,5 kat daha fazla). Bu çalışmada meyve kısımlarını ayırmadan metanol ekstresi yaptık; bu nedenle, sonuçlarının bizimkinden daha yüksek olması anlaşılabilir. EVO'nun karakteristik özelliklerinin belirlenmesinden sonra, EVO ve p'nin antiproliferatif aktivitesini inceledik. İnsan kolorektal karsinom hücrelerine (DLD-1, HT-29, SW-620 ve Caco-2) ve insan kolon epitel hücresine (CCD-18Co) karşı -CA. Alamar Blue deneyi yapıldı ve hücreler, 48 saat EVO ve p -CA ile işleme tabi tutuldu. , DLD-1, HT-29, SW-620, ve EVO belirgin bir şekilde ve seçici olarak proliferasyonunu inhibe Caco-2 hücreleri, IC ile, Şekil 2a'da gösterildiği gibi, 50 254.3 ug / mL, 553.3 ug / mL, 327.4 ug / mL değerlerine Sırasıyla 714,6 ug / mL (P <0.0001). EVO ve p -CA, DLD-1 ve HT-29 hücrelerinin proliferasyonunu doza bağlı bir şekilde inhibe etti. Kanserli hücrelerdeki genetik ve moleküler mekanizmalar birbirinden farklıdır. Bu nedenle bu hücreler kimyasal maddelere karşı farklı davranışlara sahiptir. SW-620'nin hücreleri en güçlü Wnt sinyal takipçileri iken, DLD-1 en düşük seviyededir. DLD-1 hücrelerinde maksimum inhibitör etki bulundu. Biz antiproliferatif etkileri araştırıldı s , bu hücre soyu üzerinde -CA ve IC 50 değeri p DLD-1 hücre üzerinde -CA 223 uM (Şekil 2b) olarak hesaplanmıştır. Aynı zamanda, bu kanıtlanmıştır s IC ile -C-inhibe HT-29 ve CaCo-2 hücreleri 50değerleri sırasıyla 1.5 mM ve 1.6 mM'dir (Jaganathan vd., 2013). Diğer yandan sağlıklı kolon epitel hücrelerin yaşama kabiliyeti (CCD-18Co) hafif EVO ve sonra engellenmiştir s IC içinde -C-tedavi 50 teorik olarak 2117 ug / mL olarak sigmoidal grafiğinden (> 2 mg / ml) hesaplandı ve sırasıyla 1,6 mM (Şekil 2b). Şekil 2c ve 2d, EVO ve p -CA'nın DLD-1 hücrelerinin büyümesi üzerinde sitotoksik potansiyele sahip olduğunu ve doza bağımlı bir şekilde hücrelerin çoğalmasını engellediğini gösterir. EVO yüksek miktarda p- içerir Karboksilik ve fenolik OH gruplarına sahip CA ve fenolik OH gruplarına sahip kateşin hidrat. Karboksilik grup, fenolik OH'den çok daha asidiktir ve enzimleri ve DNA'yı protonlayabilirken, fenolik OH, enzimler ve DNA ile bir hidrojen bağı oluşturur. Biyoflavonoidler, farklılaşma ve apoptozu, hücresel kanserojen indüksiyonunun blokajını, hücresel proliferasyonu, tümör hücresi adezyonunu ve anjiyogenezi teşvik etme yeteneklerine dayanan geniş antikanser özelliklerine sahiptir (De Kok ve diğerleri, 2008). Bazı kemoterapötik bileşikler, düşük konsantrasyonlarda yüksek sitotoksisiteye sahiptir. Bununla birlikte, bu bileşikler çok sınırlı kullanıma sahiptir çünkü sağlıklı hücrelere olduğu kadar kanserli hücrelere de zarar verebilirler (Evdokiou ve diğerleri, 2002; Beijers ve diğerleri, 2012). Bu nedenle, Doz seçiminde kanserli hücreleri etkileyen ancak sağlıklı hücreleri etkilemeyen dozun belirlenmesi çok önemlidir. IC50 EVO değeri, insan kolorektal karsinom hücre hattı DLD-1 için 254.3 ug / mL iken, sağlıklı insan kolon epitel hücre hattı, CCD-18Co için 2 mg / mL'den fazlaydı. Orta sitotoksisite ve güvenli EVO konsantrasyonu, kolorektal kanser tedavisi için dengede görünmektedir.
        Resim, illüstrasyon vb. İçeren harici bir dosya. Nesne adı turkjbio-44-252-fig002.jpg
        şekil 2
        EVO ve p -CA'nın insan CRC hücrelerinin proliferasyonu üzerindeki etkileri ; Caco-2, DLD-1, HT-29, SW-620 ve sağlıklı kolon epitel hücresi; CCD-18Co hücreleri. a) EVO ve p- CA'nın Alamar Blue testi ile ölçülen insan CRC hücrelerinin proliferasyonu üzerindeki etkileri . b) IC 50 hücre canlılığı vs değerleri belirlenmiştir sigmoidal arsa EVO log (ug / mL) ve log s -C-(uM) konsantrasyonu. c) DLD-1 hücrelerine karşı EVO ve p-CA'nın doza bağlı inhibisyonunun ısı haritası analizleri. Hücre canlılığı kırmızıdan maviye düşürüldü. d) EVO ve p'nin etkileri DLD-1 hücrelerinin büyümesi üzerine -CA, otomatik hücre sayacı ile izlendi. Gösterilen sonuçlar, bağımsız olarak gerçekleştirilen üç deneyin temsilcisidir. NT: Tedavi edilmemiş; ***: P <0,001; g: μM. Tablo 3


        EVO'nun antioksidan kapasitesi, toplam fenolik ve flavonoid içeriği.
        EVO 156.51 ± 1.12 44.06 ± 1.55 310.07 ± 2.20 5.86 ± 0.40
        Quercetin 12.04 ± 0.87 - - -
        SS: Standart sapma; GAE: Gallik asit eşdeğeri; QE: Quercetin eşdeğeri.

        EVO ile tümör hücresi (DLD-1) büyümesinin inhibisyon etkisinin moleküler mekanizmasını açıklığa kavuşturmak için, hücre döngüsü ve apoptoz akış sitometrisi ile incelenmiştir. 48 saat boyunca 254 ug / mL EVO ile tedaviyi takiben, EVO grupları, NT (tedavi edilmemiş) gruplarına kıyasla hücre döngüsünde istatistiksel olarak önemli farklılıklar gösterdi. G2 / M kontrol noktasında, G2 fazında hücre birikimi ile bir hücre döngüsü tutuklaması gözlemlendi. EVO ile tedaviyi takiben, G2 fazındaki ve Freq Super-G2'deki hücrelerin oranı azaldı (1,7 kat) ve Freq Sub-G1'deki hücrelerin yüzdesi, NT grubuna kıyasla (sırasıyla% 1,24 ve% 0,54 ) (Şekil 3a – 3b). DLD-1 hücrelerinin artan Sub-G1 birikimi apoptozu doğruladı. p -CA'nın ayrıca Caco-2 ve HT-29 hücrelerinde Sub-G1 ve G2 fazlarını arttırdığı da gösterilmiştir. Burada, EVO'nun apoptoz üzerindeki etkilerini araştırmaya başladık (Şekil 3c – 3d). 48 saatlik EVO tedavisi, kontrol grubuna göre% 70 daha fazla apoptozu indükledi. NT grubundaki apoptotik ve nekrotik oranlar şu şekildedir: nekroz% 2.72; geç apoptoz% 5.86; erken apoptoz% 4.45; canlı hücreler% 86.97. EVO ile tedavi edilen grupta oranlar aşağıdaki gibidir: nekroz% 5,42; geç apoptoz% 12.18; erken apoptoz% 5.70; canlı hücreler% 76.70. DLD-1 hücrelerinin ilgili apoptozisi önemli ölçüde artmıştır, bu da DLD-1 hücresinin zar bütünlüğünün bozulduğunu ve çekirdeğin hücreden salındığını kanıtlamıştır. Ayrıca p olduğu kanıtlandı -CA tedavisi DLD-1 hücrelerinde apoptotik hücre oranını artırdı. Öte yandan, apoptotik oranlar HT-29 hücrelerinde önemli ölçüde değişmedi. EVO'nun insan kolorektal karsinom hücrelerinin proliferasyonu üzerindeki moleküler mekanizmasını açıklığa kavuşturmak için, TGFβ, WNT, MAPK, PI3K-Akt ve p53 sinyal yolakları dahil olmak üzere sinyal iletim yollarındaki anahtar enzimlerin protein ekspresyonunu araştırdık (Şekil 4). IC ile eşdeğer EVO konsantrasyonunun tedaviden sonra 50tümör baskılayıcı p53 ve SMAD4'ün protein ekspresyonu önemli ölçüde artmıştır [sırasıyla 1.43 kat (P <0.0001) ve 1.39 kat (P = 0.0011)]. CRC'de p53 protein seviyesinin modülasyonu yaygın olarak görülür; dönüm noktası işareti ve klinikopatolojik özelliklerle ilişkisi hala şüphelidir. Bazı çalışmalar p53 protein seviyeleri ile klinikopatolojik özellikler arasında bir ilişki bildirmemiş olsa da, bazı çalışmalar p53 ekspresyonunun metastatik dönemle ilişkili olduğunu göstermiştir (Aladhraei ve ark., 2019). Yine de, Cao ve ark. (2017), CRC tümörlerinde p53 ekspresyon eksikliğinin bildirildiğini ve lenf nodu metastazı ve progresif tümör gelişimi dahil olmak üzere daha kötü bir klinikopatolojik yanıtla ilişkili olduğunu, çünkü insan kanserlerinin% 50'sinden fazlasının TP53gene'de fonksiyon mutasyonları kusurları sunduğunu belirtti. Dolayısıyla Sonuçlarımız, CRC hücrelerinde p53'ün protein ekspresyonunun, CRC ilerlemesine karşı yararlı bir etki sağlayabilen EVO uygulamasıyla arttığını ortaya koydu. TGF-β1 indüksiyonu, SMAD sinyalizasyonunun aktivasyonunu destekler. Önceki çalışmalar, TGFβ sinyallemesinin kanser hücresi proliferasyonunu, istilasını ve metastazı indüklediğini ve TGF-21 blokajının metastatik kanser gelişimini inhibe ettiğini göstermiştir. Bu nedenle, CRC tedavisi için kullanılan TGF-21 inhibisyonunun bağlantısının acil bir şekilde açıklığa kavuşturulması gerekir (Massague, 2008). Sonuçlarımıza göre, SMAD4'ün protein ekspresyonu, kontrol grubuna göre 1.39 kat daha yüksek bulundu. Jiang vd. (2018), selastrolün CRC hücrelerinde SMAD4'ün mRNA ve protein ekspresyonunu önemli ölçüde önleyen etkili bir ilaç olduğunu bildirdi. SMAD4, CRC'de sıklıkla eksik olan, G1 / S hücre döngüsünde G1 döngüsünde bekleyen hücrelerin durdurulmasında rol oynar ve bu nedenle hücre döngüsü durmasına neden olur (Zhao ve diğerleri, 2018). Ayrıca, CRC hücrelerinin EVO ile işlenmesi, SMAD4'ün daha yüksek mRNA ve protein ekspresyonu ile sonuçlandı. Bu, EVO'nun koruyucu bir etkisi olarak kabul edilebilir. Bu nedenle, SMAD4'ün yükselmesi, CRC hücrelerinin G1 fazındaki hücre döngüsünü durdurmasına neden olur ve bu da tümör baskılamasına yol açabilir. BRAF, MAPK kaskadı içinde bir pozitif modülatör olarak hücre trafiğinde önemli bir işleve sahiptir. RAF, hücre dışı endikasyonlara karşı hücresel farklılaşma, proliferasyon, yaşlanma ve hayatta kalmayı düzenlemede merkezi bir işlevi olan RAS –– RAF – MEK – ERK hücre sinyal zincirinin bir üyesidir (Caronia ve diğerleri, 2011). BRAF ekspresyonu, erken evre CRC hastalarına kıyasla terminal evre KRK hastalarında artmıştır (P = 0.080) (Kwon ve diğerleri, 2018). Hipofiz adenomlarının en yüksek BRAF mRNA ve protein ekspresyonlarına sahip olduğu bulunmuştur (Ewing ve diğerleri, 2007). Endometrial hücreler, kontrol hücrelerine kıyasla 2.4 kat daha yüksek BRAF aktivitesi ifade ettiler ve bu nedenle RAS / RAF / MAPK sinyallemesinin anormal aktivasyonuna neden oldu (Yotova ve diğerleri, 2011). EVO tedavisi, kontrol grubu ile karşılaştırıldığında BRAF protein ekspresyonunu önemli ölçüde azalttı (% 21; P = 0.014). Bu nedenle, bulgularımıza göre, BRAF protein ekspresyonu, CRC hücrelerinde EVO aracılığıyla azaltılabilir. Kontrol hücrelerine kıyasla 4 kat daha yüksek BRAF aktivitesi ve bu nedenle RAS / RAF / MAPK sinyallemesinin anormal aktivasyonuna neden oldu (Yotova ve diğerleri, 2011). EVO tedavisi, kontrol grubu ile karşılaştırıldığında BRAF protein ekspresyonunu önemli ölçüde azalttı (% 21; P = 0.014). Bu nedenle, bulgularımıza göre, CRC hücrelerinde BRAF protein ekspresyonu EVO yoluyla azaltılabilir. Kontrol hücrelerine kıyasla 4 kat daha yüksek BRAF aktivitesi ve bu nedenle RAS / RAF / MAPK sinyallemesinin anormal aktivasyonuna neden oldu (Yotova ve diğerleri, 2011). EVO tedavisi, kontrol grubu ile karşılaştırıldığında BRAF protein ekspresyonunu önemli ölçüde azalttı (% 21; P = 0.014). Bu nedenle, bulgularımıza göre, CRC hücrelerinde BRAF protein ekspresyonu EVO yoluyla azaltılabilir.
        Resim, illüstrasyon vb. İçeren harici bir dosya. Nesne adı turkjbio-44-252-fig003.jpg
        Figür 3
        Akış sitometresi ile belirlenen DLD-1 hücrelerinin temsili hücre döngüsü ve apoptoz profili. a) ve c) Tedavi edilmeyen (NT) grubun hücre döngüsü ve apoptoz analizleri, b) ve d) EVO ile tedavi edilen grubun (n = 3). DNA, hücre döngüsü ve apoptoz analizleri için sırasıyla PI ve 7-AAD ile boyandı.

        Resim, illüstrasyon vb. İçeren harici bir dosya. Nesne adı turkjbio-44-252-fig004.jpg
        Şekil 4
        EVO'nun kolorektal karsinomda sinyal yollarında anahtar proteinlerin protein ekspresyonu üzerindeki etkileri. a) Tedavi edilmemiş (NT) ve EVO gruplarında DLD-1 proteininin immünoblot bantları. b) NT ve EVO gruplarının kantitatif bant yoğunluğu analizi. Deneyler en az 3 kez tekrarlandı (n = 6). (*: P = 0.0140), (**: P = 0.0011) ve (***: P <0.0001) istatistiksel olarak anlamlı bir farkı belirtir.

        Protein ifadelerindeki değişikliğin kökenini anlamak için TP53, BRAF, KRAS, SMAD4, APC ve MLH genlerinin mRNA ekspresyonunu araştırdık (Şekil 5). Tümör baskılayıcı genler TP53 ve SMAD4'ün mRNA ekspresyonu önemli ölçüde (P <0.0001) sırasıyla 1.54 kat ve 3.03 kat artmıştır. Öte yandan, BRAF'ın mRNA ekspresyonu, EVO tedavisinden sonra önemli ölçüde (P <0.0001) azaldı (% 41). Önceki araştırmalar, SMAD4'ün kolon metastazlarının ilerlemesi ile derin bir şekilde ilişkili olduğunu ve kolon kanseri metastazında kritik bir antimetastatik role sahip olduğunu göstermiştir (Yan ve diğerleri, 2018). Sheng ve diğerleri (2019), MiR-144'ün insan kolon kanseri hücrelerinin istilasını engellediğini bildirdi. Transfekte SW620 kolorektal karsinoma hücreleri, daha düşük SMAD4 ekspresyonu gösterdi. Ayrıca SMAD4'ün çalışmadaki CRC vakalarının% 30-40'ında saptandığını, adenomdan karsinoma ilerlemede geç evrelerde ortaya çıktığını ve karaciğer metastazlarına neden olduğunu bildirdiler; bu vakalar kemoterapi ile daha kötü bir sonuca ve ardından kötü bir prognoza sahiptir. Çalışmamızda SMAD4 yükseldi. SMAD4 tümör baskılayıcı gen ürünü, TGF-β aracılı sinyallemeyi azaltır ve CRC'nin ~% 10'unda kusurludur. Chang vd. (2019), hedeflenen ekzom dizilimi yardımıyla MSH3, MSH6, APC ve PIK3CA'nın daha yüksek silme oranlarının bulunduğu sonucuna varmıştır. CRC'de önemli bir rol bildirdiler ve RAF (% 9,38), APC (% 59,38), TP53 (% 50), RAS (% 28,13) ve SMAD4'te (% 9,38) yaygın delesyonlar buldular. Tümör baskılayıcılara ve onkojenlere ek olarak , DNA onarım enzimi MLH1 ve WNT sinyal yolağı düzenleyici gen APC'nin mRNA ekspresyonu da EVO tedavisi ile önemli ölçüde inhibe edildi (sırasıyla% 44 ve% 40). APC, CRC'de daha yüksek bir silinme insidansı ile genel olarak bir tümör baskılayıcı gen olarak adlandırılır. APC hem germ hattı hem de somatik adımlarda bozuktur (Zhang ve Shay, 2017). Protein ve mRNA ekspresyonlarının sonuçları birlikte değerlendirildi; protein ifadelerinin değişmesinin nedeni, mRNA ifadelerindeki değişiklik gibi görünmektedir.
        Resim, illüstrasyon vb. İçeren harici bir dosya. Nesne adı turkjbio-44-252-fig005.jpg
        Şekil 5
        EVO'nun sinyal transdüksiyonu anahtar enzim kodlayan genlerin mRNA ekspresyonu üzerindeki etkileri; DLD-1 hücrelerinin TP53, BRAF, KRAS, SMAD4, APC ve MLH'si. MRNA ifadelerindeki değişiklikler qRT-PCR ile değerlendirildi. Sonuçlar göreceli ortalama ± SD (n = 4) idi. Bir temizlik geni olarak GAPDH kullanıldı. Kat değişimi 2 -ΔΔCt ile hesaplandı . Gruplar istatistiksel olarak Student's t-testi ile analiz edildi. ***: P <0.00.

        Şuraya gidin: 4. Sonuç


        Bu çalışmada, şifalı bitki V. opulus ve ana aktif bileşeni olan p- CA'nın insan kolorektal karsinomuna karşı sitotoksik etkilerinin moleküler mekanizmasını açıklıyoruz. Her ikisi de insan CRC hattı DLD-1'in proliferasyonunu önemli ölçüde inhibe ederken, sağlıklı kolon hücrelerine karşı önemli bir etki gözlenmedi. EVO ve p -CA yukarı / aşağı düzenlenmiş CRC anahtar geni ve protein ekspresyonları. Bu genlerin modülasyonu, TGF-β, MAPK, Wnt ve PI3K-Akt sinyal yolaklarında önemli rollere sahip diğer 186 geni etkiler. Ek olarak, EVO ve p -CA , Bax ve Bcl-2'yi değiştirerek apoptozu önemli ölçüde artırdı. Bu nedenle, EVO ve aktif bileşiği p- CA, CRC'ye karşı umut verici bir terapötik ajan olabilir.

        Şuraya gidin: Teşekkür


        Bu proje Türkiye Bilimsel ve Teknolojik Araştırma Kurumu (TÜBİTAK) tarafından 217Z279 sayılı hibe ile finanse edilmiştir.

        Şuraya gidin: Referanslar
        • Aladhraei M Al-Salami E Poungvarin N Suwannalert P Yemenli hastalarda kolorektal kanser progresyonunda p53 ve XPO1'in rolleri. Gastrointestinal Onkoloji Dergisi. 2019; 10 : 437–444. [ PMC ücretsiz makale ] [ PubMed ] [ Google Scholar ]
        • Al-Hazzani AA Alshatwi AA Kateşin hidrat, SiHa insan servikal kanser hücrelerinin proliferasyonunu inhibe eder ve apoptozuna aracılık eder. Gıda ve Kimyasal Toksikoloji. 2011; 49 : 3281–3286. [ PubMed ] [ Google Scholar ]
        • Alshatwi AA Catechin hidrat, TP53 / Kaspaz aracılı apoptoz yoluyla MCF-7 proliferasyonunu baskılar. Deneysel ve Klinik Kanser Araştırmaları Dergisi. 2010; 29 : 167–167. [ PMC ücretsiz makale ] [ PubMed ] [ Google Scholar ]
        • Apak R Guclu K Özyürek M Karademir SE Neokuproin varlığında bakır iyon azaltma yeteneklerini kullanan diyet polifenolleri ve C ve E vitaminleri için yeni toplam antioksidan kapasite indeksi: CUPRAC yöntemi. Tarım ve Gıda Kimyası Dergisi . 2004; 52 : 7970–7981. [ PubMed ] [ Google Scholar ]
        • Beijers AJ Jongen JL Vreugdenhil G Kemoterapi kaynaklı nörotoksisite: nöroprotektif stratejilerin değeri. Hollanda Tıp Dergisi. 2012; 70 : 18–25. [ PubMed ] [ Google Scholar ]
        • Brand-Williams W Cuvelier ME Berset C Antioksidan aktiviteyi değerlendirmek için bir serbest radikal yönteminin kullanılması. Gıda Bilimi ve Teknolojisi. 1995; 28 : 25–30. [ Google Scholar ]
        • Cam M Hisil Y Gilaburu (Viburnum opulus L.) Acta Alimentaria'nın taze ve pastörize edilmiş meyve suyunun kimyasal özelliklerinin karşılaştırılması . 2007; 36 : 381–385. [ Google Scholar ]
        • Cao DZ Ou XL Yu T p53 ekspresyon düzeylerinin kolon kanserli hastaların ameliyat sonrası klinikopatolojik özellikleri ve prognozu ile ilişkisi. Onkoloji Mektubu. 2017; 13 : 3538–3546. [ PMC ücretsiz makale ] [ PubMed ] [ Google Scholar ]
        • Caronia LM Phay JE Shah MH Tiroid onkogenezinde BRAF'ın rolü. Klinik Kanser Araştırması. 2011; 17 : 7511–7517. [ PubMed ] [ Google Scholar ]
        • Çelik G Semiz A Karakurt S Gencler-Özkan AM Arslan S Epilobiumhirsutum ekstresi ve bileşen ellagik asidin ilaç metabolize edici enzimler üzerindeki inhibe edici etkisi. Avrupa İlaç Metabolizması ve Farmakokinetik Dergisi. 2016; 41 : 109–116. [ PubMed ] [ Google Scholar ]
        • Ceylan D Aksoy A Ertekin T Yay AH Nisari M Farelerde gilaburu (Viburnum opulus) suyunun deneysel olarak indüklenmiş ehrlich assit tümörü üzerindeki etkileri. Journal of Cancer Research and Therapeutics. 2018; 14 : 314–320. [ PubMed ] [ Google Scholar ]
        • Chang CC Yang MH Wen HM Chern JC ( Journal of Food and Drug Analysis. 2002; 10 : 178–182. [ Google Scholar ]
        • Chang YS Lee CC Ke TW Chang CM Chao DS Tayvanlı bir popülasyonda tam ekzom dizileme kullanılarak kolorektal kanserin moleküler karakterizasyonu. Kanser Tıbbı. 2019; 8 : 3738–3747. [ PMC ücretsiz makale ] [ PubMed ] [ Google Scholar ]
        • Chen X Lv Q Liu Y Deng W Gıda katkı maddesi sitrik asidin insan özofagus karsinom hücre hattı EC109'un büyümesi üzerindeki etkisi. Cell Journal. 2017; 18 : 493–502. [ PMC ücretsiz makale ] [ PubMed ] [ Google Scholar ]
        • Cunningham D Atkin W Lenz HJ Lynch HT Minsky B Kolorektal kanser. Lancet. 2010; 375 : 1030–1047. [ PubMed ] [ Google Scholar ]
        • Dawood M Ooko E Efferth T Partenolid'in NF-kappaB ve HIF-α inhibisyonu yoluyla kollateral duyarlılığı ve ilaca dirençli kanser hücre dizilerindeki epigenetik değişiklikler. Farmakolojide Sınırlar. 2019; 10 : 542–542. [ PMC ücretsiz makale ] [ PubMed ] [ Google Scholar ]
        • De Kok TM Van Breda SG Manson MM Farklı kemopreventif diyet bileşiklerinin kombine etki mekanizmaları: bir inceleme. Avrupa Beslenme Dergisi. 2008; 2 : 51–59. [ PubMed ] [ Google Scholar ]
        • Evdokiou A Bouralexis S Atkins GJ Chai F Hay S Ewing I Pedder-Smith S Franchi G Ruscica M Emery M Kemoterapötik ajanlar, osteojenik sarkom hücrelerini Apo2L / TRAIL kaynaklı apoptoza duyarlı hale getirir, ancak normal insan kemik hücrelerini hassaslaştırmaz. Uluslararası Kanser Dergisi. 2002; 99 : 491–504. [ PubMed ] [ Google Scholar ]
        • Vse o jagodach –Novaja enciklopedia dacnika. 2000. sayfa 311–387.
        • 2012 yılında dünya çapında tahmini kanser insidince, mortalite ve prevalans. 2014. s. 11–11.
        • Jaganathan SK Supriyanto E Mandal M HCT-15 kolon kanseri hücrelerinde p-kumarik asidin apoptotik etkisiyle ilişkili olaylar. Dünya Gastroenteroloji Dergisi. 2013; 19 : 7726–7734. [ PMC ücretsiz makale ] [ PubMed ] [ Google Scholar ]
        • Janicke B Hegardt C Krogh M Onning G Akesson B Diyet lifi fenolik bileşiklerinin ferulik asit ve p-kumarik asidin Caco-2 hücrelerinin hücre döngüsü üzerindeki çoğalmayı önleyici etkisi. Beslenme ve Kanser. 2011; 63 : 611–622. [ PubMed ] [ Google Scholar ]
        • Jiang B Zhao W Shi M Zhang J Chen A IDH1 Arg-132 mutantı, p53'ü aşağı regüle ederek tümör oluşumunu teşvik eder. Biyolojik Kimya Dergisi. 2018; 293 : 9747–9758. [ PMC ücretsiz makale ] [ PubMed ] [ Google Scholar ]
        • Johnson CM Wei CM Ensor JE Smolenski DJ Amos CI Kolorektal kanser risk faktörlerinin meta analizleri. Kanser Nedenleri ve Kontrolü. 2013; 24 : 1207–1222. [ PMC ücretsiz makale ] [ PubMed ] [ Google Scholar ]
        • Karacelik AA Küçük M İskefiyeli Z Aydemir S De Smet Viburnum opulus L.'nin antioksidan bileşenleri, on-line HPLC-UV-ABTS radikal süpürme ve LC-UV-ESI-MS yöntemleri ile belirlenmiştir. Gıda Kimyası . 2015; 175 : 106–114. [ PubMed ] [ Google Scholar ]
        • Karakurt S Adali O Tannik asit prostat kanserinin proliferasyonunu, göçünü, invazyonunu inhibe eder ve ilaç metabolizmasını ve antioksidan enzimleri modüle eder. Tıbbi Kimyada Anti-Kanser Ajanlar. 2016; 16 : 781–789. [ PubMed ] [ Google Scholar ]
        • Karakurt S Semiz A Çelik G Gencler-Özkan AM Sen A Ellagik asidin tıbbi bitki Epilobiumhirsutum'un antioksidan potansiyeline katkısı. Beslenme ve Kanser. 2016; 68 : 173–183. [ PubMed ] [ Google Scholar ]
        • Kızılay F Ülker V Çelik O Özdemir T Çakmak O Gilaburu (Viburnum opulus L.) ekstresinin distal üreter taşlarının medikal çıkarım tedavisinde etkinliğinin değerlendirilmesi. Türk Üroloji Dergisi. 2019; 45 : 63–69. [ PMC ücretsiz makale ] [ PubMed ] [ Google Scholar ]
        • Kwon JH Jeong BK Yoon YS Yu CS Kim J BRAF V600E mutasyonunu barındıran kolorektal kanser için bir tarama aracı olarak BRAF VE1 immünohistokimyasının kullanımı. Journal of Pathology and Translational Medicine. 2018; 52 : 157–163. [ PMC ücretsiz makale ] [ PubMed ] [ Google Scholar ]
        • Massague J TGFbeta kanserde. Hücre. 2008; 134 : 215–230. [ PMC ücretsiz makale ] [ PubMed ] [ Google Scholar ]
        • Moldovan B David L Vulcu A Olenic L Perde-Schrepler M Viburnum opulus L. meyve özü kullanılarak yeşil sentezlenmiş gümüş nanopartiküllerin in vitro ve in vivo anti-inflamatuar özellikleri. Biyolojik Uygulamalar için Malzeme Bilimi ve Mühendisliği C-Malzemeleri. 2017; 79 : 720–727. [ PubMed ] [ Google Scholar ]
        • Moldovan B Ghic O David L Chisbora C Cranberrybush (Viburnum opulus L.) meyve özütünün toplam fenol içeriği ve antioksidan aktivitesi üzerinde depolamanın etkisi. Revista De Chimie. 2012; 63 : 463–464. [ Google Scholar ]
        • Namani A Li J Wang XJ Tang X Kolorektal kanserin önlenmesine yönelik bileşiklerin bir incelemesi. Güncel Farmakoloji Raporları. 2017; 3 : 221–231. [ Google Scholar ]
        • Russell W Duthie G Bitki ikincil metabolitleri ve bağırsak sağlığı: fenolik asitler için durum. Beslenme Derneği Bildirileri. 2011; 70 : 389–396. [ PubMed ] [ Google Scholar ]
        • Sharma SH Rajamanickam V Nagarajan S p-kumarik asidin antiproliferatif etkisi, kolon kanserinde Grp78'i aşağı regüle ederek UPR aktivasyonunu hedefler. Kimyasal-Biyolojik Etkileşimler. 2018; 291 : 16–28. [ PubMed ] [ Google Scholar ]
        • Sheng S Xie L Wu Y Ding M Zhang T MiR-144, SMAD4'ü aşağı regüle ederek kolon kanserinde büyümeyi ve metastazı inhibe eder. Bioscience Raporları. 2019; 39 [ PMC ücretsiz makale ] [ PubMed ] [ Google Akademik ]
        • Slinkard K Singleton VL Toplam fenol analizleri: otomasyon ve manuel yöntemlerle karşılaştırma. Amerikan Enoloji ve Bağcılık Dergisi. 1977; 28 : 49–55. [ Google Scholar ]
        • Ülger H Ertekin T Karaca O Canoz O Nisari M gilaburu (Viburnum opulus) suyunun 1,2-dimetilhidrazin (DMH) ile indüklenen kolon kanseri üzerindeki etkisi. Toksikoloji ve Endüstriyel Sağlık. 2013; 29 : 824–829. [ PubMed ] [ Google Scholar ]
        • Velioğlu S Avrupa yaban mersini (Viburnum opulus L.) meyvelerinin fenolik bileşimi ve ticari suyunun burukluk giderimi. Uluslararası Gıda Bilimi ve Teknolojisi Dergisi. 2006; 41 : 1011–1015. [ Google Scholar ]
        • Wang D Zhang Z Li Y Xu C Yu Y Adenomatöz polipoz koli gen mutasyonları, ailesel adenomatöz polipozlu 22 Çinli soy ağacında. Tıp Bilimi Monitörü. 2019; 25 : 3796–3803. [ PMC ücretsiz makale ] [ PubMed ] [ Google Scholar ]
        • Wu MS Chien CC Chang J Chen YC İnsan kolorektal karsinom hücrelerinde hem oksijenaz-1'in endoplazmik retiküler stres yoluyla pro-apoptotik etkisi. Hücresel ve Moleküler Tıp Dergisi. 2019; 23 : 5692–5704. [ PMC ücretsiz makale ] [ PubMed ] [ Google Scholar ]
        • Yan W Liu Z Yang W Wu G miRNA ekspresyon profilleri, Smad4-pozitif ve Smad4-negatif SW620 insan kolon kanseri hücrelerinde, yeni nesil küçük RNA sekanslama ile tespit edildi. Kanser Yönetimi ve Araştırması. 2018; 10 : 5479–5490. [ PMC ücretsiz makale ] [ PubMed ] [ Google Scholar ]
        • Ying TH Chen CW Hsiao YP Hung SJ Chung JG Sitrik asit, kaspaz- Antikanser Araştırması yoluyla insan ölümsüzleştirilmiş keratinosit hücre hattının (HaCaT) hücre döngüsü tutuklanmasına ve apoptozuna neden olur . 2013; 33 : 4411–4420. [ PubMed ] [ Google Scholar ]
        • Yotova IY Quan P Leditznig N Beer U Wenzl R Endometriozisli hastaların eutopik endometrial stromal hücrelerinde Ras / Raf / MAPK ve RhoA / ROCKII sinyal yollarının anormal aktivasyonu. İnsan Üreme. 2011; 26 : 885–897. [ PubMed ] [ Google Scholar ]
        • Zhang H Yang X Qin N Li X Yang H EGFR ve KRAS mutasyonunun akciğer adenokarsinomu ile saptanması ve analizi. Zhongguo Fei Ai Za Zhi. 2015; 18 : 686–690. [ PMC ücretsiz makale ] [ PubMed ] [ Google Scholar ]
        • Zhang L Shay JW APC'nin çoklu rolleri ve kolorektal kanserdeki terapötik etkileri. Ulusal Kanser Enstitüsü Dergisi. 2017; 109 [ PMC ücretsiz makale ] [ PubMed ] [ Google Scholar ]
        • Zhao M Mishra L Deng CX Kanserde TGF-beta / SMAD4 sinyalinin rolü. Uluslararası Biyolojik Bilimler Dergisi. 2018; 14 : 111–123. [ PMC ücretsiz makale ] [ PubMed ] [ Google Scholar ]
        Bitkisel Tedavi - İbrahim Gökçek Ürünleri Resmi Satış Sitesidir.

        Yorum yap


        • #5
          Gilaburu Nedir ? Faydaları Nelerdir ?

          Yorum yap


          • #6

            Evodia rutaecarpa
            JNK Aktivasyonu, İnsan Kolorektal Karsinom Hücrelerinde Evodiamine Bağlı Apoptoz ve G 2 / M Tutuklamasına Katkıda Bulunur : Evodiamin'in Yapı-Aktivite Çalışması
            Chih-Chiang Chien ,Ming-Shun Wu ,Shing-Chuan Shen ,Ching-Huai Ko,Chih-Hung Chen,Ling-Ling Yang,Yen-Chou Chen
            24 Haziran 2014 tarihinde yayınlandı.

            ÖZ
            Evodiamin (EVO; 8,13,13b, 14-tetrahidro-14-metilindolo [2′3′-3,4] pirido [2,1-b] kinazolin-5- [7H] -bir geleneksel bitkisel ilaçtan türetilmiş Evodia rutaecarpaantikanser aktiviteye sahip olduğu bildirildi; ancak antikanser mekanizması hala belirsizdir. Bu çalışmada, EVO'nun insan kolon COLO205 ve HT-29 hücreleri üzerindeki antikanser etkilerini ve bunların potansiyel mekanizmalarını araştırdık. MTT ve laktat dehidrojenaz (LDH) salım tahlilleri, COLOL205 ve HT-29 hücrelerinin canlılığının, apoptotik hücrelerin yüzdesindeki artışlara ve kaspaz-3 ve poli (ADP riboz) polimerazın bölünmesine göre çeşitli konsantrasyonlarda EVO tarafından inhibe edildiğini göstermiştir. (PARP) proteinleri. EVO tarafından mitokondriyal membran potansiyelinin bozulmasına, COLO205 ve HT-29 hücrelerinde artan Bax, kaspaz-9 protein bölünmesi ve sitokrom (Cyt) c protein translokasyonu eşlik etti. Antioksidan N-asetil-L-sistein (NAC) uygulaması H 2 O 2'yi inhibe ettiindüklenmiş reaktif oksijen türleri (ROS) üretimi ve apoptoz, ancak COLO205 veya HT-29 hücrelerinin EVO ile indüklenen apoptozunu etkilemedi. G önemli artışlar 2 EVO / E oranı ve cyclinB1 / cdc25C protein ifadesi sırasıyla, akış sitometrik analizinde ve Western blot ile kolon karsinoma hücrelerinde tespit edilmiştir. Hücre dışı sinyalle düzenlenen kinaz (ERK) ve c-Jun N-terminal kinaz (JNK) protein fosforilasyonunun indüksiyonu, EVO ile tedavi edilen hücrelerde tespit edildi ve JNK inhibitörü SP600125, ancak ERK inhibitörü U0126, EVO ile indüklenen inhibe etmedi. fosforile JNK protein ekspresyonu, apoptoz ve G 2/ M kolon karsinom hücrelerinin tutuklanması.
            Yapı-aktivite analizinin verileri, 14. pozisyonda bir alkil grubu içeren EVO ile ilgili kimyasalların apoptozu, artmış DNA merdiveni oluşumu, kaspaz-3 ve PARP bölünmesi ve yüksek sikB1 ile ilişkili G 2 / M tutukluğunu indükleyebildiğini gösterdi ve COLO205 ve HT-29 hücrelerinde cdc25c protein ekspresyonları. Kolon karsinom hücrelerinde EVO ile indüklenen apoptoza ve G 2 / M tutukluğuna yol açan JNK aktivasyonunu destekleyen kanıt sağlanır ve EVO'nun 14. pozisyonundaki alkilasyon, kolon kanserinin tedavisi için kritik bir ikamedir.Alıntı: Chien CC, Wu MS, Shen SC, Ko CH, Chen CH, Yang LL, et al. (2014) JNK Aktivasyonu, İnsan Kolorektal Karsinom Hücrelerinde Evodiamine Bağlı Apoptoz ve G 2 / M Tutuklamasına Katkıda Bulunur : Evodiamin'in Yapı-Aktivite Çalışması. PLoS ONE 9 (6): e99729. Editör: Malka Cohen-Armon, Tel-Aviv Üniversitesi, İsrail Alındı: 12 Şubat 2014; Kabul tarihi: 17 Mayıs 2014; Yayın: 24 Haziran 2014
            Rakamlar



            GİRİŞ
            Kolorektal kanser (CRC), yüksek mortaliteye sahip ikinci önde gelen kanserdir ve önemli bir küresel sağlık sorunu olmaya devam etmektedir [1] , [2] . CRC'yi tedavi etmek için cerrahi ve kemoterapi gibi birçok tedavi stratejisi kullanılmaktadır; ancak kemoterapinin sorunlu yan etkileri vardır ve cerrahi tedavi yüksek mortalite ve lokal nüks ile ilişkilidir [3] , [4] . Doğal ürünler, yüzyıllardır önde gelen bir ilaç geliştirme kaynağı olarak hizmet etmiştir ve taksol ve cisplatin gibi yeni antitümör ilaçların çoğu doğal ürünlerdir veya doğal ürünlerden türetilmiştir [5] , [6] . Evodiamine (EVO), Evodia rutaecarpa'dan izole edilmiş doğal bir kimyasaldır.ve antitümör, antinosiseptif ve vazorelaksan özellikler dahil olmak üzere EVO'nun çeşitli biyolojik etkileri bildirilmiştir [7] , [8] . EVO, in vitro olarak tümör hücresi göçü üzerinde inhibe edici bir etki gösterdi ve birkaç hücre tipinde hücre ölümünü indükledi, ancak normal insan periferik kan mononükleer hücreleri üzerinde çok az etkiye sahipti [9] . Ogasawara vd. (2004), EVO'nun kolon karsinom hücrelerinin invazyonu ve akciğer metastazına karşı inhibe edici etkilerini göstermiştir [10] . Anti-tümör etkisine ek olarak EVO, adipositlerde insülin ile uyarılan mTOR-S6K aktivasyonunu inhibe edebilir ve Obez / Diyabetik Farelerde glukoz toleransını iyileştirebilir [11]. Bu sonuçlar, EVO'nun faydalı etkilerini ortaya koymaktadır, ancak antitümör aktivitelerinin altında yatan mekanizma ve EVO'nun yapı-aktivite ilişkisi hala zayıf bir şekilde tanımlanmıştır.
            Son çalışmalar, kanser hücrelerinin antikanser ajanlar tarafından yok edilmesinin, bu hücrelerin apoptozunun indüksiyonunun aracılık ettiğini ileri sürdü [12] - [14] . Apoptotik uyaranlara yanıt olarak hücrelerde birkaç apoptotik yol vardır ve kemoterapötik ajanlarla apoptoz indüksiyonu çoğunlukla mitokondriyal apoptotik yolaklar yoluyla gerçekleşir [15] , [16]. Sitokrom (Cyt) c gibi mitokondriyal apoptotik proteinlerin salınımı, kaspaz aktivasyonunu başlatır ve Cyt c salınımı, kaspaz-3 gibi efektör kaspazları aktive ederek kaspaz-bağımlı DNA fragmantasyonuna neden olur. apoptoz. Proapoptotik (örn., Bax ve Bak) veya antiapoptotik (örn., Bcl-2 ve Bcl-xL) fonksiyonlara sahip Bcl-2 ailesi proteinlerinin üyeleri, apoptozda mitokondriyal membran geçirgenliğini (MMP) düzenler ve antiapoptotikte azalır ve kimyasal uyarı altında kanser hücrelerinin apoptozisi sırasında proapoptotik Bcl-2 ailesi proteinlerinde artışlar gözlenmiştir. Önceki makaleler, Bcl-2 / Bax kompleksinin ince dengesinin bir anti- veya proapoptotik etkiye yol açtığını belirtti.[17] , [18] . Kaspaz-9 ve -3'ün aktivasyonuna yol açan Bcl-2 / Bax dengesini bozarak MMP'nin bozulmasının kemoterapötik ajanların neden olduğu apoptozda önemli bir rol oynadığı belirtildi. Reaktif oksijen türleri (ROS), apoptoz indüksiyonunun aracılarıdır ve bir dizi çalışma, artan ROS üretiminin mitokondriye bağımlı bir yolla hücresel apoptoza neden olabileceğini göstermiştir [19] . EVO'nun çeşitli kanser hücrelerinde apoptozu indüklediği gösterilmiştir; ancak, EVO ile indüklenen apoptozda ROS'un mekanizmaları ve rolleri hala belirsizdir.
            Kanser terapisindeki mevcut ilaç gelişimi, kanser hücrelerinde çeşitli sinyal transdüksiyon yollarını bloke ederek mitojenik durmayı indüklemektir ve paklitaksel ve kanser hücresi döngüsü ilerlemesine karşı etkili olan çeşitli kemoterapötik ajanlar araştırılmıştır [20] , [21] . Mitotik arrestin, bu kemoterapötik ajanlar tarafından sitotoksisitenin temel bir nedeni olduğu belirtildi. Sikline bağımlı kinazların (CDK'ler) ve siklinlerin alternatif ekspresyonları, hücre döngüsünün ilerlemesini yönlendirir ve G 1 / S için siklinE / CDK2 ve G 2 / M geçişi için cdc25 tarafından düzenlenen siklinB / CDK2 bildirilmiştir [22] . Klinik kemoterapötik ajanlar esas olarak G 2'de hücre döngüsü durmasına neden olur/ M fazı ve kanser hücrelerinde apoptozu indükler. Hücre içi kinaz kaskadlarının aktivasyonu, kanser hücrelerinin proliferasyonuna ve hayatta kalmasına katkıda bulunur ve önceki çalışmalar, hücre dışı sinyalle düzenlenen kinaz (ERK) ve c-Jun N-terminal kinaz (JNK) dahil olmak üzere mitojenle aktive olan protein kinazların (MAPK) aktivasyonunu göstermiştir. ) kanser hücrelerinin apoptoz ve hücre döngüsü ilerlemesine katılır. EVO tarafından mitojenik tutuklamanın indüksiyonu bildirilmiş olsa da, EVO ile indüklenen hücre döngüsü tutuklamasında MAPK aktivasyonunun rolü belirsizliğini korumaktadır.
            Bu çalışmada, COLO205 ve HT-29 kolorektal karsinom hücrelerinin EVO ile inhibe edilen canlılık ve hücre döngüsü ilerlemesinin mekanizmalarını inceledik ve EVO'nun yapı-aktivite ilişkisi (SAR) analiz edildi. EVO'nun, ROS üretiminden bağımsız olan apoptoz indüksiyonu ve G 2 / M tutuklaması yoluyla kolorektal karsinom hücrelerinin canlılığını azaltabildiğini bulduk . Kolorektal karsinom hücrelerinde, EVO tarafından JNK protein fosforilasyonunun indüksiyonu yoluyla artan kaspaz-9 ve -3 protein bölünmesi ve siklin B1 ve cdc25c proteinleri gözlendi. Ek olarak, EVO'nun N14'ünde ikame, kolorektal karsinom hücrelerinin apoptozisi ve G 2 / M tutuklanması için kritiktir ve apoptozun hücre içi yolu ve EVO tarafından ortaya çıkan G 2 / M tutuklaması da araştırılmıştır.

            SONUÇLAR : EVO, apoptoz indüksiyonu yoluyla kolorektal karsinom hücrelerinin canlılığını azalttı
            EVO'nun iki kolon karsinom hücresinin yaşayabilirliği üzerindeki etkisini incelemek için COLO205 ve HT-29, bu çalışmada MTT ve LDH salım deneyleri uygulandı. Çalışmada, kolon karsinom hücrelerinin canlılığına karşı EVO'nun sınırlı sitotoksisitesinin olup olmadığını test etmek için NIH3T3 ve WI-38 hücreleri kullanıldı. NIH3T3 hücreleri, farelerde tümör oluşumu olmaksızın murin embriyodan oluşturulmuş hücrelerdir ve WI-38 hücreleri, sınırlı bir ömre sahip normal embriyonik akciğer dokusundan izole edilmiştir. Şekil 1A'da gösterildiği gibiCOLO205 ve HT-29 hücrelerinin canlılığındaki konsantrasyona bağlı azalmalar, MTT testi ile tespit edildi ve EVO, yine COLO205 / HT-29'un canlılığını NIH3T3 / WI-38 hücrelerine göre daha güçlü sitotoksisite sergiler. LDH salım tahlilinin verileri, EVO konsantrasyonuna bağlı olarak COLO205 ve HT29 hücrelerinin ortamında LDH'yi artırdığını gösterdi ( Şekil 1B ). Apoptotik cisimlerin oranı, artan apoptotik cisimlerin, EVO ile muamele edilmiş COLO205 ve HT-29 hücrelerinde tespit edildiğini gösterdi ( Şekil 1C ). DNA elektroforezi yoluyla EVO ile muamele edilmiş COLO205 ve HT-29 hücrelerinde, DNA merdivenlerinin ortaya çıkmasıyla DNA bütünlüğünün kaybı gözlendi ( Şekil 1D). Kaspaz-3 ve PARP protein ekspresyonları dahil olmak üzere apoptotik proteinlerin incelenmesi, EVO uyarımı altında COLO205 ve HT-29 hücrelerinde kaspaz-3 ve PARP proteinlerinin artan bölünmesinin tespit edildiğini gösterdi ( Şekil 1E ). Ek olarak, EVO tarafından indüklenen kaspaz-3 aktivitesi, kolorimetrik peptidil kaspaz-3 substratı Ac-DEVD-pNA kullanılarak COLO205 ve HT-29 hücrelerinde tanımlandı ( Şekil 1F ). Bu sonuçlar, apoptoz indüksiyonunun EVO tarafından aracılık edilmesiyle kolorektal karsinom hücrelerinin canlılığındaki azalmayı destekledi.


            Şekil 1. Apoptoz indüksiyonu yoluyla kolorektal karsinom COLO205 ve HT-29 hücrelerinin canlılığının EVO azalması.
            (A) COLO205, HT-29, NIH3T3 ve WI-38 hücrelerinin bir MTT deneyi ile hücre canlılığının EVO azalması. Bu hücreler, 24 saat boyunca belirtilen konsantrasyonlarda (0.5, 1, 2, 4 ve 8 uM) EVO ile muamele edildi ve hücre canlılığı, bir MTT analizi ile incelendi. (B) Bir LDH salım deneyine göre COLO205 ve HT-29 hücreleri tarafından laktat dehidrojenaz (LDH) salımının EVO indüksiyonu. (A) 'da açıklandığı gibi, ortamdaki LDH miktarı LDH kitleri ile incelendi. (C) EVO ile tedavi edilen COLO205 ve HT-29 hücre çizgilerinde artan hipodiploid hücre yüzdeleri. Hücreler 24 saat boyunca EVO (2 uM) ile işleme tabi tutuldu ve hipodiploid hücrelerin yüzdesi, PI boyama kullanılarak akış sitometrik analiz ile ölçüldü. (D) Artan DNA merdiveni oluşumu yoluyla EVO kaynaklı DNA bütünlüğü kaybı. (C) 'de tarif edildiği gibi, DNA bütünlüğü agaroz elektroforezi ile analiz edildi. (E) Kaspaz-3 (Kasp 3) ve poli (ADP riboz) polimeraz (PARP) protein klevajının EVO tarafından indüksiyonu, COLO205 ve HT-29 hücrelerinde, spesifik antikorlar kullanılarak Western blot ile tespit edildi. (F) EVO ile tedavi edilen kolorektal karsinom hücrelerinde Casp 3 enzim aktivitesinde önemli bir artış. (C) 'de tarif edildiği gibi, Casp 3'ün aktivitesi, Casp 3'e özgü kolorimetrik peptidil substratı, Ac-DEVD-pNA eklenerek ölçüldü. Her veri noktası, üç adet üçlü gruptan hesaplandı ve veriler, ortalama ± SD ** olarak gösterildi; p &lt;0.01, kontrol (C veya CON) grubuna kıyasla önemli bir farkı belirtir. (C) 'de tarif edildiği gibi, Casp 3'ün aktivitesi, Casp 3'e özgü kolorimetrik peptidil substratı, Ac-DEVD-pNA eklenerek ölçüldü. Her veri noktası, üç adet üçlü gruptan hesaplandı ve veriler, ortalama ± SD ** olarak gösterildi; p &lt;0.01, kontrol (C veya CON) grubuna kıyasla önemli bir farkı belirtir. (C) 'de tarif edildiği gibi, Casp 3'ün aktivitesi, Casp 3'e özgü kolorimetrik peptidil substratı, Ac-DEVD-pNA eklenerek ölçüldü. Her veri noktası, üç adet üçlü gruptan hesaplandı ve veriler, ortalama ± SD ** olarak gösterildi; p &lt;0.01, kontrol (C veya CON) grubuna kıyasla önemli bir farkı belirtir

            Kolorektal karsinom hücrelerinde EVO tarafından yapılan mitokondri aracılı apoptoz
            Ayrıca, COLOL205 ve HT-29 kolorektal karsinom hücrelerinde EVO tarafından apoptoz indüksiyonunda mitokondrinin rolünü inceledik. Floresan mitokondri bağlama boyası (DiOC6) kullanan MMP analizinden elde edilen veriler, EVO ilavesinin her iki hücre hattındaki MMP'leri önemli ölçüde azalttığını gösterdi. MMP'nin H2O2 ile azaltılması, pozitif kontrol olarak tanımlandı ( Şekil 2A ). Pro-ve antiapoptotik Bcl-2 familyası proteinlerinin alternatif ifadeleri, spesifik antikorlar kullanılarak Western blot ile proapoptotik Bax proteininde bir artış ve antiapoptotik protein Bcl-XL'de bir azalma gözlendiğinde ortaya çıktı ( Şekil 2B ). Kaspaz-9 ve Cyt c'nin sitozolde bölünmesinin indüksiyonu, EVO ile muamele edilmiş COLO205 ve HT-29 hücrelerinde tespit edildi ( Şekil 2C). Her iki hücre çizgisinin peptidil kaspaz-9 inhibitörü Ac-YVAD-FMK ile inkübasyonu, EVO ile indüklenen DNA merdiven oluşumunu inhibe etti ( Şekil 2D ). Özel bir peptidil kolorimetrik substrat kullanılarak EVO ile muamele edilmiş COLO205 ve HT-29 hücrelerinde kaspaz-9'da bir artış, kaspaz-8'de bir artış gözlendi ( Şekil 2E ). Bu sonuçlar, MMP'nin bozulmasının, kolorektal karsinom hücrelerinde EVO'nun neden olduğu apoptoza katkıda bulunduğunu gösterdi.

            Şekil 2. EVO ile muamele edilmiş COLO205 ve HT-29 hücrelerinde artan Bax proteini ve sitozolik sitokrom (Cyt) c protein ekspresyonları ve kaspaz-9 (Kasp 9) protein bölünmesi ile mitokondriyal membran potansiyelinin (MMP) bozulması.
            (A) COLO205 ve HT-29 hücrelerinde EVO ve H 2 O 2 tarafından MMP kaybı . Hücreler EVO'nun (2 uM) veya tedavi edildi, H 2 O 2 (100 uM), 12 saat için, ve MMP bir flüoresan boya olarak DiOC6 kullanılarak bir akış sitometri analizi ile tespit edilmiştir. (üst) Akış sitometrik verilerinin temsili bir örneği gösterilmektedir; M 1'in (alt) miktar tayiniüç bağımsız deneyden elde edilen oran gösterilmektedir. (B) EVO tarafından alternatif Bcl-2 ailesi protein ekspresyonu, spesifik antikorlar kullanılarak Western blot ile tespit edildi. Hücreler, 24 saat boyunca farklı EVO konsantrasyonları ile işleme tabi tutuldu ve belirtilen proteinlerin ekspresyonları, Western blot ile saptandı. (C) COLO205 ve HT-29 hücrelerinde Casp 9 protein bölünmesinin ve sitosolik Cyt c proteininin EVO indüksiyonu. (C) 'de açıklandığı gibi, Casp 9, sitosolik Cyt C ve mitokondriyal Cyt c proteinlerinin ekspresyonları, spesifik antikorlar kullanılarak Western blot ile incelendi. (D) Peptidil Casp 9 inhibitörü, Ac-YVAD-FMK (YVAD; 100 uM), COLO205 ve HT-29 hücreleri tarafından EVO ile indüklenen DNA merdiven oluşumunu inhibe etti. Hücreler 2 saat Ac-YVAD-FMK (100 uM) ile inkübe edildi, ardından 24 saat EVO (2 uM) işlemi yapıldı ve DNA bütünlüğü agaroz elektroforezi ile incelendi. (E) EVO ile tedavi edilen kolorektal karsinom hücrelerinde Casp 8 enzim aktivitesinde değil, Casp 9'da önemli bir artış. (C) 'de açıklandığı gibi, Casp 9 ve 8'in aktiviteleri sırasıyla Casp 9'a özgü kolorimetrik peptidil substratı, Ac-DEVD-pNA veya Casp 8'e özgü kolorimetrik peptidil substratı Ac-IETD-pNA eklenerek ölçüldü. Her veri noktası, üç adet üçlü gruptan hesaplandı ve veriler, ortalama ± SD ** olarak gösterildi; p &lt;0.01, kontrol (C veya CON) grubuna kıyasla önemli bir farkı belirtir. Her bandın yoğunluğu, bir dansitometrik analiz (Imag J) ile incelendi ve kontrolün katları olarak ifade edildi. Casp 9 ve 8'in aktiviteleri sırasıyla Casp 9'a özgü kolorimetrik peptidil substratı, Ac-DEVD-pNA veya Casp 8'e özgü kolorimetrik peptidil substratı, Ac-IETD-pNA eklenerek ölçüldü. Her veri noktası, üç adet üçlü gruptan hesaplandı ve veriler, ortalama ± SD ** olarak gösterildi; p &lt;0.01, kontrol (C veya CON) grubuna kıyasla önemli bir farkı belirtir. Her bandın yoğunluğu, bir dansitometrik analiz (Imag J) ile incelendi ve kontrolün katları olarak ifade edildi. Casp 9 ve 8'in aktiviteleri sırasıyla Casp 9'a özgü kolorimetrik peptidil substratı, Ac-DEVD-pNA veya Casp 8'e özgü kolorimetrik peptidil substratı, Ac-IETD-pNA eklenerek ölçüldü. Her veri noktası, üç adet üçlü gruptan hesaplandı ve veriler, ortalama ± SD ** olarak gösterildi; p &lt;0.01, kontrol (C veya CON) grubuna kıyasla önemli bir farkı belirtir. Her bandın yoğunluğu, bir dansitometrik analiz (Imag J) ile incelendi ve kontrolün katları olarak ifade edildi.
            Kolorektal karsinom hücrelerinde EVO tarafından ROS'tan bağımsız apoptoz
            Ayrıca COLO205 ve HT-29 hücrelerinde EVO ile indüklenen apoptozda ROS'un rolünü inceledik. Hücre içi peroksit seviyeleri, floresan boya olarak DCHF-DA kullanılarak bir akış sitometrik analiz ile tespit edildi. Gösterildiği gibi Şek. 3A H ilavesi 2 O 2 sebep olduğu hücre içi peroksit Colo205 üretimi ve HT-29 hücreleri, ancak EVO her bir hücre çizgisinde peroksit üretimi üzerinde hiçbir etkisi gözlenmemiştir. Ayrıca, COLO205 ve HT-29 hücrelerinde H2O2 ile indüklenen DNA merdivenleri ve sitotoksisite tespit edildi ve bunlar sırasıyla agaroz elektroforezi ve bir MTT testi ile antioksidan NAC eklenerek kaldırıldı. Bununla birlikte, NAC ilavesi, EVO kaynaklı hücre ölümünü MTT testi ve DNA merdivenleri yoluyla her iki hücre hattında da agaroz elektroforezi yoluyla azaltamadı (Şekil 3B ). H ile bölünmüş kaspaz-3 ve PARP proteinleri artışlar 2 O 2 tedavi spesifik antikorlar kullanılarak Western blot analizi ile tespit edilmiştir ve bunlar NAC (eklenmesiyle engellenmiştir Şek. 3C ). EVO- ve EVO + NAC ile muamele edilmiş hücrelerde bölünmüş kaspaz-3 veya PARP proteininin ekspresyonlarında hiçbir değişiklik gözlenmedi. Bu, EVO ile indüklenen apoptozun, kolorektal karsinom hücrelerinde ROS'a bağlı bir şekilde aracılık edilemeyebileceğini gösterir.


            Şekil 3. Kolorektal karsinom hücrelerinin EVO ile indüklenen apoptozunda reaktif oksijen türlerinin (ROS) rolü.
            (A) EVO, COLO205 ve HT-29 hücrelerinde hücre içi peroksit üretimi üzerinde hiçbir etki göstermez. Her iki hücre EVO'nun (2 uM) veya tedavi edildi, H 2 O 2 , 3 saat boyunca (100 uM), bir akış sitometrisi analizi ile hücre içi peroksit değerlerini incelemek için bir floresan boya (DCHF-DA) ilave edilmiştir. (üst) Akış sitometrik verilerinin temsili bir örneği gösterilmektedir; M (alt) ölçümü 1 , üç bağımsız deneyden elde oranı gösterilmektedir. (B) N-asetil-L-sistein (NAC N 20 mM) korumalı H gelen hücreler 2 O 2 ile indüklenen hücre ölümü ve DNA merdiveni oluşumu ancak EVO-teşvik edilmiş apoptosis üzerindeki herhangi bir etki göstermemiştir. Her iki hücre EVO'nun (2 uM) ya da H, ardından 30 dakika boyunca NAC (20 mM) ile muamele edildi 2 O 224 saat (100 uM) muamele. Farklı tedaviler altında hücrelerin DNA bütünlüğü (üst panel) ve canlılığı (alt panel) sırasıyla agaroz elektroforezi ve MTT testi ile incelenir. (C), NAC inhibe H 2 O 2 ile indüklenen kaspaz (Casp) 3 ve poli (ADP riboz) polimeraz (PARP), protein bölünmesi, ancak EVO kaynaklı Colo205 olayları ve HT-29 hücreleri etkilememiştir. (B) 'de tarif edildiği gibi, belirtilen protein ekspresyonu, spesifik antikorlar kullanılarak Western blot ile incelendi. Her veri noktası, üç adet üç tekrarlı gruptan hesaplandı ve veriler, ortalama ± SD ** p &lt;0.01, (A) 'da veya belirtilen gruplar (B) arasındaki kontrol (C) ile karşılaştırıldığında önemli bir farkı gösterdiği için görüntülenir.
            JNK aktivasyonu, kolorektal karsinom hücrelerinin EVO ile indüklenen apoptozunda rol oynar.
            MAPK aktivasyonunun rolleri bildirildi ve EVO ile indüklenen apoptozun, kolorektal karsinom hücrelerinde değiştirilmiş MAPK aktivasyonu yoluyla meydana gelip gelmediğini araştırdık. Şekil 4A'da gösterildiği gibi , EVO uyarımı altında COLO205 ve HT-29 hücrelerinde artan ERK ve JNK protein fosforilasyonu saptandı. Her iki hücre hattının ERK inhibitörü U0126 veya JNK inhibitörü SP600125 ile inkübasyonu, ardından EVO uyarımı, ERK ve JNK aktivasyonunun EVO ile indüklenen apoptozdaki rollerini incelemek için uygulandı. MTT tahlilinin verileri, SP600125'in ilave edilmesinin, U0126'nın değil, her iki kolorektal karsinoma hücre dizisini EVO ile uyarılan hücre ölümünden koruduğunu gösterdi ( Şekil 4B ). DNA bütünlüğünün incelenmesi, SP600125 ilavesinin COLO205 ve HT-29 hücrelerinde EVO kaynaklı DNA merdiven oluşumunu zayıflattığını gösterdi (Şekil 4C ). Western lekeleme verileri, U0126'nın EVO ile indüklenen pERK protein ekspresyonunu inhibe ettiğini, ancak COLO205 ve HT-29 hücrelerinde kaspaz-3 proteininin EVO ile indüklenen bölünmelerini etkilemediğini gösterdi. Deneyin aynı bölümünde, SP600125, her iki hücre hattında kaspaz-3 proteininin bölünmesindeki azalmaya göre EVO ile indüklenen pJNK proteini üzerinde inhibe edici bir etki sergiledi. A-tubulin, tERK veya tJNK ifadelerinde hiçbir değişiklik dahili kontroller olarak tanımlanmamıştır ( Şekil 4D ).

            Şekil 4. c-Jun N-terminal kinaz (JNK) aktivasyonu, COLO205 ve HT-29 hücrelerinin EVO ile indüklenen apoptozuna katılır.
            (A) Kolorektal karsinom hücrelerinde EVO ile hücre dışı sinyalle düzenlenen kinaz (ERK) ve JNK protein fosforilasyonunun indüksiyonu. Her iki hücre hattı, farklı zamanlar için EVO (2 uM) ile işleme tabi tutuldu ve fosforile (p) ERK / (p) JNK ve toplam (t) ERK / (t) JNK ekspresyonları, spesifik antikorlar kullanılarak Western blot analizi ile tespit edildi. (B) JNK inhibitörü SP600125 (SP; 20 uM), ancak ERK inhibitörü U0126 (U0; 20 uM) değil, COLO205 ve HT-29 hücrelerini MTT testine göre EVO kaynaklı sitotoksisiteden korumuştur. (C) SP600125, kolorektal karsinom hücrelerinde EVO ile indüklenen DNA merdiven oluşumunu zayıflatır. Hücreler 30 dakika SP600125 (10 uM) ile işleme tabi tutuldu, ardından 24 saat daha EVO uyarımı yapıldı ve DNA bütünlüğü agaroz elektroforezi ile incelendi. (D) SP600125, EVO ile indüklenen JNK protein fosforilasyonunu ve kaspaz (Casp) 3 / poli (ADP riboz) polimeraz (PARP) protein klivajını inhibe etti; bununla birlikte U0126, her iki hücre hattında EVO ile indüklenen Casp 3 / PARP protein klevajını etkilemeden EVO ile indüklenen ERK protein fosforilasyonunu inhibe etti. Her iki hücre hattı, 30 dakika süreyle farklı SP600125 veya U0126 konsantrasyonları ile işleme tabi tutuldu, ardından Western blotlama yoluyla 30 dakika (ERK ve JNK protein ekspresyonları için) veya 24 saat (Casp 3 ve PARP protein ekspresyonları için) EVO uyarımı yapıldı. Her veri noktası, üç adet üç tekrarlı gruptan hesaplandı ve veriler, ortalama ± SD ** p &lt;0.01, belirtilen gruplar arasında karşılaştırıldığında önemli bir farkı gösterdiğinden gösterilir. U0126, her iki hücre hattında EVO ile indüklenen Casp 3 / PARP protein klevajını etkilemeden, EVO ile indüklenen ERK protein fosforilasyonunu inhibe etti. Her iki hücre hattı, 30 dakika süreyle farklı SP600125 veya U0126 konsantrasyonları ile işleme tabi tutuldu, ardından Western blotlama yoluyla 30 dakika (ERK ve JNK protein ekspresyonları için) veya 24 saat (Casp 3 ve PARP protein ekspresyonları için) EVO uyarımı yapıldı. Her veri noktası, üç adet üç tekrarlı gruptan hesaplandı ve veriler, ortalama ± SD ** p &lt;0.01, belirtilen gruplar arasında karşılaştırıldığında önemli bir farkı gösterdiğinden gösterilir. U0126, her iki hücre hattında EVO ile indüklenen Casp 3 / PARP protein klevajını etkilemeden, EVO ile indüklenen ERK protein fosforilasyonunu inhibe etti. Her iki hücre hattı, 30 dakika süreyle farklı SP600125 veya U0126 konsantrasyonları ile işleme tabi tutuldu, ardından Western blotlama yoluyla 30 dakika (ERK ve JNK protein ekspresyonları için) veya 24 saat (Casp 3 ve PARP protein ekspresyonları için) EVO uyarımı yapıldı. Her veri noktası, üç adet üç tekrarlı gruptan hesaplandı ve veriler, ortalama ± SD ** p &lt;0.01, belirtilen gruplar arasında karşılaştırıldığında önemli bir farkı gösterdiğinden gösterilir.
            EVO ile G2 / M durdurma ve siklin B1 / cdc25c protein ekspresyonunun indüksiyonu COLO205 ve HT-29 hücrelerinde tanımlandı ve bunlar JNK inhibitörü SP600125 eklenerek bloke edildi
            Hücre döngüsünün ilerlemesi, floresan boya olarak PI kullanılarak akış sitometrisi ile analiz edildi. Şekil 5A'da gösterildiği gibi , konsantrasyona bağlı şekilde EVO ile muamele edilmiş COLO205 ve HT-29 hücrelerinde G2 / M oranında bir artış ve G1 oranında bir azalma tespit edildi. Benzer şekilde, zamana bağlı şekilde hem COLO205 hem de HT-29 hücrelerinde EVO ile indüklenen G2 / M oranı ve EVO tarafından inhibe edilen G1 oranı gözlendi ( Şekil 5B ). Cyc B1, cdc 2, cyc E, cdc 25c ve p27 dahil olmak üzere hücre döngüsü düzenleyici proteinlerin değişen ekspresyonları, spesifik antikorlar kullanılarak Western blot ile tespit edildi ve veriler Şekil 5C'de gösterildi .Cyc B1 ve cdc 25c'de zamana bağlı artışların, ancak diğerlerinin değil, her iki EVO ile muamele edilmiş hücre dizisinde tespit edildiğini ortaya koymaktadır. EVO tarafından sik B1 ve cdc 25c proteinlerindeki artışlar, JNK inhibitörü SP ilave edilerek EVO ile indüklenen G2 / M'deki bir azalma ile azaltıldı ( Şekil 5D ). Bu sonuçlar, JNK aktivasyonunun, EVO kaynaklı apoptoza ve kolorektal karsinom hücrelerinin G2 / M tutuklanmasına katkıda bulunduğunu gösterdi.

            Şekil 5. G 2 / M durdurma ve siklin B1 / cdc 25c protein ekspresyonlarının COLO205 ve HT-29 hücrelerinde EVO tarafından indüksiyonu , c-Jun N-terminal kinaz (JNK) inhibitörü SP600125 eklenerek önemli ölçüde inhibe edildi.
            (A) EVO ile muamele edilmiş COLO205 ve HT-29 hücrelerinde G 2 / M oranında konsantrasyona bağlı artışlar ve G 1 oranında düşüşler . Her iki hücre dizisi G farklı konsantrasyonda (1, 2, ve 4 uM) EVO'nun 24 saat boyunca ve hücre oranları ile muamele edilmiştir 1 ve G 2 / M fazlar PI boyama ile bir akış sitometrik analizi ile ölçülmüştür. (B) EVO ile tedavi edilen kolorektal karsinom hücrelerinde G 2 / M oranında zamana bağlı artışlar ve G 1 oranında düşüşler tespit edildi. Hücreler, farklı zamanlarda (6, 12 ve 24 saat) EVO (2 µM) ile tedavi edildi ve G 1 ve G 2'deki hücre oranları/ M fazları, PI boyama yoluyla bir akış sitometrik analiz ile ölçüldü. (Sol panel) Akış sitometrik verilerinin temsili bir örneği gösterilmektedir. (Sağ panel) Üç bağımsız deneyden G 1 ve G 2 / M oranlarına ait veriler sunulmuştur. (C) EVO uyarımı altında kolorektal karsinom hücrelerinde sik B1, cdc 2, sik E, cdc 25c, p27 ve a-tubulin dahil olmak üzere hücre döngüsü düzenleyici proteinlerin alternatif ifadeleri. Hücreler, farklı zamanlarda (4, 8, 12 ve 24 saat) EVO (2 uM) ile işleme tabi tutuldu ve belirtilen proteinlerin ekspresyonları, spesifik antikorlar kullanılarak Western blot ile incelendi. (D), JNK inhibitör, SP600125 (SP), G azalmalar ile birlikte EVO kaynaklı cdc25C ve cyc B1 proteini ifade inhibe 2COLO205 ve HT-29 hücrelerinde / M oranı. (Üst panel) Hücreler, 30 dakika süreyle farklı SP600125 konsantrasyonları ile işleme tabi tutuldu, ardından 24 saat süreyle EVO (2 uM) uyarımı uygulandı ve belirtilen proteinin ekspresyonu, Western blot analizi ile incelendi. (Alt panel) Hücreler 30 dakika süreyle SP600125 (10 uM) ile işleme tabi tutuldu, ardından 24 saat EVO (2 uM) tedavisi uygulandı ve hücre döngüsü ilerlemesi, PI boyama yoluyla akış sitometrisi ile analiz edildi. Her bandın yoğunluğu, bir dansitometrik analiz (Imag J) ile incelendi ve kontrolün katları olarak ifade edildi. Her veri noktası, üç adet üçlü gruptan hesaplandı ve veriler, ortalama ± SD ** p &lt;0.01, kontrole (CON) kıyasla önemli bir farkı gösterdiği için görüntülenir.
            EVO ile ilgili bileşiklerin kolorektal karsinom hücrelerinin canlılığı üzerindeki etkilerinin yapı-aktivite analizi
            COLO205 ve HT-29 hücrelerinin apoptoz indüksiyonu üzerindeki etkilerini incelemek için EVO ve 12 EVO ile ilgili bileşik uygulandı. Bu kimyasalların yapıları Şekil 6A'da gösterilmektedir ve EVO'nun 14. pozisyonundaki farklı ikameler işaretlenmiştir. Belirtilen EVO ile ilgili kimyasallarla işlem gören COLO205 ve HT-29 hücrelerindeki DNA bütünlüğünün analizi, EVO, EVO-2, -4, -7, -8 ve -12'nin DNA merdiven oluşumunu indükleme yeteneğine sahip olduğunu gösterdi. her iki hücre çizgisi de EVO-1, -3, -5, -6, -9, -10 ve -11 olmadı ( Şekil 6B). Bu, kinazolinin 14. pozisyonuna bir metil veya butil gibi bir alkil grubunun eklenmesinin, EVO ile apoptoz indüksiyonu için kritik olduğu anlamına gelir. Ayrıca, bir mekanizma çalışması için dört bileşik (yani, EVO, -4, -5 ve -8) seçildi ve bu EVO'lar, bir EVO metili, bir EVO-4 etili, bir EVO-5 ve pozisyon 14'te EVO-8'in bir butili. Western blot verileri, EVO, EVO-4 ve EVO-8'in, COLO205'te artmış sik B1 ve cdc25c protein seviyeleri ile kaspaz-3 ve PARP proteinlerinin bölünmesini indüklediğini gösterdi ve HT-29 hücreleri; ancak EVO-5 bunu yapmadı ( Şekil 6C). EVO ile tedavi edilen COLO205 ve HT-29 hücrelerindeki G2 / M oranının analizi, EVO, EVO-4 ve EVO-8 ile tedavi edilen hücrelerde G2 / M oranında önemli artışların tespit edildiğini, ancak bunların gözlenmediğini gösterdi. EVO-5 ile muamele edilmiş hücreler ( Şekil 6D ).

            Şekil 6. EVO'nun ve ilgili kimyasalların, kolorektal karsinom hücrelerinde EVO tarafından ortaya çıkarılan apoptoz ve G 2 / M tutuklanması üzerindeki yapı-aktivite ilişkisi .
            (A) EVO'nun kimyasal yapıları ve yapısal olarak ilgili kimyasallar (EVO-1∼12) tasvir edilmiştir. (B) Kolorektal karsinom hücrelerinde EVO'ların ortaya çıkardığı farklı apoptotik etkiler. Hücreler 24 saat boyunca belirtilen EVO'larla (2 uM) işlemden geçirildi ve DNA bütünlüğü agaroz elektroforezi ile analiz edildi. (C) Kinazolinin 14. pozisyonunda farklı ikamelere sahip dört EVO, kolorektal karsinom hücrelerinde kaspaz (Casp) 3 / poli (ADP riboz) polimeraz (PARP) protein bölünmesi ve sikB1 / cdc 25c protein ekspresyonları üzerinde farklı etkiler gösterdi. Hücreler, 24 saat boyunca belirtilen kimyasallarla (2 uM) işleme tabi tutuldu ve Casp 3 / PARP, sikB1 / cdc 25c ve a-tübülin (TUB) ekspresyonları, spesifik antikorlar kullanılarak Western blot ile tespit edildi. (D) EVO, EVO4 (4) ve EVO-8 (8), ancak EVO-5 (5) değil, G 2'yi artırdıCOLO205 ve HT-29 hücrelerinin / M oranı. (C) 'de tarif edildiği gibi, G, 2 / M Colo205 oranı ve HT-29, farklı işlemler altında hücre PI boyama ile flow sitometri yöntemi ile incelenmiştir. Her veri noktası, üç adet üç tekrarlı gruptan hesaplandı ve veriler, ortalama ± SD ** p &lt;0.01, kontrole (CON) kıyasla önemli bir farkı gösterdiğinden görüntülenir.
            Tartışma
            Hücre döngüsü kontrol noktaları, ökaryotik hücrelerde hücre döngüsü geçişlerinin koordinasyonunda önemli roller oynar ve hücre döngüsü kontrol noktalarının anormal düzenlenmesi, sıklıkla tümör hücrelerinde meydana gelir. Hücre döngüsü kontrol noktalarında tutuklamanın işlevi, hücresel hasar meydana geldiğinde DNA onarımı içindir ve hücre döngüsü durdurma sinyallemesi apoptotik yolları etkinleştirebilir ve hücresel hasar onarılamaz olduğunda hücre ölümüne yol açabilir. Akış sitometrik analizine göre, COLO205 ve HT-29 hücrelerinde EVO kaynaklı G 2 / M tutukluğu erken bir zaman noktasında ( Şekil 5B ; 6 saat) meydana gelirken, daha sonraki zamanlarda apoptotik oranda artış (12 ve 24 saat ). G 2'yi gösterir/ M arresti, COLO205 ve HT-29 hücrelerinde EVO tarafından apoptoza yol açan hücre proliferasyonunun inhibisyonu ile sonuçlandı. Cdc25c ve siklin B1'in uygunsuz aktivasyonunun antitübülin maddesinin neden olduğu mitotik tutuklama ve apoptozda önemli bir role sahip olduğunu gösteren artan kanıtlar vardır. EVO ile G2 / M oranında ve siklin B1 / cdc 25c protein ekspresyonunda artışlar COLO205 ve HT-29 hücrelerinde gözlemlendi ve JNK inhibitörü SP600125'te gözlendi, ancak ERK inhibitörü U0126, EVO ile indüklenen JNK protein fosforilasyonunu inhibe etti COLO205 ve HT-29 hücrelerinde EVO kaynaklı apoptotik olayların ve G2 / M tutuklamasının bastırılması. Birlikte ele alındığında, EVO'nun kolorektal karsinom hücrelerinde JNK aracılı bir şekilde apoptoz indüksiyonu ve G2 / M tutuklaması için moleküler mekanizma, mevcut çalışmada gösterilmiştir.
            Kaspaz-3, PARP ve D4-GDI gibi birkaç temel hücresel proteini parçalayarak apoptozun kritik bir uygulayıcısıdır. EVO tarafından kaspaz aktivitesinin aktivasyonu yoluyla apoptoz indüksiyonu, önceki birkaç çalışmada bildirilmiştir. Huang vd. (2004) ve Zhang ve ark. (2010), EVO'nun insan lösemik T lenfositlerinde ve kolon LOVO hücrelerinde apoptozu ve kaspazların bölünmesini indüklediğini bildirmiştir [15] , [23] . Zhang vd. (2013), EVO'nun insan U937 lösemi hücrelerinde kaspaz bağımlı ve bağımsız apoptozu indüklediğini bildirmiştir [9] . Wang vd. (2013), EVO'nun meme karsinom hücrelerinde proliferasyonu inhibe ettiğini ve kaspaz-7 ve PARP bölünmesini indüklediğini bildirdi [24]. Araştırmalarımız, EVO'nun, COLO205 ve HT-29 hücrelerinde apoptoz indüksiyonunun eşlik ettiği kaspaz-3 aktivitesini ve bölünmüş kaspaz-3 ve PARP proteinlerinin ekspresyonlarını artırma kabiliyetine sahip olduğunu ortaya çıkardı. Bu bulgular, kaspaz kaskadının aktivasyonunun kolon karsinom hücrelerinde EVO ile indüklenen apoptoza katkıda bulunduğunu göstermektedir.

            Düşük seviyede reaktif oksijen türü (ROS) hücresel fonksiyon ve hayatta kalma sinyali için önemlidir, aşırı ROS ile tetiklenen oksidatif stres apoptoz indüksiyonu yoluyla hücre ölümüne yol açar. Birikmiş kanıtlar, kemoterapötik ajanların çeşitli kanser hücrelerinde ROS üretimi yoluyla apoptozu indükleyebileceğini göstermektedir. Yang vd. (2011), gelomulide K ile artan ROS üretiminin meme karsinom hücrelerinin letalitesini güçlendirdiğini bildirmiştir [25] . Önceki yayınlarımız, kanser hücrelerinin apoptozunda ROS üretiminin katılımını destekledi [14] , [26] , [27]. İmatinib mesilat, gossypol, vitamin K3 ve flavonoidler, ROS üretimini artırarak melanom, lösemi, glioma ve kolorektal karsinom hücreleri dahil olmak üzere birçok hücre dizisinde apoptozu indükledi. Bununla birlikte, kimyasal uyarı ile ROS'tan bağımsız apoptoz da bildirilmiştir [28] , [29] . EVO tarafından indüklenen apoptoz bildirilmiş olmasına rağmen, ROS'un rolleri hala tanımlanmamıştır. Bu çalışmada, NAC H 2 O 2'yi inhibe ettiuyarılmış DNA merdiveni oluşumu ve kaspaz-3 / PARP protein bölünmesi, ancak EVO ile uyarılan apoptozu bloke edemedi. DCHF-DA boyaması verileri, COLO205 veya HT-29 hücrelerinde EVO tarafından hücre içi peroksit seviyelerinde hiçbir değişiklik gözlenmediğini gösterdi. Bu sonuçlar, ROS'un, kolorektal karsinom hücrelerinin EVO ile indüklenen apoptozunda yer almayabileceğini ileri sürdü. Bu sonuçların aksine, insan servikal karsinom HeLa hücrelerinde EVO'nun neden olduğu apoptozun EVO yükselmesi ve NAC inhibisyonu gözlendi. Mevcut çalışmada kolon karsinom hücrelerinde daha düşük EVO konsantrasyonları (1∼4 µM) ve önceki çalışmada servikal karsinom hücrelerinde daha yüksek konsantrasyon (21 µM), muhtemelen ROS'un EVO ile indüklenen apoptozda farklı roller oynamasının nedenidir. Bunlara ek olarak, Bcl-2 ailesi proteinleri, mitokondriyal Cyt c'nin sitozole salınmasının MMP düzenlemesinin korunmasına ve kanser hücrelerinin apoptozuna katkıda bulunan kaspaz-9 aktivitesinin aktivasyonuna katılır. EVO uyarımı altında hem COLO205 hem de HT-29 hücrelerinde antiapoptotik Bcl-2 / Bcl-xL proteinlerinde azalmalar ile proapoptotik Bax proteininde önemli bir artış tespit edildi. Buna göre, EVO ile muamele edilmiş hücrelerde kaspaz-9 protein bölünmesi ve Cyt C'nin mitokondriden sitozole salınmasıyla birlikte MMP kaybı gözlemlendi. EVO ile mitokondriye bağımlı apoptozun kolorektal karsinom hücrelerinde meydana geldiği belirtilmiştir. EVO uyarımı altında hem COLO205 hem de HT-29 hücrelerinde antiapoptotik Bcl-2 / Bcl-xL proteinlerinde azalmalar ile proapoptotik Bax proteininde önemli bir artış tespit edildi. Buna göre, EVO ile muamele edilmiş hücrelerde kaspaz-9 protein bölünmesi ve Cyt C'nin mitokondriden sitozole salınmasıyla birlikte MMP kaybı gözlemlendi. EVO ile mitokondriye bağımlı apoptozun kolorektal karsinom hücrelerinde meydana geldiği belirtilmiştir. EVO uyarımı altında hem COLO205 hem de HT-29 hücrelerinde antiapoptotik Bcl-2 / Bcl-xL proteinlerinde azalmalar ile proapoptotik Bax proteininde önemli bir artış tespit edildi. Buna göre, EVO ile muamele edilmiş hücrelerde kaspaz-9 protein bölünmesi ve Cyt C'nin mitokondriden sitozole salınmasıyla birlikte MMP kaybı gözlemlendi. EVO ile mitokondriye bağımlı apoptozun kolorektal karsinom hücrelerinde meydana geldiği belirtilmiştir.
            MAPK, tümör hücrelerinin hayatta kalma ve hücre ölümü tepkilerinin düzenlenmesinde rol oynar ve birkaç çalışma, MAPK'nin kanser deregülasyonunda rol oynadığını bildirmiştir; ancak apoptoz ve kanser hücrelerinin hücre döngüsü ilerlemesinde MAPK'nın kesin mekanizmaları hala belirsizdir. Du vd. (2013), EVO ile indüklenen apoptozun, ERK inhibitörü PD98059 veya p38 MAPK inhibitörü SB203580 ile kombinasyonuyla arttığını bildirdi [30]. MAPK'nın EVO kaynaklı apoptoz ve hücre döngüsü durması ile ilişkisi hala net değildir. Mevcut çalışmanın verileri, EVO tarafından ERK ve JNK protein fosforilasyonunun indüksiyonunun COLO205 ve HT-29 hücrelerinde saptandığını ve DNA merdiven oluşumu ve kaspaz-3 protein bölünmesi dahil olmak üzere EVO ile indüklenen apoptotik olayların JNK eklenerek inhibe edildiğini gösterdi. inhibitörü, SP600125, ancak ERK inhibitörü, U0126 değil. Ek olarak, kanser hücrelerinde hücre döngüsü ilerlemesinin kontrolü, tümör hücresi proliferasyonunu inhibe etmek için etkili bir strateji olarak kabul edilir. Önceki çalışmalar, EVO'nun G2 / M veya S fazında tutuklanan çeşitli kanser hücrelerinin proliferasyonunu inhibe ettiğini bildirdi [23] , [31], ancak EVO tarafından mitojenik tutuklama mekanizması hala tam olarak anlaşılamamıştır. Bu çalışmada, COLO205 ve HT-29 hücrelerinde, siklinB1 ve cdc25c protein ekspresyonlarının indüksiyonu ile EVO ile artan bir G2 / M oranı tespit edilmiştir. JNK inhibitörü SP600125'in eklenmesi, her iki kolon karsinom hücre çizgisinde EVO ile indüklenen G2 / M tutuklanmasını ve siklinB1 / cdc25c protein ekspresyonunu azalttı. Siklin B ve CDC25C'nin promotörleri, hücre döngüsüne bağımlı eleman (CDE), hücre döngüsü genleri homoloji bölgesi (CHR) bölgeleri ve CCAAT-kutuları korunmuştur. E2F, CDF-1 ve CBP gibi çeşitli faktörlerin siklin B ve CDC25C promoterlerinde CHR / CDE ile bağlandığı bildirilmiştir [32]. Muller ve arkadaşları (2012), CHR'nin DREAM ve MMB kompleksleri tarafından siklin B'nin transkripsiyonel regülasyonunda merkezi bir eleman olduğunu bulmuşlardır [33] . Chae ve arkadaşları (2011), siklin B ve CDC25C gibi hücre döngüsü G2 düzenleyicilerinin promoterlerinde bir transkripsiyonel faktör NF-Y'nin CCAAT'ye bağlandığını buldu [34] . Seo ve arkadaşları (2008), fosforile c-Myc'nin siklin B1 promoterine bağlandığını ve bunun da siklin B1 promoter aktivitesinin artmasına neden olduğunu gösterdi [35]. JNK protein fosforilasyonunun inhibisyonu, EVO ile muamele edilmiş COLO 205 ve HT-29 hücrelerinde cdc25c / siklinB1 protein ekspresyonunu azaltır, ancak EVO ile indüklenen cdc25c / siklinB1 protein ekspresyonunu azaltmaya yol açan JNK inhibisyonu mekanizması hala net değildir. JNK'nın , transkripsiyonel faktörlerin promoterlerine bağlanmasını modüle ederek siklin B1 ve CDC25C geninin transkripsiyonel düzenlemelerine katkısının daha fazla araştırılması gerekmektedir.
            Kolorektal karsinom hücrelerinde EVO'nun neden olduğu apoptoz ve G2 / M tutuklamasına katkıda bulunan yapıları tahmin etmek için, EVO'ya benzer yapılara sahip bileşiklerin (EVO-1∼12), apoptoz ve her ikisinin de hücre döngüsü ilerlemesi üzerindeki etkileri kolon kanseri COLO205 ve HT-29 hücre hatları incelenmiştir.
            Şekil 6'da gösterildiği gibiEVO'nun metil grubuna kıyasla 14. pozisyonda etil veya butil gibi bir alkil grubu içeren EVO-2, -4, -7, -8 ve -12, COLO205 ve HT-29 hücrelerinde önemli apoptozu indükledi. Ayrıca, her iki kolorektal karsinoma hücre dizisinde hücre döngüsü ilerlemesi ile kaspaz-3, PARP, siklinB1 ve cdc25c protein ekspresyonları üzerindeki etkileri incelemek için EVO ve EVO-4, -5 ve -8 dahil yapısal olarak ilişkili bileşikleri kullanıldı. EVO, EVO-4, -5 ve -8, pozisyonda bir EVO metili, bir EVO-4 etili, bir EVO-5 hidrojeni ve bir EVO-8 bütili dahil olmak üzere farklı ikameler haricinde aynı kimyasal yapıyı paylaşır. 14.

            Sonuçlarımız, EVO, EVO-5 ve EVO-8'in, her iki kolon karsinom hücresinde artmış siklin B1 / cad25c protein ekspresyonları ve kaspaz-3 / PARP protein
            bölünmesi ile G2 / M tutuklanmasını önemli ölçüde indüklediğini gösterdi. çizgiler. Ogasawara vd. (2002) ayrıca, Lewis akciğer kanseri ve melanom hücrelerinin istilasını inhibe etmede EVO için 14. pozisyonda bir metil grubunun rolünü gösterdi.[11] . Apoptoz için 14. pozisyonda metil ve butil gibi alkil ikamelerinin ve EVO tarafından kolorektal karsinom hücrelerine karşı G2 / M durdurulmasının kritik rolleri gösterilmiştir.
            Sonuç olarak, bu çalışmada, EVO'nun kolorektal karsinom hücrelerinin canlılığına karşı apoptoz ve G2 / M arresti gibi antitümör aktivitelerine sahip olduğunu gösterdik. EVO, kaspaz-3 / 9'un aktivasyonunun eşlik ettiği MMP'nin bozulmasına neden oldu ve COLO205 ve HT-29 hücrelerinde siklin B1 / cdc25c protein ekspresyonlarında artış oldu. JNK'nin EVO tarafından aktivasyonu tespit edildi ve EVO ile indüklenen apoptotik ve G2 / M tutuklaması, JNK inhibitörü SP600125 tarafından bloke edildi, bu, EVO'nun anti-kolorektal karsinom aktivitesinde JNK aktivasyonunun kritik rolünü gösterir. Ayrıca, bir yapı-aktivite çalışması, 14. pozisyondaki metilin, EVO'nun kolon kanseri hücrelerinin canlılığına karşı eylemi için önemli olduğunu gösterdi. Daha ileri çalışmalar, EVO'nun bu etkilerinin in vivo kolon kanseri hücrelerine genişletilip genişletilemeyeceğini araştıracaktır.
            Hücre Kültürü
            COLO205, HT-29, NIH3T3 ve WI-38 hücreleri, Amerikan Tipi Kültür Koleksiyonundan (Manassas, VA, ABD) elde edildi. % 10 ısı ile inaktive edilmiş fetal sığır serumu (FBS; Gibco / BRL, Grand Island, NY, ABD) içeren RPMI 1640, WI-38'de ve% 10 ısı içeren DMEM'de NIH3T3'te COLO205 / HT-29 kolon karsinom hücreleri inaktive edilmiş dana serumu, antibiyotikler (a penisilin, 100 U / mL ve 100 U / ml streptomisin) ile takviye edilmiş (CS Gibco / BRL, Grand Island, NY, ABD), bir 37 içinde muhafaza edilmiştir ° C,% 5 CO içeren inkübatör nemlendirilmiş 2 .
            AJANLAR
            EVO, N-asetil- 1 - sistein (NAC), SP600125, U0126, BCIP, 3- (4,5, -dimetiltiyazol) -2-il-2,5-difeniltetrazolyum bromür (MTT) ve NBT'nin kimyasal reaktifleri Sigma Chemical'dan (St. Louis, MO, ABD) elde edildi. A-tubulin, poli (ADP riboz) polimeraz (PARP), kaspaz-3, kaspaz-9, Bcl-2 ve Bax antikorları Santa Cruz Biotechnology'den (Santa Cruz, CA, ABD) elde edildi. Total (t) ve fosforile (p) MAPK'lerin (tERK / pERK ve tJNK / pJNK) ve siklinB1 / cdc25c proteinlerinin antikorları, Cell Signaling Technology'den (Danvers, MA, ABD) elde edildi. Kolojenik sentetik peptit substratları, Ac-DEVD-pNA (bir kaspaz-3 substratı), Ac-YVAD-pNA (bir kaspaz-9 substratı) ve Ac-IETD-pNA (bir kaspaz-8 substratı) Calbiochem'den satın alındı. Yukarıda belirtilmeyen diğer kimyasallar Sigma Chemical'dan elde edildi.
            EVO'nun yapı ile ilgili kimyasallarının sentezi
            EVO ile ilgili bileşiklerin sentezi, 3,4-dihidro-p-karbolinin piridin içinde ikame edilmiş N-alkil izatoik anhidrit ile bağlanmasına dayanıyordu. 3,4-dihidro-β-karbolin etil format ile tryptamine reaksiyona sokulması suretiyle hazırlanabilir ve POCb varlığında molekül içi halka kapama işlemine izledi 3 . NaH ve DMF varlığında, izatoik anhidrit, N-alkil izatoik anhidrit analogları verecek şekilde iyodometan, iyodoetan, iyodopropan, 2-metoksi etil klorür gibi alkil halojenür ile alkillendi. HPLC ile analiz edildiğinde bunların saflıkları% 95'in üzerindeydi ( Şekil S1 ).
            MTT (3- (4,5, -dimetiltiyazol) -2-il-2,5-difeniltetrazolyum bromür) deneyi
            Hücre canlılığı, daha önce tarif edildiği gibi MTT boyama ile değerlendirildi [13] . Kısaca, hücreler 10 bir yoğunlukta kaplanmıştır 5 , 24 çukurlu plakalara hücre /. İşlemin sonunda süpernatan çıkarıldı ve 30 ul tetrazolyum bileşiği, MTT ve 270 ml taze RPMI ortamı ilave edildi. 37 ° C'de 4 saat inkübasyondan sonra, tetrazolyum kristallerini çözmek için her oyuğa 2-propanol içinde 200 ul 0.1 N HC1 yerleştirildi. Son olarak 600 nm dalga boyundaki absorbans, enzime bağlı immünosorbent deneyi (ELISA) plaka okuyucu kullanılarak kaydedildi.
            Laktat dehidrojenaz (LDH) salım deneyi
            LDH salımının yüzdesi,% 2 Triton X-100 ile muamele edilmiş hücrelerde bulunan toplam LDH miktarı ile karşılaştırıldığında ortama salınan LDH üretimi olarak ifade edildi. Aktivite, bir LDH tahlil kiti (Roche, Indianapolis, IN, ABD) ile 530 nm'de indirgenmiş NADH formunun oksidasyonu ile izlendi. Sitotoksisite şu denklemle belirlendi: [(tedavi edilen grubun OD530'u - kontrol grubunun OD530'u) / (Triton X-100 ile tedavi edilen grubun OD530'u - kontrol grubunun OD530'u)] ×% 100.
            Western Lekeleme
            Toplam hücresel özütler (30 ug) hazırlandı ve PARP tespiti için% 8 sodyum dodesilsülfat (SDS) -poliakrilamid mini jellerde ve kaspaz-3, kaspaz-9 için% 12 SDS-poliakrilamid mini jellerde, Bcl-2 ailesi, tERK, pERK ve a-tübülin tespiti ve Immobilon poliviniliden diflorür membranlarına (Millipore, Bedford, MA, ABD) aktarıldı. Membranlar 4 ° C'de% 1 sığır serum albümini (BSA) ile inkübe edildi ve ardından belirtilen antikorlarla oda sıcaklığında 3 saat daha inkübe edildikten sonra alkalin fosfatazla konjuge immünoglobulin G (IgG) antikoru ile 1 saat inkübe edildi. Proteinler, kolorimetrik substratlar, nitroblue tetrazolyum (NBT) ve 5-bromo-4-kloro-3-indolil fosfat (BCIP) ile inkübe edilerek görselleştirildi.
            Kolonik karsinom hücreleri tarafından reaktif oksijen türlerinin (ROS) oluşumunun ölçümü
            Farklı tedaviler altında kolonik karsinom hücreleri tarafından hücre içi ROS üretimi, DCFH-DA'nın DCF'ye oksidasyonu ile ölçüldü. DCFH-DA, floresan olmayan polar türev DCFH'ye hidrolize edildiği ve böylece hücreler içinde hapsolduğu, hücrelere kolayca yayılan polar olmayan bir bileşiktir. DCFH-DA oksitlendiğinde, yüksek floresan DCF'ye dönüşür. Tedaviden sonra hücreler, 50 uM DCFH-DA ile 37 ° C 'de 10 dakika boyunca karanlıkta inkübe edildi, daha sonra 10 4 hücreleri numune başına elde edildi, hücrelerin floresans bir FACScan (Becton Dickinson, Sunnyvale, CA, ABD kullanılarak analiz edilmiştir ) 488 nm'de eksitasyon ve 530 nm'de emisyon ile akış sitometresi.
            DNA fragmantasyon deneyi
            Tripsinlenmiş hücreler buzla soğutulmuş fosfat tamponlu salin (PBS) ile yıkandı ve en az 1 saat -20 ° C'de% 70 etanol içinde sabitlendi. Fiksasyondan sonra hücreler iki kez PBS ile yıkandı ve 1 ml% 0.5 Triton X-100 / PBS içinde 37 ° C'de 30 dakika süreyle 1 mg / ml RNase A içeren inkübe edildikten sonra 1 ml 50 ug / ml ile boyandı propidyum iyodür (PI) 10 dakika süreyle. PI-DNA kompleksinden yayılan floresan, floresan boyanın FACScan akış sitometrisi (Becton Dickenson, San Jose, CA, ABD) ile uyarılmasından sonra nicelendirildi. G 2 / M ve alt G 1 fazlarındaki hücrelerin oranları ölçüldü ve toplam sayımların yüzdeleri (%) olarak ifade edildi.
            Mitokondriyal membran potansiyelinin (MMP) ölçümü
            Farklı muamelelerden sonra hücreler, 40 nM DiOC6 (3) ile 15 dakika 37 ° C'de inkübe edildi, sonra buz gibi soğuk PBS ile yıkandı ve 10 dakika boyunca 500 x g'de santrifüj ile toplandı . Toplanan hücreler, 40 nM DiOC6 (3) içeren 500 ml PBS içinde yeniden süspanse edildi. DiOC6'nın (3) floresan yoğunlukları, sırasıyla 484 ve 500 nm eksitasyon ve emisyon ayarlarıyla bir akış sitometresinde (FACScan, Becton Dickinson) analiz edildi.
            Kaspaz-3, -8 ve -9 faaliyetlerinin analizi
            Ac-DEVD-pNA, kaspaz-3 aktivitesini saptamak için kolorimetrik bir proteaz substratı olarak kullanıldı. Farklı işlemlerden sonra hücreler toplandı ve üç kez PBS ile yıkandı ve 50 mM Tris – HCl (pH 7.4), 1 mM EDTA ve 10 mM EGTA içinde yeniden süspanse edildi. Hücre lizatları, 3 dakika boyunca 15.000 rpm'de santrifüjleme ile berraklaştırıldı ve 200 ug protein içeren berrak lizatlar, 37 ° C'de 1 saat süreyle belirtilen spesifik kolorimetrik substratlardan 100 uM ile inkübe edildi. Belirtilen kaspaz-3, -8 ve -9 enzimlerinin alternatif aktiviteleri, 405 nm'de absorbans ölçülerek kolorimetrik substratın bölünmesi olarak tarif edildi.
            Kolon karsinom hücrelerinde EVO ile hücre döngüsü ilerlemesinin ve hipodiploid hücrelerin tespiti
            Hücreler iki kez 24 oyuklu plakalara kaplandı, sonra 24 saat inkübe edildi. Ortam çıkarıldı ve her oyuğa farklı muameleler eklendi. Hücreler 12 saat muamele edildi ve süpernatan ve hücreler daha sonra hücreler% 0.25'e, Tripsin-EDTA solüsyonuna 10 dakika maruz bırakılarak toplandı, sonra santrifüjlendi ve fosfat tamponlu salin (PBS) içinde yıkandı, 3 mL buz soğukluğunda 100 % etanol. Tüm örnekler karanlıkta oda sıcaklığında 30 dakika inkübe edildi. Hücre döngüsü dağılımı ve hipodiploid hücreler, FACSan Flow Cytometer (FACScan, Becton Dickinson) kullanılarak belirlendi.
            istatistiksel analiz
            Değerler, üçlü deneylerin ortalama ± standart hatası (SE) olarak ifade edilir. Her deney için ilgili kontrollerden farkın önemi, uygulanabildiğinde post-hoc Bonferroni analizi ile tek yönlü varyans analizi (ANOVA) kullanılarak test edildi ve &lt;0.05 veya &lt;0.01 p değerleri istatistiksel olarak anlamlı kabul edildi.
            Destek Bilgisi

            Şekil S1.
            Yazar Katkıları
            Deneyleri tasarladı ve tasarladı: YCC. Deneyleri gerçekleştirdi: CCC SCS CHK. Veriler analiz edildi: CCC MSW CHK. Katkıda bulunan reaktifler / malzemeler / analiz araçları: CHC LLY. Yazdı: YCC.
            Referanslar
            1.Jemal A, Bray F, Center MM, Ferlay J, Ward E, ve diğerleri. Küresel kanser istatistikleri. CA Cancer J Clin 61: 69–90.
            Makaleyi GörüntüleGoogle Scholar
            2.Ferlay J, Shin HR, Bray F, Forman D, Mathers C, ve diğerleri. (2010) 2008'de dünya çapında kanser yükü tahminleri: GLOBOCAN 2008. Int J Cancer 127: 2893–2917.
            Makaleyi GörüntüleGoogle Scholar
            3.Carnesecchi S, Langley K, Exinger F, Gosse F, Raul F (2002) Bitkisel uçucu yağların bir bileşeni olan Geraniol, insan kolon kanseri hücrelerini 5-Florourasil tedavisine duyarlı hale getirir. J Pharmacol Exp Ther 301: 625–630.
            Makaleyi GörüntüleGoogle Scholar
            4.Line-Edwige M, Raymond F, Francois E, Edouard NE (2009) Bazı Gabonese şifalı bitkilerin alkollü ekstraktlarının insan kolon kanseri hücreleri üzerindeki antiproliferatif etkisi. Afr J Tradit Complement Altern Med 6: 112-117.
            Makaleyi GörüntüleGoogle Scholar
            5.Newman DJ, Cragg GM (2007) Son 25 yılda yeni ilaçların kaynağı olarak doğal ürünler. J Nat Prod 70: 461–477.
            Makaleyi GörüntüleGoogle Scholar
            6.Sun Q, Chen T, Wang X, Wei X (2010) Taxol, hem protein sentezinden hem de MAPK yolağından bağımsız olarak paraptozu indükler. J Cell Physiol 222: 421–432.
            Makaleyi GörüntüleGoogle Scholar
            7.Kan SF, Yu CH, Pu HF, Hsu JM, Chen MJ, vd. (2007) Evodiaminin insan prostat kanseri hücre hatları DU145 ve PC3 üzerindeki anti-proliferatif etkileri. J Cell Biochem 101: 44–56.
            Makaleyi GörüntüleGoogle Scholar
            8.Kobayashi Y (2003) Farelerde Evodia rutaecarpa meyvelerinden evodiaminin nosiseptif ve anti-nosiseptif etkileri. Planta Med 69: 425–428.
            Makaleyi GörüntüleGoogle Scholar
            9.Lee TJ, Kim EJ, Kim S, Jung EM, Park JW, vd. (2006) İnsan lösemik U937 hücrelerinde evodiamin tarafından indüklenen kaspaz bağımlı ve kaspaz bağımsız apoptoz. Mol Cancer Ther 5: 2398–2407.
            Makaleyi GörüntüleGoogle Scholar
            10.Ogasawara M, Suzuki H (2004) Evodiamin ile hepatosit büyüme faktörünün neden olduğu invazyon ve tümör hücrelerinin göçünün inhibisyonu. Biol Pharm Bull 27: 578–582.
            Makaleyi GörüntüleGoogle Scholar
            11.Wang T, Kusudo T, Takeuchi T, Yamashita Y, Kontani Y, vd. (2013) Evodiamine, adipositlerde insülin ile uyarılan mTOR-S6K aktivasyonunu ve IRS1 serin fosforilasyonunu inhibe eder ve obez / diyabetik farelerde glikoz toleransını iyileştirir. PLoS One 8: e83264.
            Makaleyi GörüntüleGoogle Scholar
            12.Chien CC, Ko CH, Shen SC, Yang LY, Chen YC (2012) COX-2 / PGE2'nin kolorektal karsinom hücrelerinin gossipol kaynaklı apoptozundaki rolü. J Cell Physiol 227: 3128–3137.
            Makaleyi GörüntüleGoogle Scholar
            13.Chien CC, Shen SC, Yang LY, Wu CY, Liau JS, ve diğerleri. (2009) C2-seramid kaynaklı apoptozun PDGF ve FGF inhibisyonunda telomeraz ve siklooksijenaz-2'nin aktivasyonu. J Cell Physiol 218: 405–415.
            Makaleyi GörüntüleGoogle Scholar
            14.Ko CH, Shen SC, Yang LY, Lin CW, Chen YC (2007) İnsan kolorektal karsinom hücrelerinde ROS'a bağlı mitokondri yolu yoluyla tümör büyümesinin gossypol indirgenmesi. Int J Cancer 121: 1670–1679.
            Makaleyi GörüntüleGoogle Scholar
            15.Huang YC, Guh JH, Teng CM (2004) İnsan lösemik T-lenfositlerinde evodiamin tarafından mitotik durma ve apoptozun indüksiyonu. Life Sci 75: 35-49.
            Makaleyi GörüntüleGoogle Scholar
            16.Fei XF, Wang BX, Li TJ, Tashiro S, Minami M, vd. (2003) Evodiae Fructus'un bir bileşeni olan Evodiamine, tümör hücrelerinde anti-proliferasyon etkilerine neden olur. Cancer Sci 94: 92–98.
            Makaleyi GörüntüleGoogle Scholar
            17.Chipuk JE, Moldoveanu T, Llambi F, Parsons MJ, Green DR (2010) BCL-2 aile birleşimi. Mol Cell 37: 299-310.
            Makaleyi GörüntüleGoogle Scholar
            18.De Chiara G, Marcocci ME, Torcia M, Lucibello M, Rosini P, ve diğerleri. (2006) p38 MAPK tarafından Bcl-2 Fosforilasyon: hedef alanların ve biyolojik sonuçların belirlenmesi. J Biol Chem 281: 21353–21361.
            Makaleyi GörüntüleGoogle Scholar
            19.Maryanovich M, Gross A (2013) Hücre kaderi düzenlemesi için bir ROS reostası. Trends Cell Biol 23: 129–134.
            Makaleyi GörüntüleGoogle Scholar
            20.Zhou J, Giannakakou P (2005) Kanser kemoterapisi için hedeflenen mikrotübüller. Curr Med Chem Antikanser Ajanlar 5: 65–71.
            Makaleyi GörüntüleGoogle Scholar
            21.Mahindroo N, Liou JP, Chang JY, Hsieh HP (2006) Kanser tedavisi için antitubulin ajanları - tıbbi bir kimya güncellemesi. Terapötik Patentler Üzerine Uzman Görüşü 16: 647-691.
            Makaleyi GörüntüleGoogle Scholar
            22.Johansson M, Persson JL (2008) Kanser tedavisi: hücre döngüsü düzenleyicilerini hedefleme. Anticancer Agents Med Chem 8: 723–731.
            Makaleyi GörüntüleGoogle Scholar
            23.Zhang C, Fan X, Xu X, Yang X, Wang X, vd. (2010) Evodiamin, insan kolon lovo hücrelerinde kaspaz bağımlı apoptoz ve S fazı tutuklamasını indükler. Antikanser İlaçlar 21: 766–776.
            Makaleyi GörüntüleGoogle Scholar
            24.Wang KL, Hsia SM, Yeh JY, Cheng SC, Wang PS, ve diğerleri. (2013) Evodiaminin İnsan Meme Kanseri Hücreleri Üzerindeki Anti-Proliferatif Etkileri. PLoS One 8: e67297.
            Makaleyi GörüntüleGoogle Scholar
            25.Yang JC, Lu MC, Lee CL, Chen GY, Lin YY, ve diğerleri. (2011) Göğüs kanseri hücrelerinin ROS aracılı mekanizmalar yoluyla seçici hedeflenmesi, yeni bir diterpen, gelomulide K. ile paklitakselin letalitesini güçlendirir. Free Radical Biology and Medicine 51: 641-657.
            Makaleyi GörüntüleGoogle Scholar
            26.Shen SC, Yang LY, Lin HY, Wu CY, Su TH, ve diğerleri. (2008) Reaktif oksijen türlerine bağımlı HSP90 protein bölünmesi, JNK aktivasyonu yoluyla telomeraz aktivitesinin inhibisyonu yoluyla arsenik As (+3) - ve MMA (+3) ile indüklenen apoptoza katılır. Toksikoloji ve Uygulamalı Farmakoloji 229: 239–251.
            Makaleyi GörüntüleGoogle Scholar
            27.Chen YC, Shen SC, Tsai SH (2005) Prostaglandin D2 ve J (2), kaspaz 3 kaskadının aktivasyonu ve reaktif oksijen türlerinin üretimi yoluyla insan lösemi hücrelerinde apoptozu indükler. Biochimica Et Biophysica Açta-Moleküler Hücre Araştırması 1743: 291–304.
            Makaleyi GörüntüleGoogle Scholar
            28.Jang BC, Paik JH, Jeong HY, Oh HJ, Park JW, ve diğerleri. (2004) Leptomisin B ile indüklenen apoptoz, Mcl-1 ve XIAP ekspresyonunun kaspaz aktivasyonu ve aşağı regülasyonu aracılığıyla gerçekleşir, ancak U937 lösemi hücrelerinde ROS üretimi yoluyla değil. Biochem Pharmacol 68: 263–274.
            Makaleyi GörüntüleGoogle Scholar
            29.Ko CH, Shen SC, Hsu CS, Chen YC (2005) Mitokondriyal bağımlı, reaktif oksijen türlerinden bağımsız apoptozis myricetin: protein kinaz C, sitokrom c ve kaspaz kaskadının rolleri. Biochem Pharmacol 69: 913–927.
            Makaleyi GörüntüleGoogle Scholar
            30.Du J, Wang XF, Zhou QM, Zhang TL, Lu YY, ve diğerleri. (2013) Evodiamin, in vitro ve in vivo olarak MDAMB-231 insan meme kanseri hücrelerinde apoptozu indükler ve metastazı inhibe eder. Oncol Rep 30: 685–694.
            Makaleyi GörüntüleGoogle Scholar
            31.Yang J, Wu LJ, Tashino S, Onodera S, Ikejima T (2010) Protein tirozin kinaz yolağından türetilen ROS / NO üretimleri, evodiaminle tedavi edilen insan serviks karsinomu HeLa hücrelerinde G2 / M hücre döngüsü tutuklamasına katkıda bulunur. Free Radic Res 44: 792–802.
            Makaleyi GörüntüleGoogle Scholar
            32.Muller GA, Engeland K (2010) CDE / CHR promoter elemanlarının hücre döngüsüne bağlı gen transkripsiyonunun düzenlenmesindeki merkezi rolü. FEBS J 277: 877–893.
            Makaleyi GörüntüleGoogle Scholar
            33.Muller GA, Quaas M, Schumann M, Krause E, Padi M, vd. (2012) CHR promoter elementi, hücre döngüsüne bağlı gen transkripsiyonunu kontrol eder ve DREAM ve MMB komplekslerini bağlar. Nucleic Acids Res 40: 1561–1578.
            Makaleyi GörüntüleGoogle Scholar
            34.Chae HD, Kim J, Shin DY (2011) NF-Y, hem G1- hem de G2'ye özgü siklin promotörlerine bağlanır; CDK2 / Cyclin A'nın CDK1 / Cyclin B'ye bağlanmasında olası bir rol. BMB Rep 44: 553–557.
            Makaleyi GörüntüleGoogle Scholar
            35.Seo HR, Kim J, Bae S, Soh JW, Lee YS (2008) Ser-62 üzerinde c-Myc'in Cdk5 aracılı fosforilasyonu, siklin G1 tarafından siklin B1'in transkripsiyonel aktivasyonunda önemlidir. J Biol Chem 283: 15601–15610.
            Makaleyi GörüntüleGoogle Scholar

            Yorum yap

            Hazırlanıyor...
            X