Duyuru

Collapse

Devamını görüntüle
See less

Kedi Pençesi Otu - Uncaria tomentosa L.

Collapse
X
  • Filtrele
  • Zaman
  • Göster
Hepsini Sil
new posts

  • Kedi Pençesi Otu - Uncaria tomentosa L.

    Kedi Pençesi (Cat's Claw)


    Uncaria Tomentosa (Rubiaceae familyasından), iki ottan biri diğeri Uncalia guianensis’tir ve Uncaria Tomentosa (Kedi Pençesi’nin) ortak adı vardır.Bursit, lupus, kronik yorgunluk sendromu ve hem mideye hem de bağırsak rahatsızlıklarına uzanan diğer geleneksel faydalar ile, anti-iltihaplanma maddesi olarak geleneksel kullanımı olan bu sarmaşıklar, Amazon ormanda yetişen sarmaşıklardır.

    Kedinin pençesi olarak da bilinen Uncaria tomentosa, geleneksel tıpta kullanılan, Güney Amerika'da, özellikle Peru ve Brezilya'da ve Orta Amerika'da yaygın olan bir bitkidir. U. tomentosa(Kedi Pençesi), antienflamatuar ve antioksidan özellikler ve kansere karşı koruyucu etkilerin yanı sıra kardiyovasküler, merkezi sinir ve lokomotor sistemlerindeki olumlu etkilerini içeren sayısız bilimsel rapor vardır. Uncaria tomentoza'nın bu biyoaktif özellikleri temel olarak alkaloid içeriklerine atfedilmiştir , ancak antioksidan etkisi gibi bazı özelliklerin fenolik içerikleriyle ilişkili olabileceği bildirilmiştir.

    Fenolik bileşikler, bazı insan bakterilerinde antimikrobiyal maddeler olarak bilinir. Bu tür hidroksibenzoik ve hidroksisinnamik asitler gibi bazıları, karşı antimikrobiyal etkiler göstermiştir. Salmonella monomerik flavonoller de gibi patojen bakterilerin gelişimini inhibe edebilen ise Clostridium perfringens , C. dificile , Bacteroides spp., Probiyotik bakterilerin suşları ise Lactobacillus ve Bifidobacterium daha az hassas görünüyor. Proantosiyanidinler söz konusu olduğunda, bu bileşiklerin uzun süreli uygulanmasının, Gram-negatif türlere (yani Enterobacteriaceae ve Bacteriodes ) karşı mikrobiyal popülasyonda bir değişiklik meydana getirdiği ve Gram-pozitif bakterilerin yüksek oranda inhibe edilmek üzere daha büyük bir duyarlılık gösterdiği belirtilmiştir. moleküler ağırlık polifenolleri.

    U. tomentosa'nın ,üçlü dörtlü bir kütle spektrometresine bağlı sıvı kromatografisi kullanan düşük moleküler ağırlıklı polifenoller üzerindeki son çalışması, prosiyanidin dimerleri ve trimerleri, propelargonidin dimerleri ve sinknainin tipi flavalijenler (epikateşinler ikame edilmiş) dahil olmak üzere yüksek flavan-3-ol içeriğini göstermiştir. fenilpropanoidler) ile bunların bir kısmı Kedi Pençesinde ilk kez bildirilmiştir. Bununla birlikte, daha büyük moleküler ağırlıklı polifenollerin incelenmesi , Uçuş Süresi (TOF) analizörlerine dayalı olanlar gibi daha geniş bir m / z aralığına sahip kütle spektrometrelerinin kullanılmasını gerektirir . Dolayısıyla, bu çalışmanın amacı, U. tomentosa'nın polimerik proantosiyanidinlerinin polimerik proantosiyaninlerinin detaylı bir karakterizasyon çalışmasını gerçekleştirmekti.Elektrosprey iyonizasyonu ve dörtlü uçuş süresi analiz cihazı (ESI-QTOF MS) ile donatılmış bir cihazda doğrudan enjeksiyonlu (DI) kütle spektrometresi kullanılarak ekstraktlar. Ek olarak, ekstraktlar farklı biyoaktiviteler, özellikle antioksidan aktivite, solunum patojenlerine karşı antimikrobiyal aktivite ve mide ve kolon kanseri hücre soylarında antitümoral etkiler açısından tahlil edildi. Son olarak, bu aktiviteler ile U. tomentosa ekstrelerinin toplam proantosiyanidin içeriği arasındaki olası ilişkiler araştırılmıştır.

    Proantosiyanidinler, kurucu monomerlerin yapılarına (propelargonidinler, prociyanidinler, prodelfinidinler, profisetinidinler ve prorobinetinidinler), bunların interflavanik bağ tipine (tip A ve tip B protandiidinler), interflavanik bağ tipine (tip A ve tip proantididinler) bağlı olarak yüksek derecede yapı değişkenliği olan yoğunlaştırılmış flavan-3-ollerdir. Polimerizasyonun (DP). Proantosiyanidinler, antioksidan, antienflamatuar ve antikansergen özellikleri gibi biyolojik özellikleri nedeniyle, kanser önlenmesinde proantosiyanidinlerin potansiyel kullanımı nedeniyle daha fazla araştırılan araştırmalar ile ilgi çekmeye başlamıştır.


    MACA olarak bilinen Lepidium meyenii , 50μg / mL’lik bir konsantrasyon kullanıldığında insan kıkırdak hücresinde IGF-1 düzeylerini yaklaşık 2.7 kat arttırabilir; 10 μg / mL Kedi pençesinin birlikte uygulanması, izolasyonda zayıf etkilere sahip olmasına rağmen bu uyarımından sonra 3.8 kat artar.

    Uncaria Tomentosa (Rubiaceae familyasından), iki ottan biri diğeri Uncalia guianensis’tir ve Uncaria Tomentosa (Kedi Pençesi’nin) ortak adı vardır.Bursit, lupus, kronik yorgunluk sendromu ve hem mideye hem de bağırsak rahatsızlıklarına uzanan diğer geleneksel iddia edilen faydalar ile, anti-iltihaplanma maddesi olarak geleneksel kullanımı olan bu sarmaşıklar, Amazon ormanda yetişen sarmaşıklardır. Aksi belirtilmedikçe bu makale Uncaria Tomentosa’nın özelliklerini açıklamaktadır

    En az bir laboratuvar ortamındaki çalışmada, Maca ve Uncaria Tomentosa (Kedi Pençesi’nin) kireçlenme açısından ek avantajlara sahip olabileceğini göstermektedir; sinerjizm henüz ortaya konmamış veya canlı sistemlerde herhangi bir deneme olmamıştır.Hem Maca hem de Kedi pençesi (50 ve 10μg / mL) ile IL-1β’nın uyardığı IGF-1 indirgemelerinin kısmi bastırması, kombinasyon ile neredeyse mutlaktır ve IL-1β ile uyarılan GAG salımı üzerinde benzer normalize edici etkiler görülmüştür.





    Nuran Serinkaya
    Hocam CAT'S CLAW, JAPON POLİGONUMU kullandım hocam çok güzel kalbi güçlendiriyor buralar çok sıcak sıcakdan kaplerimiz çapıyor KALBE İYİ GELİYOR. BAĞIRSAKLARI TERTEMİZ FIRÇALIYOR. KABIZLIK asla yaşamıyorsun ben böyle JAPON POLİGONUMU görmedim müthiş. BOSWELLİA hocam çok kullandım ben BOSWELLİA sayesinde ANTİBİYOTİKTEN KURTULDUM. Kandaki iltahapları önlüyor çok faydasını gördüm bu kapsülden önce salık oca hasdane olsun antibiyotik çok yazdılar hocam iyikide sizleri tanımışız dilerim sayesin kimyasalları bırakdım hocam sabah kalkardım ağızlarım zehir gibi olurdu sizin sayenizde kimyasalar yok artık keşke önce bulasdım hocam önce hiç birşeler yiyenezdim şimdi heşylerimi yiyorum allahım binlerce razı olun hocam çok teşekürler dünyalar varmış yani annemden yeniden domuşum gibiyim şürler olsun çok teşekürler hocam
    KAYNAK

    serinkayanuran
    Hocam hayırlı günler diyoruz sizlere. JAPON POLİGONUMU, CATS CLAW DENEDİM barsakları adeta fıçalıyor KALBİN DOSDU KALBE ÇOK YARDIMCIDIR KAPÇAPIN TISINI ORTADAN KALDIRIYOR HOCAM bizler çok sipor yapdımız için kalp çarpınıtısın ortadan kaldırıyor BOSWELLIA 2 YILIGEÇİK KUANDIM hata buzdolabına bakdım hiç açlmamış hemen açdık şuan elimde var kullanıyorum EFKSİYONU YOKEDİYOR TABSAYILMAZ FAYDALARINI GÖRDÜM ben bu BOSWELLA KULANMAN ÖNCE ÇOK ENFESİYONUM OLURDU KANDAKİ EFEKSİYOLARIMI YOK ETİ HOCAM ALLAHIM İYİ KİDE HOCAMIZI TANIMIŞIZ bundan önce salık oca hadi bakalım antibiyotik verilerddi hocam sizin bitkilerine başlıyalı antibiyotik tarih oldu hocam çok teşekürler sizler iyikide varsınız hocam çok mutluyum sizin sayenizde kimyasallara soooon dur allahım razı olun
    KAYNAK

    Hülya Demir
    CAT'S CLAW SETİ kullandım KRONİK YORGUNLUĞUM gitti MİDE ve BAĞIRSAKLARIM DÜZENE GİRDİ kendimi çok sağlıklı hissediyorum hocam teşekkür ederim.
    KAYNAK

    fatihcankilic
    CAT'S CLAW KAPSÜL ürününü BAĞIRSAK rahatsızlığım için kullandım çok mükemmel.
    KAYNAK
    Konu mert tarafından (https://bitkiseltedavi.net/vb5/member/685-mert Saat 02 Aralık 2020, 14:13 ) değiştirilmiştir.

  • #2
    Uncaria tomentosa, Yaprak Dekoksiyonunu , Kanser ve Normal Hücrelerdeki ROS Üretimini Farklı Şekilde Modüle Ediyor ve Sisplatin Sitotoksisitesini Etkiliyor

    Anita Kośmider , 1, * Edyta Czepielewska , 2 Mieczysław Kuraś , 3 Krzysztof Gulewicz , 4 Wioleta Pietrzak , 5 Renata Nowak , 5 ve Grażyna Nowicka 1
    Thomas J. Schmidt, Akademik Editör
    Yazar bilgileri Madde notları Telif Hakkı ve Lisans bilgileri Uyarı
    Git: Soyut, Özet

    Uncaria tomentosa , geleneksel Peru tıbbında uzun bir kullanım tarihi olan odunsu bir asmadır ve günümüzde bu asmayı içerik olarak içeren takviyeler mevcuttur. Uncaria tomentosa'nın immüno -modülatör, anti-enflamatuar ve antikanser özellikleri önerilmiş ve esas olarak tetrasiklik veya pentasiklik oksindol alkaloitlerin varlığına atfedilmiştir. Bununla birlikte, ekstraktlarda meydana gelen farklı bileşiklerin sinerjik etkisi ve redoks işlemlerinin modülasyonu, Uncaria tomentosa'nın antikanser aktivitesini önemli ölçüde etkileyebilir . Bu çalışmanın amacı, ilk kez kurutulmuş Uncaria tomentosa'nın tetrasiklik alkaloitlerinin serbest sulu ekstraktının (kaynatma) sitotoksik etkilerini araştırmaktı.normal ve kanser hücrelerinde yaprak bıçakları ve test edilen ekstraktın sisplatin (CDDP) sitotoksisitesi üzerindeki etkisini değerlendirmek. Test Edilen Uncaria tomentosa özütü, NHDF hücreleri için sitotoksik değildi, fakat HepG2 hücrelerine karşı sitotoksik etki gösterdi. Ekstrakt HepG2 hücrelerinde ROS üretimini arttırdı, bu da GSH seviyesinin azalmasına neden oldu ve bu, kaspaz-3 ve kaspaz-7'nin aktivasyonu ile bu hücrelerin apoptozisine yol açtı. Kanser hücrelerinde NF-activeB aktif formunda bir azalma gözlendi. Normal hücrelerde, ekstrakt ROS üretimini, GSH seviyesini ve NF-κB aktivitesini etkilememiştir ve hücre canlılığını sürdürmüştür. Uncaria tomentosa kaynatma ile ve aynı anda CDDP ile inkübasyon yapan HepG2 hücreleri , aynı koşullar altında iken HepG2'ye karşı CDPP sitotoksik aktivitesinde bir artışa neden olduUncaria tomentosa, CDDP'ye bağlı olarak NHDF hücre canlılığının azalmasını önler. Sonuçlar, Uncaria tomentosa'nın kaynatma kaynağının farklı kanser ve normal hücrelerin oksidatif metabolizmasını modüle ettiğini ve CDDP'nin kanser hücrelerine karşı sitotoksisitesinin ve aynı zamanda sisplatine karşı normal sağlıklı hücrelere karşı direncin arttığını göstermektedir. Gözlemlerimizi doğrulamak ve altta yatan moleküler mekanizmayı ve Uncaria tomentosa kaynağının kanser için potansiyel faydasını açıklamak için daha ileri çalışmalara ihtiyaç vardır .

    Anahtar Sözcükler: Uncaria tomentosa kaynatma, tanen ve alkaloitler, HepG2 hücreleri, ROS üretimi, NF-κB aktivitesi, CDDP sitotoksisitesi
    Git: 1. Giriş

    Önceki çalışmalar , Rubiaceae ailesinin bir Perulu bitkisi olan Uncaria tomentosa'nın farklı organik ve sulu özlerinin, imüno uyarıcı pentasiklik oksindol alkaloitler [ 1 ], ursan tipi pentasiklik triterpenler ve kinovik asit glikositlerinin bulunduğu bildirilen biyolojik olarak aktif maddeler içerdiğini ortaya koymuştur. anti-antiinflamatuar özellikler [ 2 ] ve viral replikasyonu [ 3 ] inhibe eder . Bu ekstreler, aynı zamanda mevcut veriler, neoplastik hücrelerin daha düşük proliferasyon göre ve DNA onarımı uyarılmış, kinik asit türevleri de dahil olmak üzere, alkil esterler karboksil içeriyordu [ 4 ], ve ayrıca kateşin monomerleri ve proantosiyanidinler gibi antioksidanların [olarak 5]. Günümüzde bileşen olarak bu asmayı içeren diyet takviyeleri mevcuttur ve kanser önleyici tedavide kullanılmaktadır.

    İn vitro çalışmalar, Uncaria tomentosa kabuğu ekstraktlarının insan lösemi hücreleri K562 ve HL60, EBV ile transforme edilmiş B lenfoma hücreleri [ 6 ] ve meme kanseri hücreleri MCF7 [ 7 ] dahil olmak üzere çeşitli hücre hatları üzerindeki antiproliferatif ve proapoptotik etkilerini göstermiştir . HL60 hücrelerinde Uncaria tomentosa'nın etil asetat ekstresi mitokondriyal membran potansiyelinde değişikliklere, sitokrom c'nin sitozole salınmasına ve kaspaz-3 aktivasyonuna neden olmuştur [ 8 ].

    , İn vitro çalışmalarda, oksindol alkaloidler [büyük miktarlarda ihtiva eden bir organik ekstreler, ancak 9 , 10 ] ve saf alkaloidler izole Uncaria tomentosa [ 11 , 12 ], Lewis akciğer karsinom [taşıyan farelerde in vivo neoplastik hücrelerin çoğalmasım inhibe 10 ], Kanser gelişimi üzerinde daha güçlü bir inhibitör etki, düşük alkaloit içerikli su özütlerinden kaynaklanmıştır. Su özütleri, vücut için daha uygun olan polar bileşikleri içerir. Ayrıca Uncaria tomentosa'nın anti-enflamatuar ve muhtemelen antikanser özelliklerinin , farklı bileşiklerin sinerjik etkisiyle ilişkili olabileceği öne sürülmüştür [ 13] ve redoks işlemlerinin modülasyonu, bu bitkinin antikanser aktivitesinde çok önemli bir rol oynayabilir [ 14 ].

    Bu çalışmanın amacı, ilk kez tetrasiklik alkaloid içermeyen tanenlerin ve tanenlerin zengin sulu ekstraktının (kaynatma) sitotoksik aktivitesini ve Uncaria tomentosa yaprak kanatlarının zengin sulu ekstraktını (kaynatma) ve insan hepatomunda, HepG2 hücrelerinde ve normal insanda ROS üretimi üzerindeki etkisini araştırmaktı. dermal fibroblast, NHDF. Uncaria tomentosa'nın kanser için adjuvan tedavisinde potansiyel yararına bir içgörü kazandırmak için kanser ekstraktlarına ve normal sağlıklı hücrelere karşı bu ekstraktın sisplatin sitotoksisitesi üzerindeki etkisini de değerlendirdik . Uncaria tomentosa'nın kabuğu ve kök ekstraktlarının kanser hücreleri üzerindeki etkilerine odaklanan önceki raporlar , yapraklar benzer aktif bileşikler içerir ve uygun materyal önemli bitki hasarı olmadan toplanabilir [15 ]. Bu çalışmada kullanılan ekstrakt Uncaria tomentosa'nın kaynatılması için yaygın olarak kabul edilen prosedüre göre kurutulmuş bitki yapraklarının su içinde ısıtılmasıyla hazırlandı .

    Git: 2. Sonuçlar ve Tartışma

    2.1. Uncaria tomentosa Yapraklarından İncelenen Decoction Kompozisyonu

    Bitki ekstreleri, antioksidan özellikleri ve apoptoz indüksiyon kapasitelerinin bir sonucu olabilecek antikanser aktivitesi için kapsamlı bir şekilde test edilmiştir ve gelecekte böyle ekstreler kanser için bir adjuvan tedavi olarak yararlı olabilir [ 2 , 16 ]

    Uncaria tomentosa yapraklarından elde edilen kaynatma (su özü) pentasiklik oksindol alkaloitleri (kuru özüt kütlesinin% 13'ü) içerir ve terasiklik alkaloit içermez ( Şekil 1 ). Pentasiklik oksindol alkaloidleri: ekstraktta bulunan mitralfilin ve pteropodinin, kanser hücrelerinin proliferasyonunu inhibe ettiği ve immüno-modülatör özellikler gösterdiği bildirilmiştir [ 17 , 18 ]. Tetrasiklik alkaloitlerin, pentasiklik alkaloitlerin [ 19 ] etkinliğini önemli ölçüde azaltabildiği ve ABD Farmakopesi'ne göre sadece tetrasiklik oksindol alkaloitleri içermeyen ekstraktların insanlarda araştırma ve / veya terapötik amaçlar için kullanılabileceği kabul edilmiştir [ 20 ]. Test edilen ekstrakt ayrıca fenolik bileşikler içerir (Tablo 1 ) proantosiyanidinlere ait ve antioksidan aktiviteye sahip yoğunlaşmış tanenler dahil [ 2 , 21 ].
    Resim, çizim vb. İçeren harici bir dosya. Nesne adı molecules-22-00620-g001.jpg
    Şekil 1
    Uncaria tomentosa'nın yapraklarından sulu ekstrakttaki alkaloitlerin HPLC analizi . tablo 1

    Kolorimetrik deneylerle ölçülen ve mg gallik asit (GA / g kuru ekstrakt) olarak ifade edilen Uncaria tomentosa'nın özütlerinden kuru (su) ekstraktta bulunan toplam fenolik bileşikler (TPC), flavonoidler (TFC) ve yoğunlaştırılmış tanen (CT) içeriği , mg quercetin (Q / g kuru ekstrakt), mg kateşin (Cat / g kuru ekstrakt) ve mg pyrogallol (PGA / g kuru ekstrakt). Veriler, üç bağımsız deneyden elde edilen ortalama ± SD'dir.
    Uncaria tomentosa yapraklarından kuru su özü 242.37 ± 0.36 2.26 ± 0.09 21.81 ± 0.41 110.0 ± 2.0
    2.2. Uncaria tomentosa Dekoksiyonunun Kanser ve Normal Hücre Canlılığı Üzerine Etkisi

    Uncaria tomentosa yapraklarından elde edilen ekstrenin , NHDF hücreleri için toksik olmadığı kabul edilirken, sadece> 1 g / mL'lik yüksek ekstre konsantrasyonları kullanıldığında hücre canlılığının anlamlı şekilde azaldığı gözlendi. Bu ekstresi ile HepG2 hücrelerine ilişkin bu çalışmada tedavisinde (hücre canlılığında bir önemli konsantrasyon bağımlı azalma olduğu Şekil 2, MTT deneyi IC sonuçlarına göre), ve 50 / mL konsantrasyon değerleri belirlenmiş 580 ug (% 50 canlılık inhibisyon konsantrasyonu).
    Resim, çizim vb. İçeren harici bir dosya. Nesne adı molecules-22-00620-g002.jpg
    şekil 2
    Hücre canlılığı, MTT mitokondriyal dönüşümü ile değerlendirildi. NHDF ve HepG2 hücreleri , 37 ° C'de 72 saat boyunca Uncaria tomentosa yaprakları özü (30-1160 ug / mL) ile işlendi . Daha sonra, hücrelerin mitokondriyal metabolik aktivitesi MTT tahlili ile ölçülmüştür. Veriler, üç kopya halinde gerçekleştirilen üç bağımsız deneyden elde edilen ortalama ± SD olarak ifade edildi. İstatistiksel olarak anlamlı farklar: * p <0.05 ve ** p <0.001 kontrole (işlenmemiş hücreler) karşılık gelir.

    Ekstrakt ve kontrol hücreleri ile inkübe edilmiş hücreler flüoresansta da gözlendi ( Şekil 3 ). Test edilen ekstrenin konsantrasyonu arttıkça, kalseinle yeşil lekelenen canlı HepG2 hücrelerinin sayısında ilerici bir azalma ve propidium iyodürle (PI) kırmızı renkle boyanmış ölü hücrelerin sayısında bir artış oldu [ 22 ]. 145 ug / mL'lik ekstrakt konsantrasyonunda ( Şekil 3 j-l) HepG2 hücrelerinin% 22'si kırmızı lekeli bulundu ve bu sayı kontrol hücrelerine göre anlamlı derecede daha yüksekti (* p <0.05). HepG2 hücreleri ile benzer koşullar altında inkübe edilen NHDF hücrelerinde floresans görüntülerinde, hücre morfolojisinde ve kırmızı lekeli hücrelerin miktarında önemli bir değişiklik görülmemiştir ( Şekil 3 a-f).
    Resim, çizim vb. İçeren harici bir dosya. Nesne adı molecules-22-00620-g003a.jpg
    Resim, çizim vb. İçeren harici bir dosya. Nesne adı molecules-22-00620-g003b.jpg
    Figür 3
    Uncaria tomentosa özü ile muameleden sonra NHDF ( a - f ) ve HepG2 ( g - l ) hücrelerinin morfolojik değişiklikleri . Işık mikroskobunda (100 x) gözlenmemiş muamele edilmemiş hücreler ( a , g ); ( b , h ), kalsein-AM ile lekelemeden sonra floresan (200 x), PI ile lekelemeden sonra floresan (200 x) ile ( c , i ). Calcein-AM ( e , k ) ve PI boyamasından ( f , l ) sonra flüoresansta gözlenen 145 ug / mL ekstrakte ile işlenen hücreler), sırasıyla. Canlı hücrelerde kalsein yeşil flüoresans yayar, PI sadece ölü hücrelerde kırmızı flüoresans yayar. 2.3. Uncaria tomentosa Decoction'un Hücre Apoptozisi Üzerine Etkisi

    HepG2 hücrelerinin Uncaria tomentosa ile inkübasyonu, 72.5 µg / mL ve −145 µg / mL konsantrasyonlarında kaynaşmaya neden olur, Apoptotik hücrelere karşılık gelen Annexin pozitif hücre sayısında bir artışa neden olurken, Annexin pozitif sayısında anlamlı bir fark olmaz ve PI pozitif hücreler gözlendi. 145 µg / mL'den yüksek Uncaria tomentosa kaynatma konsantrasyonları , geç apoptotik (Annexin pozitif ve PI pozitif) veya nekrotik hücrelerin sayısında önemli bir artışa (* p <0.05) neden olmuştur ( Şekil 4 ).
    Resim, çizim vb. İçeren harici bir dosya. Nesne adı molecules-22-00620-g004a.jpg
    Resim, çizim vb. İçeren harici bir dosya. Nesne adı molecules-22-00620-g004b.jpg
    Şekil 4
    Erken (An + / PI - ) ve geç (An + / PI + ) apoptozdaki HepG2 hücrelerinin sayısı annexin V-FITC / PI boyama ve ardından akış sitometri analizi kullanılarak değerlendirildi. Hücreler, 72 saat boyunca Uncaria tomentosa yaprakları özü ile işlendi . Veriler, üç kopya halinde gerçekleştirilen iki bağımsız deneyden elde edilen ortalama ± SD olarak ifade edildi. İstatistiksel olarak anlamlı fark * p <0.05, kontrol (tedavi edilmemiş) hücreleri ifade eder. Kontrol hücrelerinin ve ekstrakte ile işlenmiş hücrelerin (72.5-580 µg / mL) temsili histogramları gösterilmiştir.

    NHDF hücrelerinde benzer koşullar altında, Uncaria tomentosa kaynağının , 72.5 ug / mL ve 145 ug / mL konsantrasyonlarında Annexin-pozitif ve Annexin-pozitif ve PI-pozitif hücrelerin sayısı üzerinde hiçbir etkisi bulunmamıştır (veriler gösterilmemiştir). 2.4. Uncaria tomentosa Decoction'un ROS Üretimi ve GSH Seviyesine Etkisi

    HepG2 hücrelerinin canlılığındaki değişiklikler mitokondriyal elektron taşıma zincirindeki fonksiyonel değişikliklerle ve oksidatif stresin gelişmesiyle ilişkili olabilir, bu nedenle HepG2 ve NHDF hücrelerinde ROS üretimi belirlendi.

    HepG2 hücrelerinde ( Şekil 5 b) ' de gösterildiği gibi kontrol grafiği (ekstrakt olmayan hücreler için) , farklı Uncaria tomentosa konsantrasyonları ile inkübe edilen hücrelerde DCF yoğunluğu alanlarının altında yer alır . Bu, Uncaria tomentosa özütünün neden olduğu hücresel ROS üretiminde bir artış olduğunu gösterir . En yüksek ROS salınım oranı, ilk 0.5 saatlik inkübasyon sırasında gözlenirken, 1 saat sonra ROS seviyeleri dengelendi. Uncaria tomentosa özü, ROS oluşumunda artış ve istatistiksel olarak anlamlı bir artış (* p <0.05) görülmüştür. NHDF'deki benzer deneysel koşullar altında ( Şekil 5 a), Uncaria tomentosa etkisinin aksine hücreler gözlendi.ROS üretimi hakkında bilgi. Test edilen tüm dozlar , Uncaria tomentosa ile tedavi edilen NHDF hücreleri tarafından kontrol edilen (işlemden geçirilmemiş) NHDF hücrelerine göre daha düşük ROS üretimini gösteren kontrollere kıyasla anlamlı şekilde (* p <0.05) daha düşük floresans yoğunluğu seviyeleri ile sonuçlanmıştır .
    Resim, çizim vb. İçeren harici bir dosya. Nesne adı molecules-22-00620-g005.jpg
    Ayrı bir pencerede aç
    Şekil 5
    ( A ) NHDF ve ( b ) Uncaria tomentosa yaprakları ile muamele edilmiş HepG2 hücrelerinde ROS oluşumu özütlenir . Hücreler, 37 ° C'de 1 saat boyunca özü (30-145 ug / mL) maruz bırakıldı ve daha sonra 250 uM DCFH-DA ile işlendi. Kontrol, işlenmemiş hücreleri temsil eder. Sonuçlar, üç kopya halinde gerçekleştirilen üç bağımsız deney aracı olarak sunulur. Anlamlılık düzeyi , kontrole kıyasla (tedavi edilmemiş hücreler) * p <0.05 idi .

    Verilerimiz, test edilen Uncaria tomentosa özütünün, ROS aşırı üretiminin uyarılmasıyla kanser hücrelerinde sitotoksik etki yaratabileceğini göstermektedir. Glutatyon (GSH) hücrelerde oksidatif - indirgeyici dengenin korunmasında önemli bir rol oynar ve seviyesi oksidatif strese yanıtın bir göstergesidir. HepG2 hücrelerinde Uncaria tomentosa özütünün GSH seviyelerinde bir azalmaya neden olduğunu ve Uncaria tomentosa konsantrasyonu 145 ug / mL kullanıldığında önemli (** p <0.001) GSH azalmasının gözlendiğini gösterdik ( Şekil 6 ).
    Resim, çizim vb. İçeren harici bir dosya. Nesne adı molecules-22-00620-g006.jpg
    Şekil 6
    Uncaria tomentosa yapraklarımızın etkisi, HepG2 ve NHDF hücrelerinde GSH seviyelerinde ekstrakt bırakır. Hücreler 37 ° C'de 4 saat boyunca test edilen ekstre (30-145 µg / mL) ile muamele edildi ve Malzemeler ve Yöntemler bölümünde tarif edildiği gibi hücre içi GSH konsantrasyonu ölçüldü. Veriler, üç kopya halinde gerçekleştirilen iki bağımsız deneyden elde edilen ortalama ± SD olarak ifade edildi. İstatistiksel olarak anlamlı fark ** p <0.001 kontrole (işlenmemiş hücreler) atıfta bulunur.

    NHDF hücrelerinde uncaria tomentosa özü ( Şekil 6 ) kontrol hücrelerine kıyasla GSH seviyelerinde önemli değişikliklere neden olmamıştır. GSH seviyelerindeki azalma, hücrelerin ölüm yoluna girmesine neden olurken, kanser hücrelerinde sürekli artan GSH seviyeleri kemoterapötik ajanlara karşı dirençlerinden sorumlu olabilir [ 23 ]. 2.5. Uncaria tomentosa Decoction'un Caspase-3 ve Caspase-7 Aktivitesi Üzerine Etkisi

    Redoks işlemlerinin test edilmiş ekstrakt ile modülasyonu, hücre canlılığı kaybında önemli bir rol oynayabilir. ROS aşırı üretimi ve azalmış GSH seviyeleri, hücre içi yapıların tahrip olmasına neden olabilir ve hücreler, hücre morfolojisindeki ve Annexin pozitif hücre sayısındaki gözlenen değişikliklerle belirtildiği gibi ölüm yoluna girebilir. HepG2 hücrelerinde Uncaria tomentoza'nın apoptotik etkisi, efektör kaspaz-3 ve kaspaz-7'nin aktivasyonu ile doğrulandı. HepG2 hücrelerinde test edilen ekstre ≤145 µg / mL konsantrasyonlarında efektör kaspaz-3 ve kaspaz-7 aktivitesini% 250 arttırdı (** p <0.001, Şekil 7)) bazal aktiviteye kıyasla (işlenmemiş hücreler). NHDF hücrelerinde, ekstraktın bu kaspazlar üzerindeki etkisi, işlenmemiş hücre kontrolüne kıyasla anlamlı değildi ( Şekil 7 ). Bu sonuçlar, Uncaria tomentosa'nın kaspaz-3'e bağlı apoptozis yoluyla kanser hücresi ölümüne neden olduğu son bulgular ile uyumludur [ 14 ].
    Resim, çizim vb. İçeren harici bir dosya. Nesne adı molecules-22-00620-g007.jpg
    Şekil 7
    Unpazia tomentosa ile 37 ° C'de inkübasyondan 4 saat sonra HepG2 ve NHDF hücrelerinde kaspaz-3 ve kaspaz-7 aktivitesindeki değişiklikler üreticinin protokolüne göre ekstrakt (30-145 µg / mL) bırakır. Veriler, üç kopya halinde gerçekleştirilen iki bağımsız deneyden elde edilen ortalama ± SD olarak sunulmuştur. İstatistiksel olarak anlamlı farklar: ** p <0.001 kontrole (işlenmemiş hücreler) atıfta bulunur. 2.6. Uncaria tomentosa Decoction'un NF-ActivityB Aktivitesi Üzerine Etkisi

    Bir hücrenin oksidasyon azaltma potansiyeli, hücre çoğalması ve ölümü de dahil olmak üzere çeşitli işlemlerde yer alan NF-regulationB düzenlemesi üzerinde doğrudan bir etkiye sahiptir [ 24 ]. Uncaria tomentosa'nın ayrı ayrı bileşenlerinin etkileri ve NF-κB'nin aktivitesinin modülasyonu üzerindeki farklı ekstraktlar üzerindeki tutarsız veriler bildirilmiştir [ 12 , 24 ]. Bu çalışma, HepG2 hücrelerinin Uncaria tomentosa özü suyuyla inkübasyonunun yaklaşık% 25 ila% 30 azalma (* p <0.05) NF-κB aktivitesinde ( Şekil 8 ), sonuçta NHDF hücrelerinde bu ekstrakt ile yaklaşık 16 NF-κB aktivitesinde % –26% artış (* p <0.05) not edildi.
    Resim, çizim vb. İçeren harici bir dosya. Nesne adı molecules-22-00620-g008.jpg
    Şekil 8
    HepG2 ve NHDF hücrelerinde NF-κB aktivitesindeki değişiklikler, Uncaria tomentosa ile 4 saat 37 ° C'de muamele edildi, üreticinin protokolüne göre ekstrakt (30-145 ug / mL) çıkar. Veriler, üç kopya halinde gerçekleştirilen üç bağımsız deneyden elde edilen ortalama ± SD olarak ifade edildi. İstatistiksel olarak anlamlı farklar: * p <0.05 kontrole (işlenmemiş hücreler) atıfta bulunur.

    Kanser terapisinin etkinliği için geliştirilmiş NF-KB modülasyonu olmaması önemi [önce de belirtildiği 24 ] ve yakın zamanda, C-Med100 etkisi üzerinde çalışma ile desteklenen ® standart Uncaria tomentosa NF-KB kabuğu formülasyonu ve apoptoz indüksiyonu neoplastik hücreler [ 25 ]. NF-usedB aktivasyonu ile diğerleri arasında hepatoma, yani sisplatin için kullanılanlar da dahil olmak üzere klinik pratikte kullanılan antikanser ilaçları, kanser hücrelerinin kemoterapiye direncini uyarabilir [ 23 ]. NF-κB aktivasyonunun inhibisyonu, kanser tedavisinin etkinliğini arttırmalıdır. Uncaria tomentosa'nın etkisine ilişkin raporlarinsan lösemi hücreleri üzerindeki ekstraktlar (THP-1) klasik NF-κB aktivasyon yolunun inhibisyonunu gösterdi [ 26 ]. Hem oksindol alkaloidleri [ 27 ] hem de prosiyanidinlerin [ 28 ], NF-κB aktivasyonunu inhibe etme kabiliyetine sahip olduğu bulunmuştur. 2.7. Uncaria tomentosa'nın Kanser Hücrelerine Karşı CDDP Sitotoksisitesi Üzerine Etkisi

    Su Uncaria tomentosa özü (MTT testi ile ölçülür), kanser hücrelerinin canlılığı azalmış. Bu nedenle, kanser tedavisinde klinik uygulamada yaygın olarak kullanılan CDDP gibi antikanser ilaçların sitotoksik etkisini artırabileceği varsayılabilir. (IC karşılık gelen konsantrasyonda Bu hipotezi test etmek için, HepG2 ve NHDF hücreleri test özü ve CDDP ile eş zamanlı olarak, son 48 saat enkübe 72 saat idi 50 laboratuarımızda tanınan HepG2 hücrelerinde 11,25 uM). MTT tahlilinin sonuçları ( Şekil 9 ), Uncaria tomentosa özü suyunun , hücre canlılığında% 10-15'lik bir düşüşle gösterildiği gibi HepG2 hücrelerine karşı CDPP sitotoksik aktivitesini arttırdığını göstermektedir.
    Resim, çizim vb. İçeren harici bir dosya. Nesne adı molecules-22-00620-g009.jpg
    Şekil 9
    NHDF HepG2 MTT tahlili (hücre canlılığı) sonuçları, seçilen konsantrasyonda, 37 ° C 'de 72 saat muamele Uncaria tomentosa yaprakları ekstresi (72,5-145 ug / mL) ve CDDP (IC ile aynı zamanda, son 48 saat 50 11.25 uM dozuda için Laboratuvarımızda belirlenen HepG2 kullanılmıştır). Veriler, üç kopya halinde gerçekleştirilen üç bağımsız deneyden elde edilen ortalama ± SD olarak ifade edildi. İstatistiksel olarak anlamlı farklar: * p <0.05, tek başına tedavi edilen CDDP'ye karşılık gelir.

    Bununla birlikte, normal NHDF hücreleri bu ekstrakt ile muamele edildiğinde (72.5 ve 145 ug / mL konsantrasyonlarında) ve CDDP, sadece CDDP ile muamele edilen NHDF hücrelerine kıyasla, hücre canlılığında anlamlı bir (* p <0.05) artış% 30 oranında gözlendi. . Bu veri, test edilen Uncaria tomentosa kaynağının, CDDP'nin kanser hücrelerine karşı sitotoksik aktivitesini artırabileceğini ve aynı zamanda normal hücreleri, sisplatinin zararlı etkilerine karşı koruyabileceğini göstermektedir. Son zamanlarda, kolorektal kanserli hastalarda Uncaria tomentosa kapsüllerinin (300 mg / gün) kullanıldığı bildirildi . Uncaria tomentosa , azalan nötropeni ve trombositopenide ve ayrıca immün yanıtın onarımında da olumlu etkiler göstermiştir [ 20]. Bu gözlemleri doğrulamak için daha ileri çalışmalara ihtiyaç vardır.

    Git: 3. Gereç ve Yöntem

    3.1. Bitki Malzemesi ve Dekoksiyon Hazırlama

    Uncaria tomentosa'nın kurutulmuş yaprak bıçakları, Laboulas Induquinica (Lima, Peru) 'nın kontrollü tarlalarından, Wilcaccora Fitoterapi Merkezi (Łomianki, Varşova, Polonya) aracılığıyla satın alındı. Uncaria tomentosa'nın (4 g) öğütülmüş kurutulmuş yaprak bıçakları, 20 dakika boyunca ılık suyla (200 mL, kaynama noktasının altındaki sıcaklık) çıkarıldı. Daha sonra kaynatma, 20 dakika boyunca 4000 rpm'de santrifüjlendi. Hücre kültürü deneyleri için numuneler süzülerek ayrıldı. Alkaloitleri ve fenolik içeriği analiz etmek için sulu ekstre liyofilize edildi ve ekstraksiyonun bir sonucu olarak ortalama 1.16 g kuru toz elde edildi. 3.2. HPLC — Alkaloitlerin Analizi

    Uncaria tomentosa yapraklarının kaynatma işleminde alkaloitlerin belirlenmesi Pilarski ve diğ. [ 9]. 100 mg kuru toza (liyofilize kaynatma)% 2 sülfürik asit çözeltisi (15 mL) ilave edildi ve karışım, 15 dakika boyunca bir ultrasonik banyoda (Sonorex RK 103H, Bandelin, Berlin, Almanya) sonikasyona tabi tutuldu. Karışım daha sonra 3000 rpm'de 10 dakika santrifüjlendi ve ağaç kez 10 mL etil asetat ile özü çıkarıldı. Sulu faz ayrıldı ve% 10 amonyum hidroksit ile pH 10'a ayarlandı, daha sonra her biri 10 mL etil asetat ile üç kez özü çıkarıldı. Organik özler birleştirildi, kuruyana kadar buharlaştırıldı ve tortu, 10 mL metanol içerisinde çözündürüldü. Alkaloitlerin kalitatif ve kantitatif analizi, bir LiChrospher 100 RP-18 (250 mm x 4 mm, Merck, Darmstadt, Almanya) kolonu ve bir LiChrospher 100 RP-18 (4 mm x 4 mm, Merck) precolumn; çözücüler: A — fosfat tampon çözeltisi (10 mM, pH 6.6), B-metanol: asetonitril (1: 1); (% 60 A ve% 40 B) ila (% 30 A ve% 70 B) arasındaki gradyan; süre: 30 dak, akış hızı 1 mL / dak; 245 nm'de L-7450 Diyot Dizisi Dedektörü (Merck-Hitachi, Darmstadt, Almanya) ile tespiti. Kalibrasyon eğrileri, 0.01 ila 1.0 mg / mL konsantrasyonlarındaki alkaloitlerin (izopteropodin, pteropodin, izomitrafilin, unkarin F, mitrofilin, speciofilin) ​​standart çözeltilerinden elde edildi. Oksindol alkaloitlerin standartları, ChromaDex'ten (Santa Ana, CA, ABD) satın alınmıştır. Tüm standartlar NMR, MS ve HPLC verileriyle geldi. İç standart olarak kafein kullanılmıştır. Pik alan ve alkaloid konsantrasyonu arasında doğrusal ilişkiler gözlendi. Ekstredeki alkaloitlerin kantitatif tayininin sonuçları, mg / 100 g ekstrakt kuru ağırlığı olarak sunuldu. (% 60 A ve% 40 B) ila (% 30 A ve% 70 B) arasındaki gradyan; süre: 30 dak, akış hızı 1 mL / dak; 245 nm'de L-7450 Diyot Dizisi Dedektörü (Merck-Hitachi, Darmstadt, Almanya) ile tespiti. Kalibrasyon eğrileri, 0.01 ila 1.0 mg / mL konsantrasyonlarındaki alkaloitlerin (izopteropodin, pteropodin, izomitrafilin, unkarin F, mitrofilin, speciofilin) ​​standart çözeltilerinden elde edildi. Oksindol alkaloitlerin standartları, ChromaDex'ten (Santa Ana, CA, ABD) satın alınmıştır. Tüm standartlar NMR, MS ve HPLC verileriyle geldi. İç standart olarak kafein kullanılmıştır. Pik alan ve alkaloid konsantrasyonu arasında doğrusal ilişkiler gözlendi. Ekstredeki alkaloitlerin kantitatif tayininin sonuçları, mg / 100 g ekstrakt kuru ağırlığı olarak sunuldu. (% 60 A ve% 40 B) ila (% 30 A ve% 70 B) arasındaki gradyan; süre: 30 dak, akış hızı 1 mL / dak; 245 nm'de L-7450 Diyot Dizisi Dedektörü (Merck-Hitachi, Darmstadt, Almanya) ile tespiti. Kalibrasyon eğrileri, 0.01 ila 1.0 mg / mL konsantrasyonlarındaki alkaloitlerin (izopteropodin, pteropodin, izomitrafilin, unkarin F, mitrofilin, speciofilin) ​​standart çözeltilerinden elde edildi. Oksindol alkaloitlerin standartları, ChromaDex'ten (Santa Ana, CA, ABD) satın alınmıştır. Tüm standartlar NMR, MS ve HPLC verileriyle geldi. İç standart olarak kafein kullanılmıştır. Pik alan ve alkaloid konsantrasyonu arasında doğrusal ilişkiler gözlendi. Ekstredeki alkaloitlerin kantitatif tayininin sonuçları, mg / 100 g ekstrakt kuru ağırlığı olarak sunuldu. 245 nm'de L-7450 Diyot Dizisi Dedektörü (Merck-Hitachi, Darmstadt, Almanya) ile tespiti. Kalibrasyon eğrileri, 0.01 ila 1.0 mg / mL konsantrasyonlarındaki alkaloitlerin (izopteropodin, pteropodin, izomitrafilin, unkarin F, mitrofilin, speciofilin) ​​standart çözeltilerinden elde edildi. Oksindol alkaloitlerin standartları, ChromaDex'ten (Santa Ana, CA, ABD) satın alınmıştır. Tüm standartlar NMR, MS ve HPLC verileriyle geldi. İç standart olarak kafein kullanılmıştır. Pik alan ve alkaloid konsantrasyonu arasında doğrusal ilişkiler gözlendi. Ekstredeki alkaloitlerin kantitatif tayininin sonuçları, mg / 100 g ekstrakt kuru ağırlığı olarak sunuldu. 245 nm'de L-7450 Diyot Dizisi Dedektörü (Merck-Hitachi, Darmstadt, Almanya) ile tespiti. Kalibrasyon eğrileri, 0.01 ila 1.0 mg / mL konsantrasyonlardaki alkaloitlerin (izopteropodin, pteropodin, izomitrafilin, unkarin F, mitrofilin, speciofilin) ​​standart çözeltilerinden elde edildi. Oksindol alkaloitlerin standartları, ChromaDex'ten (Santa Ana, CA, ABD) satın alınmıştır. Tüm standartlar NMR, MS ve HPLC verileriyle geldi. İç standart olarak kafein kullanılmıştır. Pik alan ve alkaloid konsantrasyonu arasında doğrusal ilişkiler gözlendi. Ekstredeki alkaloitlerin kantitatif tayininin sonuçları, mg / 100 g ekstrakt kuru ağırlığı olarak sunuldu. Uncarine F, Mitrophylline, Speciophylline) 0.01 ila 1.0 mg / mL arasındaki konsantrasyonlarda. Oksindol alkaloitlerin standartları, ChromaDex'ten (Santa Ana, CA, ABD) satın alınmıştır. Tüm standartlar NMR, MS ve HPLC verileriyle geldi. İç standart olarak kafein kullanılmıştır. Pik alan ve alkaloid konsantrasyonu arasında doğrusal ilişkiler gözlendi. Ekstredeki alkaloitlerin kantitatif tayininin sonuçları, mg / 100 g ekstrakt kuru ağırlığı olarak sunuldu. Uncarine F, Mitrophylline, Speciophylline) 0.01 ila 1.0 mg / mL arasındaki konsantrasyonlarda. Oksindol alkaloitlerin standartları, ChromaDex'ten (Santa Ana, CA, ABD) satın alınmıştır. Tüm standartlar NMR, MS ve HPLC verileriyle geldi. İç standart olarak kafein kullanılmıştır. Pik alan ve alkaloid konsantrasyonu arasında doğrusal ilişkiler gözlendi. Ekstredeki alkaloitlerin kantitatif tayininin sonuçları, mg / 100 g ekstrakt kuru ağırlığı olarak sunuldu. 3.3. Toplam Fenolik İçerik

    Toplam fenolik içerik (TPC), Folin-Ciocalteu fenol reaktifi kullanılarak daha önce [ 29 ] tarif edilen yönteme göre 96 oyuklu şeffaf mikroplakalar (Nunclon, Nunc, Roskilde, Danimarka) üzerinde gerçekleştirildi. Absorbans, Elisa Infinite Pro 200F okuyucu (Tecan Group Ltd., Männedorf, İsviçre) ile 20 dakikalık inkübasyonun ardından 680 nm'de ölçülmüştür. TPC, gallik asit için hazırlanan standart bir eğri kullanılarak belirlendi. Sonuçlar, 1 g kuru ekstrakt başına mg gallik asit (GA) olarak ifade edildi. 3.4. Toplam Flavonoid İçeriği

    Toplam flavonoidlerin belirlenmesi, Lamaison ve Carret [ 30 ] tarafından açıklanan yönteme göre bazı değişiklikler yapıldı [ 31 ]. Kısaca, hazırlanan numune, 20 uL metanol 80 uL,% 2 (20 uL ile mikroplaka üzerinde karıştırıldı hac / hac ) AICI 3 metanol çözeltisi ve 200 uL hacmi metanol ile doldurulmuştur. Absorbans, 30 dakika sonra 430 nm'de, numune yerine metanol içeren solüsyon ile boş olarak kuluçkalandı. Ölçümler, Infinite Pro 200F mikroplaka okuyucu (Tecan Group Ltd.) kullanılarak yapıldı. Sonuçlar, 1 g kuru ekstrakt başına mg quercetin (Q) olarak ifade edilir. 3.5. Tanen İçeriği

    Su ekstraktımızdaki taninlerin içeriğini (kaynatma) belirlemek için iki yöntem kullanıldı: vanilin tahlili ve protein çökeltme yöntemi (tanenlerin gizlenmiş tozla çökeltilmesi). 3.6. Tanen İçeriği, Protein Yağış Yöntemiyle Belirlenir

    Tanen içeriğinin analizi, Polonya Farmakopesinde 6. basımda [ 32 ] açıklanan gizli toz yöntemine göre belirlenmiştir . Tanenlerin adsorpsiyondan ve çözünmeyen gizleme tozu ile çökeltilmesinden sonra dolaylı olarak tahmin edilmiştir. Sonuç, bir gram kuru ekstrakt başına miligram pyrogallol (PGA) cinsinden ifade edildi. 3.7. Tannin İçeriği Vanillin / HCl Metodu ile Belirlenir

    Yoğunlaştırılmış tanenlerin miktarı vanilin tahlili kullanılarak belirlendi [ 33 ]. Absorbans, 20 dakikalık inkübasyondan sonra 500 nm'de ölçülmüştür. Sonuçlar, 1 g kuru ekstrakt başına mg kateşin (Cat) olarak ifade edildi. 3.8. Hücre Kültürleri

    İnsan hepatomu (HepG2) Amerikan Tip Kültür Koleksiyonundan (Rockville, MD, ABD) satın alındı ​​ve daha önce tarif edilen işlemlere göre kültürlendi [ 22 , 34 , 35 ]. Deneyler% 10 FBS ile DMEM'de yapıldı. Her 24 saatte bir ortam, ekstraktın incelenen konsantrasyonları olan veya olmayan taze bir tane için değiştirildi. İnsan derisi fibroblast hücreleri (NHDF'ler) Lonza'dan (Walkersville, MD ABD) satın alınmıştır. NHDFs hücreler (üçüncü altıncı geçide) 24 oyuklu plakalar (1.5-2.0 x 10 üzerinde tohumlandı 4 FGM-2 takviyeleri ve% 2 FBS ile oyuk başına hücre).

    3.8.1. Hücre Canlılığı Değerlendirmesi (MTT Testi)

    Hücre canlılığı, MTT tuzu (3- (4,5-dimetiltiazol-2-il) -2,5-difeniltetrazolyum bromür, Sigma-Aldrich Chemie, Darmstadt, Almanya) dönüşümünün daha önce tarif edilen prosedüre göre mitokondriyal dehidrojenaz ile dönüşümünün belirlenmesiyle değerlendirildi. [ 22]. Kısaca, hücreler, 72 saat boyunca, çeşitli ekstrakt konsantrasyonları ile 24 oyuklu plakalarda ve daha sonra, mitokondriyal dehidrojenazın çözünmeyen formazan etkisi altında canlı hücrelerde dönüştürülen 0.5 mg / mL MTT çözeltisi ile 2 saat daha kuluçkalandı. . Dönüştürülen boya daha sonra mutlak izopropanol içinde 0.04 M HC1 içerisinde çözündürüldü. Çözünmüş formazanın emiciliği 570 nm'de (BioTek Epoch mikroplaka okuyucu, BioTek Instruments Inc., Winooski, VT, ABD) spektrofotometrik olarak ölçülmüştür. Hücre canlılığı, kontrole karşı yüzde olarak hesaplandı (ekstraklar olmadan serumsuz DMEM'de inkübe edilmiş hücreler). Bağıl hücre canlılığı (%) [A] / [B] x 100 olarak hesaplandı, burada [A] test numunesinin absorbansı ve [B] muamele edilmemiş hücreleri içeren kontrol numunesinin absorbansı.

    3.8.2. Mikroskobik muayene

    Hücre morfolojisindeki değişikliklerin mikroskobik incelemesi daha önce tarif edildiği gibi görünür ışıkta değerlendirildi [ 22 , 35 , 36 ]. Canlılıkta ve ölü hücrelerin flüoresansta değerlendirilmesi MoBiTec'in (Gottingen, Almanya) protokolüne göre, kalsein-AM ve propidium iyodür (PI) ile boyandıktan sonra yapıldı. Canlı hücrelerin dijital görüntüleri, NIS-Elements Nikon BR 2.30 yazılımı (Nikon) kullanan Nikon Digital Sight DS-U2 kamerasıyla donatılmış faz kontrastlı ters mikroskop Eclipse TS 100F (Nikon, Melville, NY, ABD) kullanılarak görüntülendi.

    3.8.3. Annexin V-FITC / PI Apoptozis Deneyi

    Apoptoz, AnnexinV-FITC Kiti (Becton Dickinson, San Diego, CA, ABD) tarafından değerlendirildi. Hücreler, 12 oyuklu plakalarda 72 saat boyunca Uncaria tomentosa özü ile inkübe edildi . Maruz kaldıktan sonra, kültür ortamı uzaklaştırılmış ve hücreler% 0.05'lik Tripsin-EDTA ile tripsinizasyon ile toplanmış ve 2000 rpm'de 10 dakika santrifüjlenmiştir. Akış sitometrisi ile analiz, her numune başına 5000 kapılı olay sayılarak 1 saat içinde yapıldı. Veriler, FACS Calibur akış sitometresindeki CELL-Quest yazılımı ve Cell Quest yazılımı (BD Biosciences, San Jose, CA, ABD) kullanılarak da analiz edildi. Sonuçlar erken apoptotik (Annexin V-pozitif) ve geç apoptotik (Annexin V ve PI-pozitif) hücrelerin oranları olarak sunuldu.

    3.8.4. ROS Üretim Ölçümü

    ROS üretimi, DCFH 2- DA dönüşümünün değerlendirilmesi ve daha önce tarif edildiği gibi DCF'ye oksidasyon ile ölçülmüştür [ 35 ]. DCFH 2 -da, kolayca DCFH için esteraz ile dönüşüm geçiren hücreleri nüfuz 2 ROS varlığında yüksek floresan DCF oksidize olur. Serum içermeyen DMEM içinde 12-kuyucuklu plakalar içinde kültürlendi hücreler DCFH 250 uM 2 saat süre ile, daha sonra, PBS ile yıkanır ve ekstrenin incelenmiştir konsantrasyonları ile DMEM içerisinde 1 saat süreyle inkübe edildi ve 2-DA (2 ′, 7′-diklorodihidrofloresein diasetat) HBSS'de (Hank'in dengeli tuz çözeltisi). DCFH2-DA eklendikten hemen sonra flüoresans ölçümü başlatıldı, Gen5 yazılımı (BioTech Instruments Inc., Winooski, VT, ABD) ile donatılmış ve 485 nm'lik bir eksitasyon dalga boyunda gen5 yazılımı (BioTech Instruments Inc., Winooski, VT, ABD) ile donatılmış bir mikroplaka okuyucusu kullanılarak başladı 530 nm'de, her 15 dakikada bir okumalar.

    3.8.5. GSH Seviye Ölçümü

    Hücreler, 24-çukurlu plakalarda serumsuz DMEM'de test edilmiş ekstraktla birlikte çeşitli konsantrasyonlarda) 4 saat boyunca kuluçkalanmıştır. GSH seviyesi, glutatyon tahlil kiti protokolü (Sigma-Aldrich Chemie, Darmstadt, Almanya) kullanılarak değerlendirildi. Absorbans ölçümü, bir mikroplaka okuyucu (Synergy 4, BioTek Inc.) kullanılarak 412 nm'de yapıldı. Sonuçlar, üreticinin protokolü Pierce BCA Protein Test Kiti (Pierce Biotechnology, Rockford, IL, ABD) kullanılarak numunedeki protein miktarıyla ilişkili olarak ifade edildi.

    3.8.6. Caspase-3 ve -7 Aktivite Tespiti

    Kaspaz aktivitesinin belirlenmesi, üretici (Promega GmbH, Mannheim, Almanya) tarafından sağlanan Caspase-Glo 3/7 Test Kiti protokolüne uygun olarak lusiferaz enziminin kullanılmasıyla gerçekleştirildi. Lüminesans ölçümü, test edilen ekstrakt ile 4 saat boyunca 96 oyuklu plakalarda inkübe edilen hücreler kullanılarak hazırlanan hücre lisatlarında gerçekleştirildi. Lüminesans yoğunluğu kaspaz aktivitesi ile orantılıdır.

    3.8.7. NF-κB Aktif form Ölçümü

    NF-B aktif formunun kemilüminesan ölçümü, test edilen ekstrakt ile 4 saat boyunca inkübe edilen hücreler kullanılarak hazırlanan hücre lisatlarında NF-B p65 ELISA Kitinin (Enzo Yaşam Bilimleri, Farmigdale, NY, ABD) protokolüne göre yapıldı. Sonuçlar, Bradford metodu ile ölçülen, numunelerdeki protein seviyeleri ile ilgili olarak sunulmuştur.

    3.8.8. İstatistiksel analiz

    Sonuçlar deneysel araçlar ve SD olarak sunulmaktadır. Gözlemlenen farklılıkların istatistiksel önemi, Tukey post-hoc testi ile (Statistica ver. 8, StatSoft, Kraków, Polonya) tek yönlü varyans analizi (ANOVA) ile değerlendirildi ve anlamlı olarak p <0.05 kabul edildi.

    Git: 4. Sonuçlar

    Bitki özleri ve bitki türevli maddeler ve bunların antikanser tedavileri altındaki hastalıklardaki yararları şimdi büyük ilgi görüyor. Kemoterapi ile kombine edildiklerinde ümit verici etkiler göstermişlerdir ve hepatosellüler karsinomalı hastalara yarar sağlayabilmektedirler [ 36 ].

    Aynı zamanda “kedinin pençesi” ve “uña de gato” olarak da bilinen Uncaria tomentosa , kabuğu, kökleri ve yaprakları, Güney Amerika'daki yerel halk tarafından immünomodülatör, antikanser ve anti-agresi nedeniyle yaygın olarak kullanılan, Perulu bir bitkidir. -enflamatuar eylem. Uncaria tomentosa'nın kanser hücreleri üzerindeki etkilerinin önceki raporları, kabuk ve kök ekstraktlarının (yüksek miktarda alkaloit içeren) çalışmalarına odaklanırken, yaprakları benzer aktif bileşikler içerir ve uygun materyal, bitkinin ciddi zararları olmadan toplanabilir. Ancak, polifenollerin muhteviyatında kabuğu ve yaprakları ile sulu ve alkollü ekstreler arasındaki farklar bildirilmiştir [ 5]. Bu çalışmada kullanılan öz, kaynatma hazırlığı için yaygın olarak kabul edilen prosedüre göre hazırlandı. Tetrasiklik alkaloidler içermez, pentasiklik oksindol alkaloitler ve yoğunlaşmış tanenler içerir.

    Bu ekstrenin kanser hücrelerine karşı sitotoksik olduğu ve kanser hücrelerinde oksidatif stresi indüklediği ancak normal hücrelerde bulunmadığı bulunmuştur. Kanser hücrelerinde, ekstrakt, apoptozun aracıları ve düzenleyicileri, yapısal proteinlerin yanı sıra DNA onarımı ve hücre döngüsü ile ilgili proteinleri içeren protein substratlarının ayrılması yoluyla apoptoz yapan efektör kaspaz-3 ve kaspaz-7'yi aktive eder. Ek olarak kansere ek olarak normal hücrelerde NF-κB aktif formunda azalma gözlenmiştir. NF-κB aktivitesinin inhibisyonu, kemoterapiye karşı kanser hücresi direncinin gelişmesini önleyebilir. Çalışılan Uncaria tomentosa kaynatma, HepG2 hücrelerine karşı CDDP sitotoksisitesini arttırırken, NHDF hücrelerinin bu ekstrakt ile inkübasyonu CDDP'den kaynaklanan canlılık azalmasını önler. Bu sonuçlar göstermektedir kiUncaria tomentosayaprakları kaynatma farklı kanser ve normal hücrelerin oksidatif metabolizmasını modüle eder ve kanser hücrelerine karşı CDDP sitotoksisitesini arttırır. Kanser hücrelerine karşı hiperplastik olmayan hücrelere kıyasla daha etkili olabilen her bileşik veya farklı bileşiklerin kombinasyonu yeni terapötik fırsatlar sağlayabilir. Gözlenen etkilerin altında yatan moleküler mekanizmaları tanımlamak ve incelenen ekstraktın, kanser hücrelerinin tedaviye duyarlılığını arttırmada ve / veya ilaç direnci gelişiminin önlenmesinde potansiyel yararlılığını göstermek için daha ileri çalışmalara ihtiyaç vardır. Genel olarak, etnomedicine kullanılan fitofarmasötiklerin aktif bileşenleri çoğunlukla bilinmemektedir ve bitki özü, aktif bileşen olarak kabul edilmektedir. Bitki özü, aktif bileşiklerin bir karışımıdır ve bunların ortak etkisi, farmasötik aktiviteye aracılık edebilir. Bununla birlikte, bu çalışmada gözlemlenen etkilerin fitokimyasal temelini aydınlatmak için aktif bileşiklerin izolasyonunun bir sonraki adım olması gerekir.

    Git: Teşekkür

    Çalışma, Ulusal Bilim Merkezi, Polonya ve Varşova Tıp Üniversitesi'nden UMO-2013/09 / N / NZ7 / 01461 hibesi ile desteklenmiş ve Avrupa Birliği (Avrupa Bölgesi tarafından finanse edilen CePT altyapısının kullanımı ile gerçekleştirilmiştir. Operasyonel Program Geliştirme Fonu 2007-2013 için Yenilikçi Ekonomi).

    Git: Yazar Katkıları

    Deneyleri tasarladı ve tasarladı: AK ve GN Deneyleri yaptı: AK, EC, MK, KG, WP ve RN Verileri analiz etti: AK, KG, WP ve RN Makaleyi yazdı: AK ve GN

    Git: Çıkar çatışmaları

    Yazarlar çıkar çatışması bildirmemişlerdir.

    Git: Dipnotlar


    Örnek Kullanılabilirliği: Bileşiklerin örnekleri yazarlardan temin edilemez.



    Git: Referanslar

    1. Keplinger K., Laus G., Wurm M., Dierich MP, Teppner H. Uncaria tomentosa (Willd.) DC. Etnomedicinal kullanım ve yeni farmakolojik, toksikolojik ve botanik sonuçlar. J. Ethnopharmacol. 1999; 64 : 23–34. doi: 10.1016 / S0378-8741 (98) 00096-8. [ PubMed ] [ CrossRef ] [ Google Akademik ]
    2. Heitzman ME, Neto CC, Winiarz E., Vaisberg AJ, Hammond GB Etnobotanik, Fitokimya ve Uncaria (Rubiaceae) Fitokimyasının farmakolojisi . 2005; 66 : 5-29. doi: 10.1002 / chin.200517286. [ PubMed ] [ CrossRef ] [ Google Akademik ]
    3. Wang GF, Shi LP, Ren YD, Liu QF, Liu HF, Zhang RJ, Li Z., Zhu FH, He PL, Tang W., vd. İn vivo ve in vitro klorojenik asit, kinik asit ve kafeik asidin anti-hepatit B virüsü aktivitesi. Antivir. Res. 2009; 83 : 186-190. doi: 10.1016 / j.antiviral.2009.05.002. [ PubMed ] [ CrossRef ] [ Google Akademik ]
    4. Sheng Y., Akesson C., Holmgren K., Bryngelsson C., Giamapa V., Pero RW Cat'in Pençe Suyu özlerinin aktif bir bileşenidir. Kinik asidin tanımlanması ve etkinliği. J. Ethnopharmacol. 2005; 96 : 577-584. doi: 10.1016 / j.jep.2004.10.002. [ PubMed ] [ CrossRef ] [ Google Akademik ]
    5. Bors M., Bukowska B., Pilarski R., Gulewicz K., Oszmiański J., Michałowicz J., Koter-Michalak M. Uncaria tomentosa özütlerinin 2,4 ile indüklenen oksidatif stresde insan eritrositlerinde koruyucu aktivitesi diklorofenol (2,4-DCP) ve katekol. Besin Kimyası Toxıcol. 2011; 49 : 2202-211. doi: 10.1016 / j.fct.2011.06.013. [ PubMed ] [ CrossRef ] [ Google Akademik ]
    6. Sheng Y., Pero RW, Amiri A., Bryngelsson C. Uncaria tomentosa özleri ile muamele edilmiş insan tümör hücrelerinde apoptozun ve proliferasyonun inhibisyonu . Antikanser Arş. 1998; 18 : 3363-3368. [ PubMed ] [ Google Akademik ]
    7. Riva L., Coradini D., Di Fronzo G., De Feo V., De Tommasi N., De Simone F., Pizza C. Uncaria tomentosa özütlerinin ve fraksiyonlarının meme kanseri hücre çizgisinin büyümesi üzerindeki antiproliferatif etkileri . Antikanser Arş. 2001; 21 : 2457-22461. [ PubMed ] [ Google Akademik ]
    8. Cheng AC, Jian CB, Huang YT, Lai CS, Hsu PC, Pan MH Apoptozun Uncaria tomentosa tarafından reaktif oksijen türlerinin üretilmesi, sitokrom c salımı ve insan lösemi hücrelerinde kaspaz aktivasyonuyla indüksiyonu . Gıda. Chem. Toxıcol. 2007; 45 : 2206-22218. doi: 10.1016 / j.fct.2007.05.016. [ PubMed ] [ CrossRef ] [ Google Akademik ]
    9. Pilarski R., Poczekaj-Kostrzewska M., Ciesiołka D., Szyfter K., Gulewicz K. HL-60 promyelositik lösemi hücreleri üzerinde çeşitli Uncaria tomentosa preparatlarının antiproliferatif aktivitesi . Pharmacol. Rep. 2007; 59 : 565-572. [ PubMed ] [ Google Akademik ]
    10. Pilarski R., Filip B., Wietrzyk J., Kuray M., Gulewicz K. Uncaria tomentosa (Willd.) DC'nin Antikanser aktivitesi . Farklı oksindol alkaloit bileşimli müstahzarlar. Phytomedicine. 2010; 17 : 1133-1139. doi: 10.1016 / j.phymed.2010.04.013. [ PubMed ] [ CrossRef ] [ Google Akademik ]
    11. Bacher N., Tiefenthaler M., Sturm S., Stuppner H., Ausserlechner MJ, Kofler R., Konwalinka G. Uncaria tomentosa kaynaklı oksindol alkaloiz , çoğalmakta, G0 / G1-tutuklanmış ve bcl-2 eksprese edici akut apoptozu indüklemektedir lenfoblastik lösemi hücreleri. Br. J. Haematol. 2006; 132 : 615-622. doi: 10.1111 / j.1365-2141.2005.05907.x. [ PubMed ] [ CrossRef ] [ Google Akademik ]
    12. Prado EG, Gimenez MDG, Vázquez RP, Sánchez JLE, Rodríguez MTS Uncaria tomentosa'nın pentasiklik bir oksindol alkaloid olan mitraphyllinin insan gliomu ve nöroblastom hücre hatları üzerindeki antiproliferatif etkileri . Phytomedicine. 2007; 14 : 280 - 284. doi: 10.1016 / j.phymed.2006.12.023. [ PubMed ] [ CrossRef ] [ Google Akademik ]
    13. Rizzi R., Re F., Bianchi A., De Feo V., de Simone F., Bianchi L., Stivala LA Uncaria tomentosa ve ekstraktlarının mutajenik ve antimutagenik aktiviteleri . J. Ethnopharmacol. 1993; 38 : 63-77. doi: 10.1016 / 0378-8741 (93) 90080-0. [ PubMed ] [ CrossRef ] [ Google Akademik ]
    14. Dreifuss AA, Bastos-Pereira AL, Fabossi IA, Lívero FA, Stolf AM, Alves de Souza CE, Gomes Lde O., Constantin RP, Furman AE, Strapasson RL, vd. Uncaria tomentosa , alkaloid aktivite ile değil, oksidatif stresi modüle ederek Walker-256 tümörüne karşı geniş anti-neoplastik etkiler uygular. BİRİNCİ 2013; 8 : e54618. [ PMC ücretsiz makale ] [ PubMed ] [ Google Akademik ]
    15. Forner A., ​​Hessheimer AJ, Real MI, Bruix J. Hepatoselüler karsinomun tedavisi. Crit. Rev. Oncol. Hematol. 2006; 60 : 89-98. doi: 10.1016 / j.critrevonc.2006.06.001. [ PubMed ] [ CrossRef ] [ Google Akademik ]
    16. Jo KJ, Cha MR, Lee MR, Yoon MY, Park HR Uncaria rhynchophylla'nın metanolik ekstreleri, HT-29 insan kolon karsinom hücrelerinde sitotoksisite ve apoptozu indükler. Bitki Gıdaları Nutr. 2008; 63 : 77-82. doi: 10.1007 / s11130-008-0074-z. [ PubMed ] [ CrossRef ] [ Google Akademik ]
    17. Wagner H., Kreutzkamp B., Jurcic K. Alkaloide von Uncaria tomentosa ve ihre Phagozytose-steigernde Wirkung. Planta Med. 1985; 51 : 419–423. doi: 10.1055 / s-2007-969537. [ PubMed ] [ CrossRef ] [ Google Akademik ]
    18. García Giménez D., García Prado E., Sáenz Rodríguez T., Fernández Arche A., De la Puerta R. Uncaria tomentosa kabuğundan izole edilen pentasiklik oksindol alkaloid mitraphyllinin sitotoksik etkisi , insan Ewing sarkomu ve meme kanseri hücre hatları üzerinde. Planta Med. 2010; 76 : 133-136. doi: 10.1055 / s-0029-1186048. [ PubMed ] [ CrossRef ] [ Google Akademik ]
    19. Wurm M., Kacani L., Laus G., Keplinger K., Dierich MP Uncaria tomentosa kaynaklı pentasiklik oksindol alkaloitleri, lenfosit-proliferasyon düzenleyici bir faktörü serbest bırakmak için insan endotel hücrelerini indükler. Planta Med. 1998; 64 : 701-704. DOI: 10.1055 / s-2006-957561. [ PubMed ] [ CrossRef ] [ Google Akademik ]
    20. Farias IL, Araújo MC, Farias JG, Rossato LV, Elsenbach LI, Dalmora SL, Flores NM, Durigon M., Cruz IB, Morsch VM, vd. CRC Hastalarında Kemoterapinin Neden Olduğu Yan Etkileri Azaltmada Uncaria tomentosa : Klinik Çalışma. Evid. Tabanlı Tamamlayıcı. Alternat. Med. 2012; 2012 : 892182. doi: 10.1155 / 2012/892182 sayılı belge. [ PMC ücretsiz makale ] [ PubMed ] [ CrossRef ] [ Google Akademik ]
    21. Khanbabaee K., van Ree T. Tannins: Sınıflandırma ve tanım. Nat. Prod. Rep 2001; 18 : 641-649. [ PubMed ] [ Google Akademik ]
    22. Grudzinski IP, Bystrzejewski M., Cywinska MA, Kosmider A., ​​Poplawska M., Cieszanowski A., Fijalek Z., Ostrowska A., Parzonko A. Lewis akciğer karsinom hücrelerinde karbon kapsüllenmiş demir nanopartikülleri sitotoksisitesinin değerlendirilmesi. J. Appl. Toxıcol. 2014; 34 : 380-394. doi: 10.1002 / jat.2947. [ PubMed ] [ CrossRef ] [ Google Akademik ]
    23. Reuter S., Gupta SC, Chaturvedi MM, Aggarwal B. Oksidatif stres, inflamasyon ve kanser, Nasıl bağlantılılar? Ücretsiz Biol. Med. 2010; 49 : 1603-1616. doi: 10.1016 / j.ücretsizradbiomed.2010.09.006. [ PMC ücretsiz makale ] [ PubMed ] [ CrossRef ] [ Google Akademik ]
    24. Sandoval M., Charbonnet RM, Okuhama NN, Roberts J., Krenova Z., Trentacosti AM, Miller MJ Cat'in pençesi TNFalpha üretimini engeller ve serbest radikalleri temizler: Sitoproteksiyondaki rolü. Ücretsiz Biol. Med. 2000; 29 : 71–78. doi: 10.1016 / S0891-5849 (00) 00327-0. [ PubMed ] [ CrossRef ] [ Google Akademik ]
    25. Akesson C Lindgren H., Pero RW Leanderson T. Ivars F. kinik asit biyolojik olarak aktif bir bileşendir Uncaria tomentosa özü Cı-Med 100 ® Int. Immunopharmacol. 2005; 5 : 219-229. doi: 10.1016 / j.intimp.2004.09.028. [ PubMed ] [ CrossRef ] [ Google Akademik ]
    26. Allen-Hall L., Arnason JT, Cano P., Lafrenie RM Uncaria tomentosa , NF-κB yoluyla güçlü bir TNF-a inhibitörü olarak görev yapar. J. Ethnopharmacol. 2010; 127 : 685-693. doi: 10.1016 / j.jep.2009.12.004. [ PubMed ] [ CrossRef ] [ Google Akademik ]
    27. Valerio LG, Gonzales GF Güney Amerika otlarının kedisinin pençesinin ( Uncaria tomentosa ) ve Maca'nın ( Lepidium meyenii ), kritik bir özeti. Toxıcol. Rev. 2005; 24 : 11-35. doi: 10.2165 / 00139709-200524010-00002. [ PubMed ] [ CrossRef ] [ Google Akademik ]
    28. Terra X., Valls J., Vitrac X., Mérrillon JM, Arola L., Ardèvol A., Bladé C., Fernandez-Larrea J., Pujadas G., Salvadó J., vd. Üzüm çekirdeği prosiyanidinler, NF-κB sinyal yolunu inhibe ederek endotoksinle uyarılmış RAW 264.7 makrofajlarında antienflamatuar ajanlar olarak görev yapar. J. Agric. Besin Kimyası 2007; 55 : 4357-4365. doi: 10.1021 / jf0633185. [ PubMed ] [ CrossRef ] [ Google Akademik ]
    29. Olech M., Nowak R., Los R., Rzymowska J., Malm A., Chruściel K. Rosa rugosa Thunb'den hazırlanan çay ve tentürlerin biyolojik aktivitesi ve bileşimi . Cent. EUR. J. Biol. 2012; 7 : 172-182. doi: 10.2478 / s11535-011-0105-x. [ CrossRef ] [ Google Akademik ]
    30. Lamaison JLC, Carret A. Crataegus monogyna'daki temel flavonoidler ve jeneratörler Jacq et de Crataegus laevigata (Piret DC) ve bitki örtüsü. Plantes Méd. Phytothér. 1990; 25 : 12-16. [ Google Akademik ]
    31. Pietrzak W., Nowak R., Olech M. Ekstraksiyon yönteminin Viscum albüm alt yayınlarından ökse otu ekstraktlarının fenolik içerik ve antioksidan aktivitesi üzerine etkisi . Abietis. Chem. Pap. 2014; 68 : 976–982. doi: 10.2478 / s11696-013-0524-4. [ CrossRef ] [ Google Akademik ]
    32. Polonya Farmakopesi. 6th ed. Polonya Farmasötik Topluluğu; Varşova, Polonya: 2005. [ Google Akademik ]
    33. Fiyat NJ, van Scoyoc S., Butler LG Sorgum tanesinde tanen tahlili için vanilik reaksiyonların kritik bir değerlendirmesi. J. Agric. Besin Kimyası 1978; 26 : 1214-1218. doi: 10.1021 / jf60219a031. [ CrossRef ] [ Google Akademik ]
    34. Jaszewska E., Koumider A., ​​Öpücük AK, Naruszewicz M. Oenothera paradoxa'nın bozulmuş tohumlarının insan derisi melanom hücrelerinde pro-oksidatif ve proapoptotik etkisi . J. Agric. Besin Kimyası 2009; 57 : 8282–8289. doi: 10.1021 / jf901395t. [ PubMed ] [ CrossRef ] [ Google Akademik ]
    35. Grudzinski IP, Bystrzejewski M., Cywinska MA, Kosmider A., ​​Poplawska M., Cieszanowski A., Fijalek Z., Ostrowska A. Murine glioma hücrelerinde karbon kapsüllü demir nanopartiküllerinin karşılaştırmalı sitotoksisite çalışmaları. Kolloidler Sörfü. B Biyo arayüzleri. 2014; 117 : 135-143. doi: 10.1016 / j.colsurfb.2014.02.015. [ PubMed ] [ CrossRef ] [ Google Akademik ]
    36. Shu X., McCulloch M., Xiao H., Broffman M., Gao J. Hepatoselüler karsinom tedavisinde Çin bitkisel ilaç ve kemoterapi: Randomize kontrollü çalışmaların meta analizi. İntegr. Kanser Ther. 2005; 4 : 219-229. doi: 10.1177 / 1534735405279927. [ PubMed ] [ CrossRef ] [ Google Akademik ]

    Yorum yap


    • #3
      Uncaria tomentosa Ekstraktının Oksaliplatin Maruziyetinin Tetiklediği Apoptoz Üzerine Etkisi HT29 Hücreleri Üzerine

      Liliane Z. Oliveira , 1, 2, * Iria Luiza G. Farias , 1, * Melânia L. Rigo , 3 Werner G. Glanzner , 3 Paulo Bayard D. Gonçalves , 3 Francine C. Cadoná , 4 Ivana B. Cruz , 4 Júlia G. Farias , 5 Marta MMF Duarte , 6 Luzia Franco , 7 Gustavo Bertol , 7 Elisangela Colpo , 4 Patricia C. Brites , 1 João Batista T. Rocha , 4 ve Daniela BR Leal 2
      Yazar bilgileri Madde notları Telif Hakkı ve Lisans bilgileri Uyarı
      Bu makale PMC'deki diğer makalelerden alıntılanmıştır .
      Git: Soyut, Özet


      Arkaplan / Amaç . Bitkisel ürünlerin, kemoterapinin kanser tedavisi üzerindeki etkilerini en aza indirmek için bir tamamlayıcı olarak kullanılması, kemoterapinin etkinliği ve toksisitesine ilişkin olarak daha fazla dikkat gösterilmesini gerektirir. Oksindol alkaloitleri içeren Uncaria tomentosa özü, bu bitkisel ürünlerden biridir. Bu çalışmanın amacı, Uncaria tomentosa özütünün kemoterapiye maruz kalma ile indüklenen apoptozu modüle edip etmediğini değerlendirmektir . Gereç ve Yöntem . Kolorektal adenokarsinom hücreleri (HT29 hücreleri), oksaliplatin ve / veya Uncaria tomentosa özü varlığında büyütüldü . Sonuçlar . Uncaria tomentosa'nın hidroalkolik özüAnnexin pozitif hücrelerin yüzdesinin artması, kaspaz aktivitelerinin artması ve neoplastik hücrelerin kültüründe DNA fragmanlarının artması ile birlikte kemoterapinin neden olduğu apoptozis. Ayrıca, antioksidan aktivite apoptozis ile ilgili olabilir. Sonuç . Uncaria tomentosa özü, kanser hastaları için tamamlayıcı bir tedavi olarak rol oynar. Bu yararlı etkileri diğer kemoterapi ilaçlarıyla değerlendiren daha ileri çalışmalar önerilmektedir. 1. Giriş

      Reaktif oksijen türleri (ROS), hücresel oksidatif stres ve kanser riski arasındaki ilişki iyi bir şekilde oluşturulmuştur, bu da antioksidan özelliklere sahip bitkisel ürünlerin kullanımının bu olumsuz etkileri tersine çevirebileceğini veya en aza indirebileceğini ve böylece kişilerin sağlığını iyileştirebileceğini gösteren çalışmalarla sonuçlanmıştır. Bununla birlikte, bu ilişkinin niteliği karmaşıktır ve zaman zaman paradoksal görünebilir [ 1 ]. 2006 yılında Schumacker [ 2] bu ilişkiyi beş noktada özetledi: (1) oksidatif stres ve ROS kansere neden olabilir, (2) transforme hücreler normal hücrelerle karşılaştırıldığında daha fazla ROS üretir, (3) tioredoksin ve süperoksit dismutaz (SOD) gibi antioksidan sistemler geliştirilir Bazı malign hücrelerde, (4) tirozin kinaz reseptörü yoluyla sinyalleşmeyi aktive eden büyüme faktörleri veya mutasyonlarla hücre döngüsü ilerlemesinin uyarılması, ROS'ta bir artış içerir ve (5) çeşitli kemoterapötik ajanlar, tümör hücrelerine seçici olarak toksik olabilir, çünkü oksidatif stresi artırın ve zaten “stresli” hücreleri sınırlarının ötesine sürün. Oksidatif stres ile ilişkisinin vurgulanması, H 2 O 2Özellikle seviyeler apoptozis indüksiyonunda önemli bir rol oynar. Bu şekilde, bu elementlerin seviyelerini doğrudan etkileyen Mn-SOD gibi antioksidan enzimler, hem apoptoz hem de kemoterapiye karşı tümör hücresi direncinde çok önemlidir. Kolorektal karsinomlardaki Mn-SOD'deki artış, tedaviye yanıt olarak tümör hücrelerinin direncine ve duyarsızlığına katkıda bulunur ve bu da daha kötü bir prognozla sonuçlanır [ 3 ]. Ayrıca, Hussain ve arkadaşları [ 4 ], kemoterapiye maruz kalan lenfoblastlarda p53 geni tarafından indüklenen apoptozun, artan bir Mn-SOD ekspresyonunun aracılık ettiğini göstermiştir. Priego ve arkadaşları [ 5]], bir FOLFOX rejimi (oksaliplatin ve 5-floroürasil) ile tedavi edilen hayvanlarda kolon karsinoması hücrelerinin (HT29) ortadan kaldırılmasında Mn-SOD'un kilit bir rolünü doğruladı.

      Uncaria tomentosa (Willd) DC., Aynı zamanda kedinin pençesi olarak da bilinen Rubiaceae, oksindol ve indol alkaloitler, polifenoller (flavonoidler, proantosiyanidinler ve tanenler, glikositler, triterpenler türevleri, kinovin ve kinisin, kinik asit, kinik asit, kinik asit, kinik asit, kinolin ve kinolin) dahil ve saponinler [ 6 ]. Bu bileşikler arasında, oksindol alkaloidleri (pentasiklik (POA) ve tetrasiklik (TOA)), çeşitli farmakolojik aktiviteler nedeniyle bu türün fitokimyasal belirteçleri olarak kabul edilmiştir [ 6 - 8 ]. Bununla birlikte, bu maddenin kimyasal bileşimi coğrafi bölgelere ve mevsimlere göre değişebilir [ 6]. Bu nedenle, bazı bitkiler yüksek oranda POA içeriyorlar (speciophylline, uncarine F, mitraphylline, isomitraphylline, pteropodine ve isopteropodine), bazılarında ise TOA (rhynchophylline and isorhynchophylline) daha yüksek içeriğe sahipler. Uncaria tomentosa'nın farmakolojik özellikleri arasında, süperoksit dismutaz enziminin (SOD) aktivitesinin artması ile birlikte antioksidan aktivite bulunmaktadır [ 9 ]. Sulu / hidroalkolik özütler, myeloproliferatif etkilerin [ 10 , 11 ], neoplastik hücrelerde [ 12 - 14 ] ve ayrıca POA izolatlarında [ 15 ] ve antitümör etkilerinde [ 16 ] ortaya çıktıklarında apoptozu indüklemiştir . Allium cepa kullanarak önceki bir çalışmadasitogenetik analizde, kuru Uncaria tomentosa hidroalkolik ekstraktının, mutajenik etki göstermediğini ve böylece antimutajenik potansiyel sergilediğini ve böylece kemoterapiye maruz kalma, özellikle anafaz-telopof kromozom sapmalarının neden olduğu DNA hasarını azalttığını gösterdik. Oksaliplatin kaynaklı lipid peroksidasyonunda bir azalma da gözlendi.

      Kemoterapinin neden olduğu apoptoza serbest radikallerin aracılık ettiği göz önüne alındığında, Uncaria tomentosa özütünün antioksidan özellikleri nedeniyle bu aktiviteyi etkileyip etkilemediğini inceledik . Benzer şekilde, ekstraktın daha önce Allium cepa kullanan sitogenetik çalışmalarda gözlendiği gibi tümör hücrelerinde kemoterapinin indüklediği DNA onarımını destekleyip desteklemediğini analiz ettik . 2. Gereç ve Yöntem

      2.1. Kanser Hücre Hatları

      HT29 hücreleri, Banco de Células do Rio de Janeiro-BCRJ'den temin edildi (Kod BCRJ: 0111). HT-29 hücreleri,% 10 FCS (Gibco / Invitrogen) ile desteklenmiş DMEM-F12 (Sigma Aldrich; pH 7.4) içinde büyütüldü. Kültürler,% 5 CO içeren nemli bir atmosferde 37 ° C 'de muhafaza edilmiştir 2 . Hücreler 5 dakika süreyle% 0.05 (a / h) tripsin (Sigma) ile 0.3 mmol / L EDTA içeren Hanks tamponlu bir çözelti (Gibco / Invitrogen) içinde kuluçkalandı ve ardından tripsin etkisiz hale getirmek için% 10 FCS ilave edildi. Hücreler bir Neubauer odası kullanılarak ölçülmüş ve hücresel canlılık tripan mavisi dışlama yöntemi kullanılarak değerlendirilmiştir. 2.2. Hücre Tedavileri

      Hücreler 1 x 10 da 6- ya da 96 oyuklu düz tabanlı plakalar (TPP) tohumlandı 6 ya da 0.5 x 10 5 / mL canlı hücreler ve 37 ° C'de gece boyunca yapışmaya bırakıldı. Hücreler 24, 48 veya 72 saat boyunca aşağıdaki sitotoksik madde konsantrasyonları ile muamele edilmiştir:
      1. kontrol: Uncaria tomentosa özü veya oksaliplatin içermeyen kültür ortamı ,
      2. kemoterapi: 20 μ mol / L'de oksaliplatin ,
      3. Uncaria tomentosa 750 ekstresi  μ gr / ml,
      4. Uncaria tomentosa + kimya .: Uncaria tomentos 750 ekstrakt  μ 20 gr / ml + oksaliplatin μ mol / L.
      2.3. Reaktifler

      Oxaliplatin (DACH- (oksalat) platin II, L-OHP) (Oxaliplatina) Eurofarma'dan satın alınmıştır. Uncaria tomentosa ekstresi (% 5), Peru'dan (Naturex) bitkilerin toprak kabuğu (% 70 etanol (Dipalcool) ile ultra turrax ekstraksiyonu (Biotron-Kinematica AG) ile hazırlandı ve USP 36 metodolojisine göre tanımlandı. santrifüjlenir (Santrifüj Suzuki), alkolü uzaklaştırmak için bir ısıtma tankında (MCA-ALW) konsantre edilir ve eksipiyanlar olarak silikon dioksit (Evonik) ve mikrokristalin selüloz 102 (Blanver) kullanılarak spreyle kurutulur (Kohls). 2.4. Kuru Uncaria tomentosa Ekstraktının Analizi

      Aşağıdaki reaktifler kullanıldı: asetonitril (JTBaker), trietilamin (Fluka), asetik asit (JTBaker), poliamid (Fluka), etanol (Vetec) ve ultra saf su. Numune ekstraksiyonu, 40 kHz'de bir USC 5000A modeli olan bir ultrason kullanılarak gerçekleştirildi. Kromatografik analiz Agilent 1100 HPLC sistemi üzerinde gerçekleştirilmiştir ve bir Zorbax XDB C-18 kolonu (150 mm x 4.6 mm, 3.5 edildi  μm Agilent) 15 ° C'de. Örnekler (80 mg)% 60 etanolde (10 mL) seyreltildi ve sonikasyona tabi tutuldu (30 ° C'de 20 dakika). Daha sonra, 200 mg poliamid içeren bir kolondan 2 mL numune geçirildi ve elüat bir HPLC sistemine enjekte edildi. Ayrılma, 0.8 mL / dak akış hızında, trietilamin (A) ve asetonitril (B) ile pH 6.9'a ayarlanan sudaki gradyan elüsyonu (% 0.2 asetik asit) kullanılarak gerçekleştirildi, tespit, 245 nm'de yapıldı ve oksindol konsantrasyonu alkaloitler (OA) daha önce Bertol ve arkadaşlarında tarif edildiği gibi hesaplandı [ 17 ]. 2.5. Akış Sitometri Analizi

      PE Annexin V'e karşı 7-amino-aktinomisin D (7-AAD) boyaması, üreticinin talimatlarına göre PE Annexin V Apoptoz Saptama Kiti I kullanılarak yapıldı ve akış sitometrisi ile analiz edildi. CELLQuest yazılımıyla FACSCalibur kullanılarak toplam 10.000 olay elde edildi ve analiz edildi. Annexin-V + 7AAD - bölmesindeki canlı kapılı hücreler erken apoptotik hücreler olarak ve Annexin-V + 7AAD + bölmesindeki kapılı hücreler geç apoptotik / ölü hücreler olarak tanımlandı. 2.6. Hücreler Mortalite Testi

      Hücre kültürü ortamında bulunan DNA fragmanları hücre ölümünü gösterdi. İşlemlerin HT29 hücrelerinin canlılığı üzerindeki etkisini değerlendirmek için üreticinin talimatlarına göre Quant-iT PicoGreen dsDNA reaktifini (Invitrogen) kullandık. Tahlil, spesifik flürokrom boyanın (PicoGreen), tek sarmallı DNA (ssDNA), proteinler, SDS ve üre yerine çift sarmallı DNA (dsDNA) ile stabil bir kompleks oluşturma kabiliyetine dayanmaktadır. Bu seçici karakteristik, hücre ortamındaki dsDNA artışlarının, florimetrik sinyal yoğunluğundaki artışlarla orantılı olduğu hücre ölümünü izlemek için kullanıldı. Floresans, 480 nm'lik bir eksitasyonda ve oda sıcaklığında kaydedilen 520 nm'lik bir emisyonda ölçülmüştür (SpectraMax M2 / M2e Çok Modlu Plaka Okuyucu, Molecular Devices Corporation, Sunnyvale, CA, ABD). 2.7. Genotoksisite Etkisi

      İşlemlerin potansiyel genotoksik etkileri, Singh ve çalışma arkadaşlarına [ 18 ] ve kuyruklu yıldız testi için genel kılavuzlara [ 19 ] göre yapılan tek hücreli jel elektroforez analizi (DNA Comet testi) kullanılarak değerlendirildi . Taze toplanan hücreler (10 6 , daha önce, 24 saat için tarif edildiği gibi) ile tedavi edilmiştir. Süpernatan çıkarıldı ve 24 saat süreyle kültür ortamıyla değiştirildi. Sonra, 60  μPBS içinde% 0.6 düşük erime noktalı agaroz (LMA), işlenmiş hücrelere eklendi ve hücreler daha sonra yağdan arındırılmış mikroskop lamlarına aktarıldı. Yüz hücre (iki kopya slaytın her birinden 50 hücre) seçildi ve analiz edildi. Hücreler kuyruk uzunluğuna göre görsel olarak puanlandı ve şu şekilde sınıflandırıldı: sınıf 0 (kuyruk yokluğu); sınıf 1 (negatif kontrol çekirdeğinin çapının 1 katına kadar kuyruk); sınıf 2 (çekirdeğin çapının 2 katına kadar kuyruk); sınıf 3 (çekirdeğin çapının 3 katına kadar kuyruk); ve sınıf 4 (çekirdeğin çapının 3 katından fazla kuyruk). Skorlar 0'dan (geçiş yok) 4'e (maksimum geçiş) kadardır. Bu nedenle, hücreler için hasar endeksi, 0'dan (göçü olmayan tüm hücreler) 400'e (maksimum göçü olan tüm hücreler) değişmiştir. 2.8. Caspases 8, 3 ve 1 Etkinlik Testi

      Caspases 1, 3 ve 8 aktiviteleri Fluorimetric Assay Kits (BioVision, Mountain View, CA) kullanılarak belirlenmiştir. Kasaz 1, 3 ve 8'in floresans yoğunluğu sırasıyla uyarma ve emisyon için 400 nm ve 505 nm'de kaydedilmiştir. Kaspaz aktivitesi floresan yoğunluğu (FI) olarak hesaplanmıştır / dakika / ml = ΔFlt / ( t x h ), ΔFlt = sıfır zamanında ve zaman arasında floresan yoğunluğundaki fark burada t dakika, t , reaksiyon dakika olarak zamanı, ve = v = ml cinsinden numune hacmi. Tüm sonuçlar altı bağımsız deneyden elde edildi. Protein içeriği Bradford'a göre belirlendi [ 20 ]. 2.9. Superoksit Dismutaz (SOD) ve Katalaz (CAT) Aktiviteleri

      Hücreler toplandı ve 5 x 10 bir konsantrasyona ayarlanmıştır 6 PBS tamponu içinde hücre / ml. CAT aktivitesi Nelson ve Kiesow [ 21 ] tarafından açıklanan modifiye metoda göre belirlendi . 240 nm'de absorbanstaki değişim 2 dakika boyunca ölçüldü. CAT faaliyeti molar sönüm katsayısı (0.046 mM kullanılarak hesaplandı -1  cm -1 ) ve sonuçlar, miligram protein başına CAT pikomol olarak ifade edildi.

      SOD aktivitesi, daha önce McCord ve Fridovich [ 22 ] tarafından tarif edildiği gibi adrenalin ile radikal süperoksit reaksiyonunun inhibisyonuna dayanarak belirlenmiştir . SOD aktivitesi, 480 nm'de gözlenen glisin-NaOH (50 mM, pH 10) ve adrenalin (1 mM) içeren ortamdaki adrenkojen oluşum oranının ölçülmesiyle belirlendi. SOD birimleri, adrenalin oksidasyonunun% 50'sini inhibe eden ve 106 hücre başına birim olarak ifade edilen enzim miktarıyla tanımlanır . 2.10. İçerik ROS

      Hücreler toplandı ve 1 x 10 bir konsantrasyona ayarlanmıştır 6 PBS tamponu içinde hücre / ml. ROS üretimi, daha önce Ali ve arkadaşları tarafından tarif edildiği gibi floresan probu, 2,, 7′-diklorofloresein diasetat (DCFH-DA) kullanılarak hesaplandı [ 23 ]. Kısaca, hücreler (5 homojenize edildi ve numuneler, DCFH-DA mevcudiyetinde inkübe edildi  ^ ım) 60 dakika 37 ° C'de. DCFH-DA, flüoresan olmayan DCFH oluşturmak için hücre içi esterazlar ile enzimatik olarak hidrolize edildi; bu daha sonra ROS varlığında yüksek flüoresan 2 ′, 7′-diklorofloresein (DCF) oluşturmak için hızla oksitlendi. DCF floresans yoğunluğu, oluşturulan ROS miktarı ile orantılıydı. Floresans sırasıyla 480 ve 535 nm uyarma ve emisyon dalga boyları kullanılarak ölçülmüştür. Bir kalibrasyon eğrisi DCF (0.1 nm ila 1 ile kurulan  μ m) ve ROS seviyelerinin DCF mmol / mL olarak ifade edildi.


      2.11. RNA Ekstraksiyonu ve qRT-PCR

      Toplam RNA, üreticinin talimatlarını izleyerek Trizol (Invitrogen) kullanılarak farklı işlemlerde kültürlenmiş hücrelerden izole edildi. RNA 260 nm'de emilim ile ölçülmüştür. Toplam RNA (1  μ 5 dakika kontamine edici DNA sindirimi g) 37 ° C 'de DNase (Invitrogen) ile muamele edilmiştir. Ters transkriptaz reaksiyon 20 bir son hacim içinde, üreticinin talimatlarına uygun olarak, iScript cDNA Sentez Kiti (Bio-Rad) kullanılarak gerçekleştirildi  μ Uygulamalı (StepOnePlus RT-PCR Sistemi kullanılarak QRT-PCR ile gerçekleştirilir göreceli gen ekspresyonu L. Analizi SYBR'li Biosystems) Master Mix'i (Uygulamalı Biosystems) seçin. MRNA miktarındaki değişkenlik, β -aktin temizlik geninin amplifikasyonu ile düzeltildi .

      ERCC1 ve temizlik geni β -aktin için primerler, GenBank'ta mevcut olan sekansları baz alan Primer Express yazılımı v 3.3'te (Applied Biosystems) tasarlanmıştır. Oligonükleotitler, IDT (Integrated DNA Technologies) ile sentezlendi. 1'den fazla transkripte sahip olan genler için, tüm diziler ClustalW2 kullanılarak dizildi ve primer dizilim konsensüs bölgesinde tasarlandı. Genlerin listesi, ileri primer, ters primer ve GenBank erişim numarası aşağıdaki gibidir.

      ERCC1. CTCAAGGAGCTGGCTAAGATGTG; TTCTGCTCATAGGCCTTGTAGGT; NM_001166049.1 ; NM_001983.3 ; NM_202001.2 .

      β -aktin . TGTGGATCAGCAAGCAGGAGTA; TGCGCAAGTTAGGTTTTGTCA; NM_001101.3 . 2.12. İstatistik


      Veriler varyans analizi (ANOVA) ve t- testi kullanılarak değerlendirildi ve ortalama ± SD olarak ifade edildi. P <0.05 istatistiksel olarak anlamlı kabul edildi. 3. Sonuçlar

      3.1. Ekstraktın Analizi

      Kuru Uncaria tomentosa ekstraktının ( Şekil 1 ) HPLC analizi, speciophylline, uncarine F, mitraphylline, rynchophylline, isomitraphylline, uncarine C, isorynyphiline ve uncarine C'nin toplamı olarak sayılan% 4.20 oksindol alkaloit (OA) içeriğine sahiptir.
      Resim, çizim vb. İçeren harici bir dosya. Nesne adı ECAM2014-274786.001.jpg
      Şekil 1
      Uncaria tomentosa'dan kuru ekstrenin HPLC-parmak izi analizi . 1 — Spektiofilin (10.075 dk), 2 — unkarin F (14.067 dk), 3 — mitrafilin (15.193 dk), 4 — rinokfilin (19.724 dk), 5 — izomitrafilin (22.515 dk), 6 — unkarin C (23.682 dk), 7 - izorinkokfilin (25.778 dk) ve 8 — unkarin E (31.255 dk). 3.2. Apoptozis Deneyi

      Uncaria tomentosa veya oksaliplatin sonrasında canlı hücre sayısında (Annexin-V - / 7AAD - ) belirgin bir azalma gözlendi. Önemli olarak, Uncaria tomentosa , HT29 tümör hücrelerinde, kontrole kıyasla 48 saat maruz kalmada apoptozu arttırmıştır (Annexin V + hücreleri:% 67 x% 16). Kombine Uncaria + kemoterapi tedavisinde de benzer sonuçlar gözlendi . Uncaria tomentosa ve Uncaria + kemoterapisine 72 saat maruz kalma, apoptotik hücre ölümü ile sonuçlandı, daha yüksek oranda yüzde 7AAD + hücresi vardı, bu sadece erken apoptotik bir artış olmadığını gösteriyor (Annexin-V + / 7AAD -) aynı zamanda geç apoptotik / nekrotik hücrelerde bir artış (Annexin-V + / 7AAD + ) ( Şekil 2 ).
      Resim, çizim vb. İçeren harici bir dosya. Nesne adı ECAM2014-274786.002.jpg
      Ayrı bir pencerede aç
      şekil 2
      Apoptozis PE Annexin V Apoptozis Saptama Kiti I (BD Pharmingen) kullanılarak değerlendirildi. Hücreler 48 saat veya 72 saat boyunca aşağıdaki sitotoksik madde konsantrasyonları ile muamele edilmiştir: (A) = kontrol: Uncaria tomentosa özü veya oksaliplatin içermeyen kültür ortamı ; (B) = kemoterapi: oksaliplatin 20  μ mol / L; (C) = Uncaria : Uncaria tomentosa 750 özü  μ gr / ml; (D) = Uncaria + kimya .: Uncaria tomentos bir ekstresi 750  μ gr / ml + oksaliplatin 20  μmol / L. CELLQuest yazılımıyla FACSCalibur kullanılarak toplam 10.000 olay elde edildi ve analiz edildi. Hücreler PE Annexin V ve 7-AAD negatif, canlı hücreler olarak kabul edildi; Annexin-V + 7AAD - bölmesindeki canlı kapılı hücreler erken apoptotik hücreler olarak tanımlanmış ve Annexin-V + 7AAD + bölmesindeki kapılı hücreler geç apoptotik / ölü hücreler olarak tanımlanmıştır. 3.3. Comet Tahlili


      Kuyruklu yıldız tahlili kullanılarak tek hücrelerde DNA bütünlüğünü belirledik. Kemoterapi tedavisi birkaç hücrede apoptozu tetikledi, bu da 24 saatlik tedaviden sonra kuyrukta bir artış gösterdi (sınıf 1, 2, 3 ve 4, veriler gösterilmemiştir) kontrolle karşılaştırıldığında. Uncaria tomentosa tedavisi ayrıca apoptoziyi (sınıf 4) indüklemiş, ancak sınıf 2 ve 3'te daha az sayıda hücreye sahip, kemoterapi tedavisinden sonra gözlemlenenlere benzer ve iki sitotoksik ajanın kombinasyonundan daha az hasar endeksi ile sonuçlanmıştır. Süpernatanın çıkarılmasından ve 24 saat daha inkübasyonun ardından (48 saat olarak adlandırılır), Uncaria tomentosa ve Uncaria ile yapılan işlemlerde gözlemlenen olaylar+ kemoterapi tersine çevrilemedi, bu da daha yüksek bir hücre yüzdesinin apoptoza maruz kaldığına işaret ediyordu. Bu, hasar indeksindeki değişikliklerle gözlendiği gibi sitotoksik etkilerin kısmen tersine çevrildiği, oksaliplatine maruz kalan hücrelerde durum böyle değildi ( Şekil 3 ).
      Resim, çizim vb. İçeren harici bir dosya. Nesne adı ECAM2014-274786.003.jpg
      Figür 3
      Tek hücreli jel elektroforez analizi (DNA Comet tahlili) (a) ve PicoGreen tahlili (b). HT 29 hücreleri 1 x 10 96 gözlü düz tabanlı plakalarda tohumlanmıştır 6 canlı hücre / mL ve gece boyunca 37 ° C 'de yapışmaya bırakılmıştır. Hücreler 24 saat boyunca aşağıdaki sitotoksik madde konsantrasyonları ile muamele edildi: kontrol = Uncaria tomentosa özü veya oksaliplatin içermeyen kültür ortamı ; kemoterapi = oksaliplatin 20  μ mol / L; Uncaria = Uncaria tomentosa 750 özü  μ g / ml; Uncaria + chem. = Uncaria tomentos bir ayıklama 750  μ gr / ml + oksaliplatin 20  ^ ımol / L. Süpernatan çıkarıldı ve 24 saatin üzerinde bir kültür ortamıyla değiştirildi (48 saat adında). Farklı küçük harfler, tedaviler arasında istatistiksel olarak anlamlı farkları temsil eder ( P <0.05). 3.4. PicoGreen Tahlili

      PicoGreen boya, çift sarmallı DNA'nın (dsDNA) ölçülmesi için floresan bir nükleik asit boyasıdır. Bu tahlil, süpernatan içindeki daha fazla serbest dsDNA yüzdesinin, artan sayıda apoptotik hücreden kaynaklandığı ve böylece sitotoksisiteyi gösterdiği ilkesine dayanmaktadır. 24 saat içinde Uncaria tomentosa'nın , tek başına veya tek başına kemoterapiyle karşılaştırıldığında, tek başına veya kemoterapi ile birlikte kullanıldığında majör sitotoksisiteyi indüklediğini bulduk . Bununla birlikte, 48 saatte, hücrelerin çoğunda 24 saatte yaralanan hücrelerin çoğunun yaralanmasından dolayı bozulmamış hücrelerin nispi eksikliği nedeniyle potansiyel olarak hücre ölümünde bir artış gözlemlemedik ( Şekil 3 ). 3.5. Caspase Etkinlikler

      Uncaria tomentosa özü ve oksaliplatin, kontrollere kıyasla kaspazlar 8 ve 1'in ve efektör kaspazın 3 aktivitesinde anlamlı bir artışa neden oldu. Uncaria tomentosa özütü, oksaliplatinden daha yüksek bir kaspaz aktivitesini indüklemiştir ve tüm kaspaz aktivitelerinin indüksiyonu için oksaliplatine Uncaria tomentosa eklendiğinde sinerji gözlenmiştir ( Şekil 4 ).
      Resim, çizim vb. İçeren harici bir dosya. Nesne adı ECAM2014-274786.004.jpg
      Şekil 4
      Kaspaz faaliyetleri. Florimetrik Test Kitleri kullanılarak belirlenmiştir. HT 29 hücreleri 1 x 10 96 gözlü düz tabanlı plakalarda tohumlanmıştır 6 canlı hücre / ml. Hücreler 48 saat boyunca aşağıdaki sitotoksik madde konsantrasyonları ile muamele edildi: kontrol = Uncaria tomentosa özü veya oksaliplatin içermeyen kültür ortamı ; kemoterapi = oksaliplatin 20  μ mol / L; Uncaria = Uncaria tomentosa 750 özü  μ g / ml; Uncaria + chem. = Uncaria tomentosa 750 özü  μ gr / ml + oksaliplatin 20  μ mol / L. Farklı küçük harfler, tedaviler arasında istatistiksel olarak anlamlı farkları temsil eder (P <0.05). 3.6. SOD, CAT Etkinliği ve ROS İçeriği


      İle tedavi Uncaria tomentosa 750 bir konsantrasyonda özü  μ oksaliplatin eklenmesi enzim katalaz (bir artışı ile sonuçlanırken gr / ml önemli ölçüde, SOD aktivitesi artmış Şekil 5 ). ROS içeriği, Uncaria tomentosa özü artı oksaliplatin tedavisi ile yapılan kontrol ile karşılaştırıldığında önemli ölçüde artmıştır ve Uncaria tomentosa ile oksaliplatin tedavileri arasında fark bulunmamıştır ( Şekil 5 ).
      Resim, çizim vb. İçeren harici bir dosya. Nesne adı ECAM2014-274786.005.jpg
      Şekil 5
      Oksidatif stres. HT 29 hücreler, 1 x 10 6-gözlü düz tabanlı plakalarda tohumlanmıştır 6 canlı hücre / ml. Hücreler 24 saat (DCF testi) veya 48 saat (SOD ve katalaz aktivitesi) için aşağıdaki sitotoksik madde konsantrasyonları ile muamele edildi: kontrol = Uncaria tomentosa özü veya oksaliplatin içermeyen kültür ortamı ; kemoterapi = oksaliplatin 20  μ mol / L; Uncaria = Uncaria tomentosa 750 özü  μ g / ml; Uncaria + chem. = Uncaria tomentosa 750 özü  μ gr / ml + oksaliplatin 20  μ mol / L. Hücreler 1 x 10 bir konsantrasyona toplandı ve ayarlanmıştır 6 PBS tamponu içinde hücreler / mL. (a) SOD aktivitesi: SOD birimleri, adrenalin oksidasyonunun% 50'sini inhibe eden ve 106 hücre başına birim olarak ifade edilen enzim miktarıyla tanımlanır . (b), katalaz aktivitesi molar sönüm katsayısı (0.046 mM kullanılarak hesaplandı -1  cm -1 ) ve sonuçlar, 10 başına katalaz pikomol olarak ifade edilmiştir 6 hücreleri. (c) ROS üretimi, floresan DCF'ye oksitlenen DCFH-DA sondası kullanılarak tahmin edildi. Farklı küçük harfler, tedaviler arasında istatistiksel olarak anlamlı farkları temsil eder ( P <0.05). 3.7. ERCC1 mRNA'nın İfadesi


      Oksaliplatin ile işlem, ERCC1 mRNA'nın ekspresyonunun artmasına neden oldu. Uncaria tomentosa özütü, oksaliplatin maruziyeti ile indüklenen ERCC1 ekspresyonunun aşağı regüle edilmesine neden oldu, bir kere oksaliplatin ile birleştirilmiş Uncaria tomentosa maruziyeti, yalnızca oksaliplatin ile muamele ile ilgili olarak ERCC1 mRNA seviyelerini önemli ölçüde azalttı ( Şekil 6 ).
      Resim, çizim vb. İçeren harici bir dosya. Nesne adı ECAM2014-274786.006.jpg
      Şekil 6
      ERCC1 mRNA düzeyi-HT29 hücre oksaliplatin (20 ile muamele edilmiş  μ M) Uncaria tomentosa ekstraktı (250  μ g / mL) ve Uncaria tomentosa 48 saat + oksaliplatin. Toplam RNA izole edildi ve qRT-PCR'ye tabi tutuldu. Farklı küçük harfler, tedaviler arasında istatistiksel olarak anlamlı farkları temsil eder ( P <0.05).

      Git: 4. Tartışma

      4.1. Uncaria tomentosa Ekstresi ve Apoptozun OA İçeriği

      Uncaria tomentosa'nın iki kemotipinin varlığını belirten iki subt tipi oksindol alkaloit, pentasiklik oksindol alkaloit (POA) ve tetrasiklik oksindol alkaloit (TOA) tanımlanmıştır . Bir kemotip POA içerir ve diğer kemotip bitkinin çeşitli yerlerinde POA ve tetrasiklik indol alkaloitlerine ek olarak TOA içerir [ 7 ]. 1998'de, Wurm ve arkadaşları [ 24 ], endotelyal hücrelerden çıkan süpernatanın, Uncaria tomentosa ile kültürlendiğini gösterdi.POA (mitraphylline / isomitraphylline ve isopterodine), T ve B lenfoblastoid hücreleri (Jurkat ve Raji hücreleri) üzerinde antiproliferatif bir etkiye sahipti. Bu aktivite, TOA (rinchophylline ve isorhynchophylline) ilavesiyle doza bağlı bir şekilde inhibe edildi. Bu çalışmanın özü, Wurm ve iş arkadaşları tarafından bildirilenden daha yüksek bir konsantrasyonda doğrudan kültür ortamında kullanıldığında, neoplastik hücreler üzerinde apoptozu indükleme kabiliyetini etkilemeyen TOA ve POA'dan oluşmaktadır [ 24 ]. Uncaria tomentosa'nın neoplastik hücreler üzerindeki apoptotik etkisi birçok çalışmada bildirilmiştir [ 12 , 15 ]. Pilarski ve arkadaşları [ 12], Su ya da etanol (% 50 ya da% 96) 'de kabuğu,% 10 elde edilen bir ekstrakt kullanılan ve bir IC rapor 50 499 803 arasında değişen  μ HT29 hücrelerinde g / mL. Biz 750 bir konsantrasyonda% 70 etanol içinde bir% 5 özü kullanılan  μ g / mL ve aynı zamanda önemli bir apoptotik etkiye görülmektedir. Bu sonuçlar, akış sitometrisinin yanı sıra kaspaz aktivitesi ve kuyruklu yıldız tahlili kullanılarak bir Annexin V ve 7AAD testinde gözlendi. Bu çalışmanın temel amacı, oksaliplatin ve Uncaria tomentosa arasındaki etkileşimi değerlendirmektir.. Kanser hastalarında antioksidan etkisi olan bitkisel ürünlerle takviye konusu halen tartışmalıdır. Yararlı etkiler, toksisiteyi hafifletmek için antioksidanların kullanılmasından kaynaklanır ve böylece kesintisiz tedavi programları ve daha düşük kemoterapi dozlarına yönelik azaltılmış bir ihtiyaç sağlar. Bununla birlikte, spesifik kemoterapi ilaçlarının aktivitesi için reaktif oksijen türleri gerekliyse, antioksidanların kullanılması istenmeyebilir [ 25 ]. Uncaria tomentosa ekstraktının oksaliplatinin sitotoksik aktivitesi ile olan etkileşimini gözlemlemedik ve verilerimiz Uncaria tomentosa'nın adenokarsinom hücrelerinde apoptotik bir etkisi olduğunu gösterdi . Bununla birlikte, bu ilaçların potansiyel metabolik etkileşimini göz önünde bulundurmak gerekir. Uncaria tomentosailaç marker substratlarının insan sitokrom P-450 (CYP) yoluyla in vitro metabolizmasını inhibe eder . Uncaria tomentosa , 3A4'ü izole etmek için orta derecede inhibe edici (>% 56) ve diğer izoformlara (2C9, 2C19 ve 2D6) karşı hafif inhibe edicidir [ 26 ]. CYP3A izoformu tarafından metabolize edilen substratlar kemoterapi ilaçlarını dasatinib, siklosporin [ 27 ], irinotekan ve oksaliplatin [ 28 ] içerir. Metabolik enzimlerin inhibisyonu, toksisitenin artmasına neden olabilir. Uncaria tomentosa , nötropeni gibi yan etkileri en aza indirmek için bu kemoterapi ajanları [ 10 , 29 ] ile kombinasyon halinde klinik olarak kullanılıyorsa bu dikkate alınmalıdır .

      4.2. Caspase Etkinlikler

      Antikanser ilaçlar, apoptotik yolakların iki ana sinyal yolundan aktive edilmesiyle tümör hücrelerini öldürür: mitokondriyal veya intrinsik yol ve ölüm reseptörü veya ekstrinsik yol [ 30 ]. Ölüm reseptörleri ve bir ölüm domeni içeren bağdaştırıcı protein içeren ekstrinsik yol faktörleri, ligandların ve ön kaspazların aktivasyonu ve bağlanması yoluyla apoptozu uyarır [ 31 ]. Ölüm reseptörü ailesinin sekiz üyesi, tümör nekroz faktörü reseptörü 1 (TNFR1; DR1 olarak da bilinir), CD95 (aynı zamanda DR2, APO-1 ve Fas olarak da bilinir) ve DR3 (APO-3 olarak da bilinir) dahil olmak üzere karakterize edilmiştir. ). Uncaria tomentosa'nın apoptotik etkisini incelemekve oksaliplatin, kaspaz 8 (FLICE), kaspaz 1 (interlökin-1 β dönüştürücü enzim, ICE) ve kaspaz 3 (CPP32) aktivitelerini değerlendirerek apoptozun ekstrinsik yolunu analiz ettik . Uncaria tomentosa ile muamele sadece incelenen üç kasanın daha büyük bir aktivitesine neden olmakla kalmayıp, ayrıca ortama oksaliplatin ile eklendiğinde aktivitede daha da bir artış gösterdi. TNF reseptörü ve ligand ailesi ve ölüm efektör domeni ailesi, oksaliplatin tedavisi ile aktive edilir ve kaspazlar, oksaliplatine tedaviye yanıt veren ana genlerdir [ 32 ]. Bir başlatıcı kaspaz olan kaspaz 8, CD95 ve TNFR1 yolu ile aktive edilir ve daha sonra efektör kaspaz 3'ü aktive eder [ 33], hücrelerde geri dönüşümsüz apoptozun indüklenmesi. Kaspaz 1, enflamatuar işlemlerle ilişkilendirilse de, başlatıcı kaspaz 8 yoluyla apoptozu aktive eden ölüm reseptörü DR3 boyunca ekstrinsik yol yoluyla apoptoza katılır. Bu daha sonra uygulayıcı kaspaz 3 veya kaspaz 1 aktivasyonuyla akış aşağı moleküler olayları indükler [ 34 ].

      Baker ve arkadaşları [ 15 ] daha önce, Uncaria tomentosa POA'ya (pterodine) bağlı apoptozun , T lenfoblastik hücrelerde CD95 / Fas yolu ile meydana gelmediğini göstermiştir. Apoptozun CD95 yolağı dışındaki mekanizmalar yoluyla da ortaya çıkması ilginçtir, çünkü birçok karsinom CD95'i anormal derecede düşük seviyelerde eksprese eder veya tamamen ekspresyonu yoktur. Ayrıca, kolon karsinomu hücre çizgileri CD95 aracılı apoptoza nispeten dirençlidir [ 35 ]. Kaspaz 1 ayrıca, aşağı regüle edildiği kolon kanseri hücrelerinde Fas aracılı apoptozise karşı direnç gösterdiği ve bu hücrelerin IFN- γ tedavisi ile Fas'a duyarlı hale getirilmesinin kaspaz 1'in bir yukarı regülasyonu ile çakıştığını göstermiştir [ 36 ].

      Gonçalves ve arkadaşları [ 37 ] ayrıca antimikrotubül ajanı kaynaklı apoptozun kaspaz 8 aktivasyonunu içerdiğini bildirmiştir. Bu apoptotik yol HT29-D4 hücrelerinde CD95 ligasyonundan bağımsızdır. Kaspaz 8 aktivasyonunun, CD95'in katkısından bağımsız olarak çeşitli apoptotik yollar için ortak bir sinyal olayı olabileceğini gösterdiler. Daha sonra, Lacour ve iş arkadaşları [ 38] kolon kanseri hücrelerinin çeşitli sitotoksik ilaçlara maruz kalmasının, liganddan bağımsız bir şekilde ölüme neden olan sinyal kompleksi (DISC) içeren bir CD95 oluşumuna neden olduğunu gösterdi. Bu, CD95 reseptörünün HT29 hücrelerinin yüzeyindeki lipit sallarına yeniden dağıtılmasına neden olarak sitotoksik ilaçların ölüm reseptörü ligandları ile sinerjize edilmesine ve tümör hücresi ölümünü indüklemesine olanak sağlamıştır. Ayrıca FADD ve procaspase 8'in sisplatin tedavisinin ardından sallara alındığını gösterdiler. Verilerimiz diğer çalışmalarla uyumlu. Kanser hücrelerinde apoptozun Uncaria tomentosa özü ile kaspas 3 ve 8 yoluyla uyarılması , daha önce de Martino ve ark. [ 14 ] ve Cheng ve arkadaşları [ 13 ]. Bununla birlikte, daha fazla çalışma ile kaspaz 8 aktivasyonu olup olmadığını değerlendirmek için gerekli olan Uncaria tomentosa ekstraktı veya oksaliplatin da daha önce anlatılan aktivasyonu FAS / APO1 yolu [ek olarak ölüm reseptörü DR3 yoluyla meydana 13 ]. 4.3.

      Oksidatif stres

      Laurent ve arkadaşları [ 39 ] ROS'un normal hücreler ve tümör hücreleri arasında apoptoza karşı proliferasyona göre farklı etkiler gösterebileceğini ve böylece antioksidanların hücre tipine bağlı olarak farklı roller oynayabildiklerini göstermiştir. H düzeylerini düşürmek bazı bağlamlarda, ürün olarak 2 O 2 inhibe normal hücrelerin çoğalması ve tümör hücre proliferasyonunu arttırır. Bununla birlikte, bir enzim olan SOD etkisini taklit antioksidanlar H düzeylerini artırmak 2 O 2 süperoksit anyon dismutasyon ile ve tümör hücrelerinin apoptosis in vitro ve uygulamak bir in vivoantitümör etkisi. Bununla birlikte, bu çalışmada oksaliplatinin SOD taklitleri ile sinerjistik bir etkisi olduğunu gözlemlediler [ 39 ].

      Alexandre ve arkadaşları [ 40 ] daha sonra iki SOD (CuDIPS; MnTBAP) ve Mangafodipir (SOD-, katalaz ve glütatyon redüktaz benzeri özellikleri olan manganez şelatları) mimiklerinin, oksaliplatin, paklitaksel ve 5-floroil içindeki sitotoksisitesini arttırdığını bildirdi. artan H den doza bağımlı bir şekilde CT26 kolon kanseri hücreleri 2 O 2 birikimi. Tersine, N-asetilsistein, bu kemoterapiler tarafından uygulanan sitotoksisiteyi azalttı [ 40 ]. Dolayısıyla, bu çalışmada Uncaria tomentosa özü ile muameleden sonra gözlemlenen SOD aktivitesindeki artış , kemoterapötik sitotoksisitesine katkıda bulunabilir. Verilerimiz Pilarski ve arkadaşları ile uyumludur [ 9Uncaria tomentosa'nın etanol ekstraktının süperoksit radikal temizleme aktivitesinin (SOD benzeri aktivite) arttığını göstermiştir. Uncaria tomentosa ekstraktı artı oksaliplatin ilavesi, SOD'un artan aktivitesi ile ilişkili olabilecek kontrol ile karşılaştırıldığında artan ROS seviyeleri ile sonuçlanmıştır. Reaktif oksijen türlerinin, bazal konsantrasyonu (özellikle H 2 O 2 ) bağlı solunum zinciri ve sitoplazmik NADPH oksidaz [ile süperoksit anyon daha yüksek bir üretime, normal karşılıkları ile karşılaştırıldığında kanser hücrelerinde daha yüksek olan 41 ]. Böylece Mn-SOD aktivitesindeki bir artışın potansiyel olarak H parçasından neden olabilir 2 O 2kaynaklı sitotoksisite ve doğal polifenollerin kullanıldığı bir çalışmada gözlendiği gibi apoptoza katkıda bulunur [ 41 ]. Bununla birlikte, yalnızca SOD ve CAT enzimlerinin aktivitesindeki mütevazı artış, gözlenen oksidize DCF'deki ana artışı açıklamak için yeterli değildir. Karlsson ve arkadaşları [ 42 ], H2DCF'nin DCF'ye önemli sitozolik oksidasyonunun, Fenton-tipi reaksiyonların (ROS aracılı) ve sitokrom c'nin enzimatik aktivitesinin birleşik etkisine bağlı olduğunu göstermiştir. Ayrıca, redoks-aktif demirin sitozole salınmasına ve / veya mevcut çalışmada gözlemlendiği gibi güçlü bir sitozolik DCF-aracılı flüoresanın indüklenmesi için sitokrom c'nin mitokondriyal salıverilmesine bağlıdır. Böylece, Uncaria tomentosa ile tedavi edilen hücrelerde gözlenen güçlü floresans Ayrıca oksaliplatin, apoptoz geçiren ve sonuç olarak sitokrom c salgılayan hücrelerin büyük bir yüzdesini de yansıtabilir (kaspazların aktivasyonundan dolayı).

      4.4. DNA Onarımı

      Oxaliplatin, kovalent olarak DNA'ya bağlanır ve DNA eklentilerinin üretimini indükleyerek DNA çoğalmasını engeller ve hem içi hem de arada çapraz bağlara neden olur. Memeli hücrelerinde, DNA intrastrand ve çapraz bağları, nükleotit eksizyon onarım (NER) sistemi ile tamir edilir. Bu eklentilerin genomik DNA'dan uzaklaştırılması, hasarlı DNA'nın 5-bölgesinde kesilmesinden sorumlu yapıya özgü bir DNA onarım endonükleaz olan eksizyon onarım çapraz tamamlayıcı 1 (ERCC1) olarak adlandırılan bir enzim aracılık eder. Önceki bir çalışmada, Uncaria tomentosa'nın ekstraktının, bir Allium cepa'da sitogenetik analiz kullanılarak oksaliplatin kaynaklı hasarı geri kazandırdığını gösterdik.Ölçek. Bu, HT29 hücreli bu çalışmada gerçekleşmedi. Bu sonuç, DNA onarım aktivitesinin artması tedaviye daha zayıf bir yanıtla ilişkili olduğu için faydalıdır. ERCC1, oksaliplatin ile tedaviden sonraki hayatta kalma süresini etkileyebilir [ 43 ]. Arnould ve arkadaşları [ 44 ], Pt-DNA eklentilerinin kalıntı seviyesinin sisplatin sitotoksisitesi ile ilişkili olduğunu göstermiş olsa da, bunun oksaliplatin için oluşmadığını göstermiştir. Oksaliplatin tarafından indüklenen lezyonların onarımı ve hücrelerin transleryon sentezi ile indüklenen mutasyonlara yönelme şekli, sitotoksisite açısından DNA adduktlerinden daha önemli faktörlerdir [ 44 ].

      Dirençli insan kolorektal kanser hücre çizgileri (bunların arasında HT 29), hassas hücre çizgileriyle olanların aksine oksaliplatine maruz kaldıklarında mRNA ve ERCC1 protein seviyelerinde önemli bir indüksiyon gösterir [ 45 ]. Mallick ve arkadaşları [ 46 ], insan kolorektal kanser hücrelerinin çizgilerinde bir oksaliplatin direncinin bir işareti olarak ERCC1 indüksiyonunun bazal ERCC1 ekspresyonundan daha önemli olduğunu gösterdi. Seetharam ve arkadaşları [ 45 ] ayrıca, bu gen ekspresyonunun ERCC1'in hedefli olarak baskılanması ile tersine çevrilebildiğini gösterdi.

      Çalışmamızın sonuçları, Uncaria tomentosa özütünün, oksaliplatin tedavisi ile gözlenenin aksine, mRNA ERCC1'in aşırı ekspresyonu olmadan HT29 hücrelerinde apoptozu indüklediğini göstermektedir . Uncaria tomentosa özütü, oksaliplatine maruz bırakılan HT29 hücrelerinde mRNA ERCC1'in ekspresyonunun aşağı regülasyonuyla sonuçlandı. Curcumin (doğal fenolik bileşik) ve emodin (doğal antrakinon) gibi bazı doğal ürünler, ERCC1 protein seviyelerini azaltarak küçük hücreli dışı akciğer kanseri (KHDAK) için kemoterapötik tedavinin duyarlılığını arttırır [ 47 , 48]. Bu çalışmalarda, sisplatin ve kurkumin veya emodinin kombinasyonu, yalnızca sisplatin ile karşılaştırıldığında, bu ürünlerin bu insan akciğer kanseri hücre soylarında ERCC1'in hem protein hem de mRNA ekspresyonunu aşağı doğru düzenleyebildiğini gösteren önemli ölçüde daha düşük ERCC1 mRNA seviyeleri üretmiştir. Endojen ERCC1 ekspresyonunun tükenmesi, sisplatin ile tedaviden sonra akciğer kanseri hücre ölümünü önemli ölçüde arttırdı [ 47 , 48 ].

      5. Sonuç

      Uncaria tomentosa özü, kemoterapinin sitotoksik etkilerini azaltmadı. İn vitro olarak , Uncaria tomentosa ve oksaliplatinin birlikte kullanılması, kaspazlar 8, 3 ve 1'in aktivitesinde bir artış yoluyla adenokarsinom hücrelerinde apoptoz seviyelerinin artmasına ve ERCC1 mRNA seviyelerinin azalmasına neden oldu. Birlikte alındığında, Uncaria tomentosaÖzü, iyi bilinen tedavi protokollerine müdahale etmemek ve olası CYP3A4 inhibisyonunu değerlendirmekten kaçınmak için tamamlayıcı ve alternatif bir ilaç olarak kanser hastaları için faydalı olabilir. Bir alternatif, kemoterapi prosedüründen sonra bitkisel ürünün sıralı kullanımı olabilir. Bu yararlı etkinin diğer kemoterapötik ilaçlara yayılıp yayılmadığını değerlendirmek için ileri çalışmalar gereklidir.

      Teşekkür

      Araştırma tamamen devlet fonları tarafından desteklendi: CAPES ve FAPERGS. Çıkar Çatışması
      Yazarlardan ikisi, bitkisel ilaç endüstrisinde çalışmaktadır. Diğer tüm yazarların çıkar çatışması yoktur.



      Referanslar
      1. Blok KI, Koch AC, Mead MN, Tothy PK, Newman RA, Gyllenhaal C. Antioksidan takviyenin kemoterapötik toksisite üzerindeki etkisi: randomize kontrollü çalışmalardan elde edilen kanıtların sistematik bir incelemesi. Uluslararası Kanser Dergisi . 2008; 123 (6): 1227-1239. doi: 10.1002 / ijc.23754. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      2. Schumacker PT Kanser hücrelerinde bulunan reaktif oksijen türleri: kılıçla yaşar, kılıçla ölürler. Kanser Hücresi . 2006; 10 (3): 175-176. doi: 10.1016 / j.ccr.2006.08.015. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      3. Janssen AML, Bosman CB, Sier CFM, Griffioen G., Kubben FJGM, Lamerler CBHW, Van Krieken JHJM, Van de Velde CJH, Verspaget HW Superoksit kolorektal kanserli hastaların genel sağkalımı ile ilgili dismutazlar. İngiliz Kanser Dergisi . 1998; 78 (8): 1051-1057. DOI: 10.1038 / bj.1998.626. [ PMC ücretsiz makale ] [ PubMed ] [ CrossRef ] [ Google Akademik ]
      4. Hussain SP, Amstad P., He P., vd. p53-MnSOD ve GPx'in uyardığı, ancak Katalaz değil, oksidatif stres ve apoptozu arttırır. Kanser Araştırması . 2004; 64 (7): 2350-2356'da açıklanmaktadır. doi: 10.1158 / 0008-5472.CAN-2287-2. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      5. Priego S., Feddi F., Ferrer P., Mena S., Benlloch M., Ortega A., Carretero J., Obrador E., Asensi M., Estrela JM Doğal polifenoller HT-29 kolorektal kanserinin ortadan kaldırılmasını kolaylaştırır kemoradyoterapiyle ksenograftlar: bir Bcl-2- ve süperoksit dismutaz 2'ye bağlı mekanizma. Moleküler Kanser Tedavisi . 2008; 7 (10): 3330-3342. doi: 10.1158 / 1535-7163.MCT-08-0363. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      6. Heitzman ME, Neto CC, Winiarz E., Vaisberg AJ, Hammond GB Etnobotanik, fitokimya ve Uncaria (Rubiaceae) Fitokimyasının farmakolojisi . 2005; 66 (1): 5-29. doi: 10.1016 / j.phytochem.2004.10.022. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      7. Keplinger K., Laus G., Wurm M., Dierich MP, Teppner H. Uncaria tomentosa (Willd.) DC. — Etnomedicinal kullanım ve yeni farmakolojik, toksikolojik ve botanik sonuçlar. Etnofarmakoloji Dergisi . 1998; 64 (1): 23–34. doi: 10.1016 / S0378-8741 (98) 00096-8. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      8. Amerika Birleşik Devletleri Farmakopes Sözleşmesi. Amerika Birleşik Devletleri Farmakopesi (USP 36) 36. Rockville, Md, ABD: Amerika Birleşik Devletleri Farmakopes Sözleşmesi; 2013. [ Google Akademik ]
      9. Pilarski R., Zieliński H., Ciesiołka D., Gulewicz K. Uncaria tomentosa (Willd.) DC'nin etanolik ve sulu ekstrelerinin antioksidan aktivitesi . Etnofarmakoloji Dergisi . 2006; 104 (1-2): 18-23. doi: 10.1016 / j.jep.2005.08.046. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      10. Farias I., Carmo Araújo M., Zimmermann ES, vd. Uncaria tomentosa , miyeloid progenitör hücrelerin çoğalmasını uyarır. Etnofarmakoloji Dergisi . 2011; 137 (1): 856-863. doi: 10.1016 / j.jep.2011.07.011. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      11. Eberlin S., dos Santos LMB, Queiroz MLS Uncaria tomentosa özütü, Listeria monocytogenes ile enfekte olmuş farelerin kemik iliğinde miyeloid progenitör hücrelerin sayısını arttırır . Uluslararası İmmunofarmakoloji . 2005; 5 (7-8): 1235-1246. doi: 10.1016 / j.intimp.2005.03.001. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      12. Pilarski R., Filip B., Wietrzyk J., Kuray M., Gulewicz K. Uncaria tomentosa (Willd.) DC'nin Antikanser aktivitesi . farklı oksindol alkaloit bileşimli müstahzarlar. Fitomedikin . 2010; 17 (14): 1133-1139. doi: 10.1016 / j.phymed.2010.04.013. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      13. Cheng A.-C., Jian C.-B., Huang Y.-T., Lai C.-S., Hsu P.-C., Pan M.-H. Uncaria tomentosa tarafından reaktif oksijen türlerinin üretilmesi, sitokrom c salınımı ve insan lösemi hücrelerinde kaspaz aktivasyonu yoluyla apoptozun uyarılması . Gıda ve Kimyasal Toksikoloji . 2007; 45 (11): 2206-22218. doi: 10.1016 / j.fct.2007.05.016. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      14. de Martino L., Martinot JLS, Franceschelli S., Leone A., Pizza C., Feo V. Uncaria tomentosa özütlerinin proapoptotik etkisi . Etnofarmakoloji Dergisi . 2006; 107 (1): 91-94. doi: 10.1016 / j.jep.2006.02.013. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      15. Bacher N., Tiefenthaler M., Sturm S., Stuppner H., Ausserlechner MJ, Kofler R., Konwalinka G. Uncaria tomentosa kaynaklı oksindol alkaloitleri, çoğalmakta, G0 / G1-tutuklayan ve bcl-2 eksprese eden akut apoptozu indükler lenfoblastik lösemi hücreleri. İngiliz Hematoloji Dergisi . 2006; 132 (5): 615-622. doi: 10.1111 / j.1365-2141.2005.05907.x. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      16. Dreifuss AA, Bastos-Pereira AL, Fabossi IA, vd. Uncaria tomentosa , alkaloid aktivite ile değil, oksidatif stresi modüle ederek walker-256 tümörüne karşı geniş anti-neoplastik etkiler uygular. PLoS ONE . 2013; 8 (2) doi: 10.1371 / dergi.pone.0054618. e54618 [ PMC ücretsiz makale ] [ PubMed ] [ CrossRef ] [ Google Akademik ]
      17. Bertol G., Franco L., de Oliveira BH Uncaria tomentosa'daki oksindol alkaloitlerin HPLC analizi : faktoring tasarımı ile numune hazırlama ve analiz optimizasyonu. Fitokimyasal Analiz . 2012; 23 (2): 143-151. doi: 10.1002 / pca.1335. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      18. Singh NP, McCoy MT, Parça RR, Schneider EL Tek tek hücrelerde düşük DNA hasar seviyelerinin ölçümü için basit bir teknik. Deneysel Hücre Araştırması . 1988; 175 (1): 184-191. doi: 10.1016 / 0014-4827 (88) 90265-0. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      19. R1, Agurell D., Anderson D., Burlinson B., Hartmann A., Kobayashi H., Miyamae Y., Rojas E., Ryu JC, Sasaki YF, Tek hücreli jel / kuyruklu testi in vivo genetik toksikoloji testi. Çevresel ve Moleküler Mutajenez . 2000; 35 (3): 206-221. [ PubMed ] [ Google Akademik ]
      20. Bradford MM Protein boya bağlama prensibini kullanarak mikrogram miktarındaki proteinin miktar tayini için hızlı ve hassas bir yöntem. Analitik Biyokimya . 1976; 72 (1-2): 248 - 254. doi: 10.1016 / 0003-2697 (76) 90527-3 sayılı belge. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      21. Nelson DP, (H molar imha katsayıları olan 25 ° C 'de katalaz ile hidrojen peroksitin ayrışma Kiesow LA Entalpi 2 O 2 UV solüsyonlar) Analytical Biochemistry . 1972; 49 (2): 474-478. doi: 10.1016 / 0003-2697 (72) 90451-4. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      22. McCord JM, Fridovich I. Superoksit dismutaz. Eritrocuprein (hemocuprein) için bir enzimik fonksiyon Biyolojik Kimya Dergisi . 1969; 244 (22): 6049-6055. [ PubMed ] [ Google Akademik ]
      23. Ali SF, Le Bel CP, Bondy SC Metilmerkür ve trimetiltin nörotoksisitesinin bir biyolojik işareti olarak reaktif oksijen türlerinin oluşumu. Nörotoksikoloji . 1992; 13 (3): 637-648. [ PubMed ] [ Google Akademik ]
      24. Wurm M., Kacani L., Laus G., Keplinger K., Dierich MP Uncaria tomentosa kaynaklı pentasiklik oksindol alkaloitleri, lenfosit-proliferasyon düzenleyici bir faktörün salınması için insan endotel hücrelerini indükler. Planta Medica . 1998; 64 (8): 701-704. DOI: 10.1055 / s-2006-957561. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      25. Deng GE, Frenkel M., Cohen L., vd. Bütünleştirici onkoloji için kanıta dayalı klinik uygulama kılavuzları: tamamlayıcı tedaviler ve botanikler. Bütünleştirici Onkoloji Derneği Dergisi . 2009; 7 (3): 85-120. doi: 10.2310 / 7200.2009.0019. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      26. Foster BC, Vandenhoek S., Hana J., Krantis A., Akhtar MH, Bryan M., Budzinski JW, Ramputh A., Arnason JT Markör substratların insan ürünlerindeki sitokrom P450 aracılı metabolizmasının doğal ürünler tarafından in vitro inhibisyonu. Fitomedikin . 2003; 10 (4): 334-342. doi: 10.1078 / 094471103322004839. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      27. FDA 2006, http://www.fda.gov/Drugs/Development.../ucm093664.htm .
      28. Lentz F., Tran A., Rey E., Pons G., Tréluyer J.-M. Kolorektal kanserin hepatik metastazlarında floroürasil, irinotekan ve oksaliplatin farmakogenomikleri: klinik uygulamalar. Amerikan Farmakogenomik Dergisi . 2005; 5 (1): 21-33. doi: 10.2165 / 00129785-200505010-00002. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      29. Santos Araújo MDC, Farias IL, Gutierres J., Dalmora SL, Flores N., Farias J., Cruz ID, Chiesa J., Morsch VM, Chitolina Schetinger MR Uncaria tomentosa - Meme kanseri için yardımcı tedavi: klinik çalışma. Kanıta Dayalı Tamamlayıcı ve Alternatif Tıp . 2012; 2012 doi: 10.1155 / 2012/676984. 676984 [ PMC ücretsiz makale ] [ PubMed ] [ CrossRef ] [ Google Akademik ]
      30. Reyes-Zurita FJ, Pachón-Peña G., Lizárraga D., Rufino-Palomares EE, Cascante M., Lupia JA Doğal triterpen maslinik asit, HT29 kolon kanseri hücrelerinde JNK-p53'e bağlı bir mekanizma tarafından apoptoziyi indükler. BMC Kanseri . 2011; 11, madde 154 doi: 10.1186 / 1471-2407-11-154. [ PMC ücretsiz makale ] [ PubMed ] [ CrossRef ] [ Google Akademik ]
      31. Kurokawa M., Kornbluth S. Bir ölüm kavramadaki kaspaslar ve kinazlar. Hücre . 2009; 138 (5): 838-854 sayılı belgeler. doi: 10.1016 / j.cell.2009.08.021. [ PMC ücretsiz makale ] [ PubMed ] [ CrossRef ] [ Google Akademik ]
      32. Berindan-Neagoe I., Braicu C., Pileczki V., Petric RC, Miron N., Balacescu O., Iancu D., Ciuleanu T. 5-flüoroürasil, oksaliplatinin Colo320 kolorektal adenokarsinom hücreleri üzerindeki kanser karşıtı etkisini kuvvetlendirir . Gastrointestinal ve Karaciğer Hastalıkları Dergisi . 2013; 22 (1): 37-43. [ PubMed ] [ Google Akademik ]
      33. Yang X., Chang HY, Baltimore D. Pro-kaspazların oligomerizasyon ile otoproteolitik aktivasyonu. Moleküler Hücre . 1998; 1 (2): 319-325. doi: 10.1016 / S1097-2765 (00) 80032-5. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      34. Lee SY, Debnath T., Kim S. - K., Lim BO Anti-kanser etkisi ve insan kolon kanseri hücresi HT-29'da DR3 yolu ile kordiyepinin apoptoz indüksiyonu. Gıda ve Kimyasal Toksikoloji . 2013; 60 : 439-447. doi: 10.1016 / j.fct.2013.07.068. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      35. Reyher U., Sträter J., Kittstein W., Gschwendt M., Krammer PH, Möller P. Kolon karsinomu hücreleri, CD95 kaynaklı apoptozdan kaçmak için farklı mekanizmalar kullanır. Kanser Araştırması . 1998; 58 (3): 526-534. [ PubMed ] [ Google Akademik ]
      36. O'Connell J., Bennett MW, Nally K., Houston A., O'Sullivan GC, Shanahan F. Kolon kanserinde apoptozis mekanizmalarında değişme: Tümör immün çatışmalarında fas direnci ve karşı saldırı. New York Bilimler Akademisi'nin Yıllıkları . 2000; 910 : 178-195. [ PubMed ] [ Google Akademik ]
      37. Gonçalves A., Braguer D., Carles G., André N., Korunmuş C., Briand C. İnsan kolon kanseri hücrelerinde paklitaksel kaynaklı apoptoz sırasında CD95 / CD95-L etkileşiminden bağımsız olarak kaspaz-8 aktivasyonu (HT29- D4) Biyokimyasal Farmakoloji . 2000; 60 (11): 1579-1584. doi: 10.1016 / S0006-2952 (00) 00481-0. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      38. Lacour S., Hammann A., Grazide S., vd. HT29 insan kolon kanseri hücrelerinin membran lipid sallarına sisplatin kaynaklı CD95 yeniden dağılımı. Kanser Araştırması . 2004; 64 (10): 3593-3598 sayılı belgeler. doi: 10.1158 / 0008-5472.CAN-03-2787. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      39. Laurent A., Nicco C., Chéreau C., Goulvestre C., Alexandre J., Alves A., Lévy E., Goldwasser F., Panis Y., Soubrane O., Weill B., Batteux F. reaktif oksijen türlerinin endojen üretimini modüle ederek tümör büyümesi. Kanser Araştırması . 2005; 65 (3): 948-956'da açıklanmaktadır. [ PubMed ] [ Google Akademik ]
      40. Alexandre J., Hu Y., Lu W., Pelicano H., Huang P. Paklitakselin kanser hücrelerine karşı yeni etkisi: reaktif oksijen türlerinin aracılık ettiği yan etki. Kanser Araştırması . 2007; 67 (8): 3512-3517. doi: 10.1158 / 0008-5472.CAN-06-3914 sayılı belgeler. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      41. Priego S., Feddi F., Ferrer P., Mena S., Benlloch M., Ortega A., Carretero J., Obrador E., Asensi M., Estrela JM Doğal polifenoller HT-29 kolorektal kanserinin ortadan kaldırılmasını kolaylaştırır kemoradyoterapiyle ksenograftlar: bir Bcl-2- ve süperoksit dismutaz 2'ye bağlı mekanizma. Moleküler Kanser Tedavisi . 2008; 7 (10): 3330-3342. doi: 10.1158 / 1535-7163.MCT-08-0363. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      42. Karlsson M., Kurz T., Brunk UT, Nilsson SE, Frennesson CI Oksidatif stres için yaygın olarak kullanılan DCF testi gerçekten ne gösterir? Biyokimyasal Dergisi . 2010; 428 (2): 183-190. doi: 10.1042 / BJ20100208. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      43. Lentz F., Tran A., Rey E., Pons G., Tréluyer J.-M. Kolorektal kanserin hepatik metastazlarında floroürasil, irinotekan ve oksaliplatin farmakogenomikleri: klinik uygulamalar. Amerikan Farmakogenomik Dergisi . 2005; 5 (1): 21-33. doi: 10.2165 / 00129785-200505010-00002. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      44. Arnould S., Hennebelle I., Kanal P., Bugat R., Guichard S. Kolon kanseri hücre hatlarında oksaliplatin duyarlılığının hücresel belirleyicileri. Avrupa Kanser Dergisi . 2003; 39 (1): 112-119. doi: 10.1016 / S0959-8049 (02) 00411-2 sayılı belgeler. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      45. Seetharam RN, Sood A., Basu-Mallick A., Augenlicht LH, Mariadason JM, Goel S. ERCC1 up-regülasyonu ile oluşturulan oksaliplatin direnci , insan kolorektal kanser hücrelerinde siRNA aracılı gen susturma ile ortadan kaldırılmıştır. Antikanser Araştırması . 2010; 30 (7): 2531 - 2538. [ PubMed ] [ Google Akademik ]
      46. Mallick AB, Seetharam R., Sood A., Mariadason J., Goel S. İnsan kolorektal kanser hücre hatlarında ilaç yanıtının bir biyolojik işareti olarak ERCC1'in uyarılabilir ifadesinin değerlendirilmesi. Uluslararası Klinik Onkoloji Dergisi . 2010; 28 (ek 15): 14048. [ Google Akademik ]
      47. Tsai M.-S., Weng S.-H., Kuo Y.-H., Chiu Y.-F., Lin Y.-W. Curcumin ve sisplatinin, timidin fosforilazının aşağı regülasyonu ve eksizyon onarımı çapraz-tamamlayıcı 1 (ERCC1) Moleküler Farmakoloji ile sinerjistik etkisi . 2011; 80 (1): 136-146. doi: 10.1124 / mol.111.071316. [ PubMed ] [ CrossRef ] [ Google Akademik ]
      48. Ko J.-C., Su Y.-J., Lin S.-T., Jhan J.-Y., Ciou S.-C., Cheng C.-M., Chiu Y.-F. , Kuo Y.-H., Tsai M.-S., Lin Y.-W. Emodin, ERCC1'in aşağı regülasyonu ve ERK1 / 2 inaktivasyonu ile sisplatin kaynaklı sitotoksisiteyi arttırır. Akciğer Kanseri . 2010; 69 (2): 155-164. doi: 10.1016 / j.lungcan.2009.10.013. [ PubMed ] [ CrossRef ] [ Google Akademik ]

      Yorum yap


      • #4
        Cat's Claw | Kedi Pençesi | Uncaria tomentosa


        Bu şifa ürünü Güney Amerika yağmur ormanları kökenlidir. Muhtemelen İnka medeniyetine kadar geriye giden bir dönem boyunca geleneksel şifa ürünü şeklinde kullanılmıştır. Günümüzde bilim adamları kedi pençesinin hastalıklarla mücadele edici etkilerini ve özellikle de gastroentestinal sağlığı destekleyici potansiyelini araştırmaktadırlar. Standardize edilmiş özü bitkinin kökünün kabuğundan elde edilmektedir.

        Bufotenin
        Molecular Formula : C12H16N2O
        Molecular Weight : 204,268 g/mol





        AKTİF BİLEŞENLERİ VE İNSAN VÜCUDU ÜZERİNDEKİ ETKİLERİ
        Kedi pençesi tahrişli veya enflamasyonlu dokuları tedavi etkisi gösterdikleri ve gastrointestinal yollar üzerinde zararlı bakteryal veya viral bulaşmaları ortadan kaldırdıkları rapor edilmiş bileşen maddeler içermektedir. Yürütülen çeşitli çalışmalarda bu bitkinin bağışıklık sistemini destekleyici işlevi üzerinde de durulmuştur. (1) Kedi pençesinin bazı temel bileşen maddeleri enfeksiyonla mücadele ve vücudun genel direncini teşvik etkileri açılarından da incelenmiştir. (2, 3, 4, 5)

        Kedi pençesinin bir antioksidan ajan olarak kanser tedavisinde kullanımı da araştırılmıştır. (6) Antioksidanlar vücutta anormal hücreler gelişmesine yol açan karsinojenik toksin birikimini azaltan maddelerdir. Gerçekleştirilmiş araştırmalar kedi pençesinin vücutta potansiyel kanserli hücreleri hedef alabildiğini ve yol açtığı çeşitli aktiviteler yoluyla bunların gelişmesini engelleyebildiğini göstermiştir. (7, 8, 9)

        Kedi pençesinin kılcal damarları güçlendirerek ve böylece vücudun her tarafında normal kan akışını kolaylaştırarak kardiyovasküler hastalıklar riskini azaltıcı rol oynayabildiğini de ortaya koymuşlardır. (10)

        Aktif romatizmal şikayetleri bulunan hastalarda ise kedi pençeğının anti-enflamatuar etkiler yarattığı gözlenmiştir. (11)

        KULLANIM ALANLARI
        • Bağışıklık sistemini güçlendirmeye ve düzenlemeye yardımcı (1,2,3,4,5)
        • Enfeksiyonların önlenmesinde/tedavisinde yardımcı (2,3,4,5)
        • Kanserin önlenmesinde/tedavisinde yardımcı (6,7,8,9)
        • Romatizmal artrit sancılarını dindirmeye yardımcı (11)

        YAN ETKİLERİ

        Uygun dozaj esaslarına gore kullanıldığında bu diyet katkı maddesinin güvenli olduğu kabul edilmektedir. (15)
        Kullandığınız şifa katkı maddeleri konusunda doktorunuzu, eczacınızı veya diğer ilgili sağlık görevlilerini mutlaka bilgilendirmeniz büyük önem arz etmektedir. Ürünler arasında karşılıklı etkileşimler bulunması veya potansiyel yan etkiler herzaman mümkündür. Herhangi bir cerrahi müdahaleden veya diş ameliyatından geçmeyi planlıyor iseniz, bu diyet katkı maddesini kullanmayı en az 14 gün önceden durdurunuz. Alıcı sıfatıyla bir organ naklinden geçmiş iseniz, bir kanama rahatsızlığınız mevcut ise veya herhangi bir enfeksiyonla mücadele süreci içinde iseniz, bu diyet katkı maddesini kullanmaya başlamadan önce doktorunuza danışmanız gerekmektedir. (16, 17) Bu diyet katkı ürünü ile ishal hallerine sebebiyet verebilir veya bağırsak faaliyetlerinde diğer bazı değişiklikler gözlemlenebilir. (18) Bu yan etkilerin şiddetlenmesi veya geçmemesi halinde doktorunuzu bilgilendiriniz. Hamile iseniz veya bebek emziriyorsanız bu diyet katkı maddesini kullanmamalısınız. (19) Günümüze kadar mevcut tıbbi literatürde bu diyet katkı maddesinin çocuklar tarafından kullanımı ile özellikle bağlantılı herhangi bir ters etki rapor edilmemiştir. Ancak küçük yaştaki çocukların teşhis edilmemiş alerjileri veya tıbbi kondisyonları bulunabileceğinden, bir doktorun özel olarak önerdiği haller dışında, bu diyet katkı maddesi 10 yaşın altında çocuklar tarafından kullanılmamalıdır.

        REFERANSLAR
        1. Wagner H, et al. The Alkaloids of Uncaria tomentosa and Their Phagocytosis-stimulating Action. Planta Med. 1995;5:419-23.
        2. Jones K. Cat’s Claw: Healing Vine of Peru. Seattle: Sylvan Press; 1995:48-49.
        3. Aquino R, et al. New Polyhydroxylated Triterpenes from Uncaria tomentosa. J Nat Prod. 1990;53(3): 559-64.
        4. Lamm S, Sheng Y, Pero RW. Persistent response to pneumococcal vaccine in individuals supplemented with a novel water soluble extract of Uncaria tomentosa, C-Med-100. Phytomedicine. Jul2001;8(4):267-74.
        5. Lemaire I, Assinewe V, Cano P, Awang DV, Arnason JT. Stimulation of interleukin-1 and -6 production in alveolar macrophages by the neotropical liana, Uncaria tomentosa (una de gato). J Ethnopharmacol. Feb1999;64(2):109-15.
        6. Aquino R, et al. Plant Metabolites. Structure and in Vitro Antiviral Activity of Quinovic Acid Glycosides from Uncaria tomentosa and Guettarda platypoda. J Nat Prod. 1989;52(4):679-85.
        7. Wagner H, et al. The Alkaloids of Uncaria tomentosa and Their Phagocytosis-stimulating Action. Planta Med. 1995;5:419-23.
        8. Riva L, Coradini D, Di Fronzo G, De Feo V, De Tommasi N, De Simone F, Pizza C. The antiproliferative effects of Uncaria tomentosa extracts and fractions on the growth of breast cancer cell line. Anticancer Res. Jul2001;21(4A):2457-61.
        9. Sheng Y, Pero RW, Amiri A, Bryngelsson C. Induction of apoptosis and inhibition of proliferation in human tumor cells treated with extracts of Uncaria tomentosa. Anticancer Res. Sep1998;18(5A):3363-8.
        10. de Matta SM, et al. Alkaloids and Procyanidins of An Uncaria sp. from Peru. Farmaco. (Sci). 1976;31(7):527-35.
        11. Mur E, Hartig F, Eibl G, Schirmer M. Randomized double blind trial of an extract from the pentacyclic alkaloid-chemotype of uncaria tomentosa for the treatment of rheumatoid arthritis. J Rheumatol. Apr2002;29(4):678-81.
        12. Schauss AG. Cat’s Claw (Uncaria tomentosa). Nat Med J. 1998;1(2):16-19.
        13. Reinhard KH. Uncaria tomentosa (Willd.) D.C.: cat's claw, una de gato, or saventaro. J Altern Complement Med. Apr1999;5(2):143-51.
        14. American Herbal Products Association. Use of Marker Compounds in Manufacturing and Labeling Botanically Derived Dietary Supplements. Silver Spring, MD: American Herbal Products Association; 2001.
        15. Jones K. Cat’s Claw: Healing Vine of Peru. Seattle: Sylvan Press; 1995:48-49.
        16. Haginiwa J, et al. Studies of Plants Containing Indole Alkaloids. 2. On the Alkaloids of Uncaria rhynchophylla Miq. Yakugaku Zasshi. 1973;93(4):448-42.
        17. de Matta SM, et al. Alkaloids and Procyanidins of An Uncaria sp. from Peru. Farmaco. (Sci). 1976;31(7):527-35.
        18. Immodal Pharmaka. Krallendorn, Uncaria tomentosa (Wild), Root Extract: Report on Experiences with Probands. Immodal Pharmaka GmbH. 1996;20.
        19. Haginiwa J, et al. Studies of Plants Containing Indole Alkaloids. 2. On the Alkaloids of Uncaria rhynchophylla Miq. Yakugaku Zasshi. 1973;93(4):448-42.

        Yorum yap


        • #5
          kedinin pençesi, Telaffuz: CATS CLAW

          Kedinin pençesi hakkında bilmem gereken en önemli bilgi nedir?

          Ürün etiketi ve ambalajındaki tüm talimatları izleyin. Her sağlık uzmanınıza tüm tıbbi durumlarınız, alerjileriniz ve kullandığınız tüm ilaçlar hakkında bilgi verin. Kedinin pençesi nedir?

          Kedinin pençesi, aynı zamanda Griffe Du Chat, Liane du Pérou, Peru'nun Hayat Veren Asma, Samento, Uña De Gato olarak da bilinen bir bitkidir. Kedi pençesi, alternatif tıpta artrit tedavisinde muhtemelen etkili bir yardımcı olarak kullanılmıştır . Osteoartrit veya romatoid artritli insanlar kedi pençesini kullandılar. Her bir artrit tipini tedavi etmek için kedinin pençesinin farklı formları spesifik olabilir. Hangi formun kullanılacağı hakkında sağlık uzmanınızın talimatlarını izleyin. Araştırmalarla kanıtlanmamış diğer kullanımlar arasında mide ve bağırsak bozuklukları, hemoroidler, kronik yorgunluk sendromu, uçuk, zona, suçiçeği, saman nezlesi ve diğer birçok durum vardır. Kedinin pençesinin herhangi bir tıbbi durumun tedavisinde etkili olup olmadığı kesin değildir. Kedinin pençesinin tıbbi kullanımı FDA tarafından onaylanmamıştır. Kedinin pençesi, doktorunuz tarafından sizin için reçete edilen ilaç yerine kullanılmamalıdır. Kedinin pençesi genellikle bitkisel bir takviye olarak satılmaktadır. Birçok bitkisel bileşik için düzenlenmiş üretim standartları yoktur ve pazarlanan bazı takviyelerin toksik metaller veya diğer ilaçlarla kontamine olduğu bulunmuştur. Kontaminasyon riskini en aza indirmek için bitkisel / sağlık takviyeleri güvenilir bir kaynaktan satın alınmalıdır. Cat'in pençesi, bu ürün kılavuzunda listelenmemiş amaçlar için de kullanılabilir. Kedi pençesini almadan önce sağlık uzmanımla neler konuşmalıyım?

          Aşağıdaki durumlarda bu ürünü kullanmanızın güvenli olup olmadığını doktorunuza, eczacınıza veya başka bir sağlık uzmanına sorun.
          • multipl skleroz, lupus veya sedef hastalığı gibi bir otoimmün bozukluk;
          • lösemi; veya
          • düşük kan basıncı.

          Hamileyseniz kedinin pençesini kullanmayın. Doğmamış bebeğe zarar verebilir. Etkili doğum kontrolü kullanın ve tedavi sırasında hamile kalırsanız doktorunuza bildirin. Kedinin pençesinin anne sütüne geçip geçmediği veya emziren bir bebeğe zarar verip vermeyeceği bilinmemektedir.
          Bu ürünü kullanırken emzirmemelisiniz.
          Tıbbi tavsiye almadan bir çocuğa bitkisel / sağlık takviyesi vermeyin. Kedinin pençesini nasıl almalıyım?

          Bitkisel takviyelerin kullanımını düşünürken, doktorunuza danışın. Bitkisel / sağlık takviyeleri kullanımı konusunda eğitim almış bir uygulayıcıya danışmayı da düşünebilirsiniz. Kedinin pençesini kullanmayı seçerseniz, paketi pakette veya doktorunuz, eczacınız veya başka bir sağlık uzmanı tarafından belirtildiği şekilde kullanın. Bu üründe etikette tavsiye edilenden daha fazla kullanmayın. Tıbbi tavsiye almadan aynı zamanda kedinin pençesinin farklı formlarını (tabletler, sıvı, tentür, çaylar, vb.) Kullanmayın. Farklı formülasyonların birlikte kullanılması aşırı doz riskini artırır. Ameliyata ihtiyacınız varsa, kedinin pençesini en az 2 hafta önceden almayı bırakın. Kedinin pençesi ile tedavi ettiğiniz durum düzelmezse veya bu ürünü kullanırken daha da kötüleşirse doktorunuzu arayın. Oda sıcaklığında ısı ve nemden uzak bir şekilde saklayınız. Bir dozu kaçırırsam ne olur?
          Bir sonraki programlı dozunuzun neredeyse zamanı gelmişse, kaçırılan dozu atlayın. Etmeyin Unuttuğunuz dozu telafi etmek için ekstra kedi tırnağı kullanın.


          Aşırı doz alırsam ne olur?

          Acil tıbbi yardım isteyin veya 1-800-222-1222 numaralı telefondan Zehir Yardım hattını arayın. Kedinin pençesini alırken nelerden kaçınırım?
          Kazein proteini, koenzim Q-10 (ubikinon), balık yağı, L-arginin, lycium veya ısırgan otu gibi diğer bitkisel / sağlık takviyeleri almaktan kaçının. Kedinin pençesini bu maddelerden herhangi biriyle birleştirmek, kan basıncınızın çok düşmesine neden olabilir.


          Kedinin pençesinin olası yan etkileri nelerdir?

          Bu alerjik reaksiyon belirtilerinden herhangi birine sahipseniz acil tıbbi yardım alın : kurdeşen; zor nefes alma; yüzünüzün, dudaklarınızın, dilinizin veya boğazınızın şişmesi. Tüm yan etkiler bilinmemekle birlikte, kedinin pençesinin kısa bir süre için alındığında muhtemelen güvenli olduğu düşünülmektedir.

          Yaygın yan etkiler şunları içerebilir:
          • baş dönmesi;
          • baş ağrısı; veya
          • kusma.

          Bu, yan etkilerin tam bir listesi değildir ve diğerleri oluşabilir. Yan etkiler hakkında tıbbi tavsiye için doktorunuzu arayın. Yan etkileri 1-800-FDA-1088'de FDA'ya bildirebilirsiniz. Başka hangi ilaçlar kedinin pençesini etkileyecek?
          Aşağıdaki durumlardan herhangi birini tedavi etmek için bir ilaç kullanıyorsanız, kedinin pençesini tıbbi tavsiye almadan almayın :


          • her türlü enfeksiyon (HIV, sıtma veya tüberküloz dahil);
          • kaygı veya depresyon;
          • astım veya alerji;
          • kanser;
          • erektil disfonksiyon;
          • mide ekşimesi veya GÖRH;
          • yüksek tansiyon, yüksek kolesterol veya kalp rahatsızlığı;
          • migren baş ağrıları;
          • sedef hastalığı, romatoid artrit veya diğer otoimmün bozukluklar;
          • bir psikiyatrik bozukluk; veya
          • nöbetler.
          Kullandığınız diğer tüm ilaçlar ve kedinin pençesi ile tedaviniz sırasında kullanmaya başladığınız veya kullanmayı bıraktığınız ilaçlar hakkında doktorunuza söyleyin, özellikle:
          • doğum kontrol hapları veya hormon replasman tedavisi; veya
          • organ nakli reddini önlemek için kanser ilacı, steroidler ve ilaçlar gibi bağışıklık sistemini zayıflatan ilaçlar.
          Bu liste tamamlanmadı. Diğer ilaçlar reçeteli ve reçetesiz satılan ilaçlar, vitaminler ve bitkisel ürünler de dahil olmak üzere kedi pençesi ile etkileşime girebilir. Olası etkileşimlerin tümü bu ilaç kılavuzunda listelenmemiştir. Daha fazla bilgiyi nereden alabilirim?

          Herhangi bir bitkisel / sağlık takviyesi kullanmadan önce lisanslı bir sağlık uzmanına danışın. İster bir tıp doktoru, isterse doğal ilaçların / takviyelerin kullanımı konusunda eğitim almış bir uygulayıcı tarafından tedavi olun, tüm sağlık uzmanlarınızın tüm tıbbi durumlarınız ve tedavilerinizi bildiğinden emin olun.
          Unutmayın, bu ve diğer tüm ilaçları çocukların erişemeyeceği yerlerde saklayın, ilaçlarınızı asla başkalarıyla paylaşmayın ve bu ilacı sadece belirtilen endikasyon için kullanın.

          Cerner Multum, Inc. ('Multum') tarafından sağlanan bilgilerin doğru, güncel ve eksiksiz olmasını sağlamak için her türlü çaba gösterilmiştir, ancak bu konuda hiçbir garanti verilmemektedir. Burada bulunan ilaç bilgileri zamana duyarlı olabilir. Multum bilgileri, ABD'deki sağlık pratisyenleri ve tüketicileri tarafından kullanılmak üzere derlenmiştir ve bu nedenle Multum, aksi belirtilmedikçe, Amerika Birleşik Devletleri dışındaki kullanımların uygun olduğunu garanti etmez. Multum'un ilaç bilgileri ilaçları onaylamaz, hastaları teşhis etmez veya tedavi önermez. Multum'un ilaç bilgileri, lisanslı sağlık hizmeti uygulayıcılarının hastalarına bakmalarına yardımcı olmak ve / veya bu hizmeti uzmanlık, beceri, sağlık pratisyenlerinin bilgisi ve yargısı. Belirli bir ilaç veya ilaç kombinasyonu için hiçbir uyarının bulunmaması, ilaç veya ilaç kombinasyonunun herhangi bir hasta için güvenli, etkili veya uygun olduğunu gösterecek şekilde yorumlanmamalıdır. Multum, Multum'un sağladığı bilgiler yardımıyla sağlık hizmetlerinin herhangi bir yönü için herhangi bir sorumluluk kabul etmez. Burada yer alan bilgilerin olası tüm kullanımları, talimatları, önlemleri, uyarıları, ilaç etkileşimlerini, alerjik reaksiyonları veya yan etkileri kapsaması amaçlanmamıştır. Aldığınız ilaçlar hakkında sorularınız varsa doktorunuza, hemşirenize veya eczacınıza danışın. herhangi bir hasta için etkili veya uygun. Multum, Multum'un sağladığı bilgiler yardımıyla sağlık hizmetlerinin herhangi bir yönü için herhangi bir sorumluluk kabul etmez. Burada yer alan bilgilerin olası tüm kullanımları, talimatları, önlemleri, uyarıları, ilaç etkileşimlerini, alerjik reaksiyonları veya yan etkileri kapsaması amaçlanmamıştır. Aldığınız ilaçlar hakkında sorularınız varsa doktorunuza, hemşirenize veya eczacınıza danışın. herhangi bir hasta için etkili veya uygun. Multum, Multum'un sağladığı bilgiler yardımıyla sağlık hizmetlerinin herhangi bir yönü için herhangi bir sorumluluk kabul etmez. Burada yer alan bilgilerin olası tüm kullanımları, talimatları, önlemleri, uyarıları, ilaç etkileşimlerini, alerjik reaksiyonları veya yan etkileri kapsaması amaçlanmamıştır. Aldığınız ilaçlar hakkında sorularınız varsa doktorunuza, hemşirenize veya eczacınıza danışın.

          Telif Hakkı 1996-2019 Cerner Multum, Inc. Sürüm: 1.05. Revizyon tarihi: 10/9/2014.

          Yorum yap


          • #6
            Cats Claw Bitkisi Neden Kullanılır?

            Cats Claw (Kedi pençesi), Güney Amerika ve Asya’daki yağmur ormanlarında yetişen tropik bir asma çeşididir. Bazı kültürler, bu çiçeğe “Yağmur Ormanlarının Kutsal Çiçeği” adını vermiştir.
            Bitki, Peru’da, değerli bir tıbbi kaynak olarak görülmekte ve korunmaktadır.
            Bitki ile ilgili başlatılan bilimsel araştırmalar sonuçlarını yeni yeni verse de, Güney Amerika yağmur ormanlarındaki bir çok yerli kültür bu bitkiyi yüzlerce yıldır kullanmaktadır.

            Cats Claw Bitkisi ve Araştırmalar

            • Cats Claw’ın kök kabuğunun medikal etkisinin yanı sıra, kökün kendisi kabuğundan 3-4 kat daha etkilidir. Cats Claw’daki aktif içerikler oldukça çeşitlidir; bitkinin hasat zamanı ile de fazlasıyla ilintilidir.

            • Cats Claw’ın ( Uncaria tomentosa ) aktif içerikleri arasında, alkaloidler, triterpenler, fitosteroller ve proantosiyanidinler bulunmaktadır. Araştırmacılar kabuk ve kökteki, beyaz kan hücrelerinin aktivitesini artırarak bağışıklık sistemini aktive eden eşsiz alkaloidleri izole etmişlerdir. İzole edilen alkaloidlerden biri olan rynchophylline, kalp ritmini ve kan basıncını düşürüp, dolaşımı arttırarak kalp krizi ve felç riskini azaltmaya yarayan antihipertansif özelliklere sahiptir.

            • Bir çok laboratuar ve hayvanlar üzerindeki çalışmalar, Cats Claw’ın enflamasyonu düşürdüğünü göstermiştir. Bu da araştırmaların Cats Claw ve romanoid artrit gibi hastalıklar üzerinde çalışılmasına sebep olmuştur. 1991’de yapılan bir araştırmada bitkinin içinde kendiliğinden meydana gelen glikosid-7 adlı maddenin şimdiye dek tespit edilen en aktif doğal antienflamatuar olduğu belirtilmiştir.

            • Küçük bir ön çalışma; yüksek ölçüde saflaştırılmış Cats Claw ekstresinin, eklemleri yumuşatmak için reçeteli ilaçlar olan sülfasalazin veya hidroksiklorokin alan aktif romatoid artritli hastalarda makul yararlar sağladığını göstermiştir. Ancak Cats Claw ve plasebo karşılaştırmasını gösteren, insanlar üzerinde yapılacak, geniş ve büyük çalışmalara gereksinim vardır.

            • Cats Claw’ın beyin ile olan ilişkisini irdeleyen bir çalışma da Ulusal Yaşlanma Enstitüsü tarafından yapılan bir araştırmada incelenmiştir. Bulgular Alzheimer hastalığının tedavisinde yeni yollar açabilir.

            Nasıl Kullanılır?

            % 3 alkaloidler ve % 15 fenol içeren standardize kök ve ağaç kabuğu özü kullanılır. Bağışıklık sistemini desteklemek için önerilen doz 250 – 350 mg’dır.

            Yan Etkileri Var mı?

            Nadiren de olsa baş ağrısı, baş dönmesi ve kusma görülebilir. Kan basıncı düşük olanlar, lösemi, tüberküloz, Otoimmün hastalıklar ve organ nakli olan kişilere önerilmiyor. Ayrıca herhangi bir hastalık için ilaç tedavisi görenler, hamile ve emziren kadınlar doktor onayı olmadan kullanmamalıdır.

            AC-11 Nedir?

            AC-11; Cat’s Claw bitkisinin alkaloid içermeyen, %8 karboksi alkil ester (CAE) içeren özel bir ekstresidir. Bilim adamları yaptıkları araştırmalarda “AC-11″ maddesinin oksidasyona ve UV ışınlarına bağlı DNA hasarını azalttığını ve DNA tamir kapasitesini de artırdığını tespit etmişlerdir.

            AC-11’in Etkileri

            • DNA hasarına karşı doğal DNA onarım kapasitesini artırır.

            • Bağışıklık sistemini destekler.

            • Tümör oluşumunu baskılamaya yardım eder.

            • Anti-enflamatuar özelliğe sahiptir.

            Bağışıklık sistemini destekleyici etkisi, DNA onarıcı, anti-tümör ve Anti-enflamatuvar özelliği uluslararası dergilerde yayınlanmıştır. Amerikan Gıda ve İlaç Dairesi FDA, AC-11’in DNA hasarının tamir yeteneğini artıran özelliğinin tanıtımda yer almasına izin vermiştir.

            AC-11’in formüle edilim yöntemi, DNA üzerinde uzman bilim adamı Ronald W. Pero Ph.D tarafından keşfedilmiştir.

            Yorum yap


            • #7
              Uncaria Tomentosa
              • kullanımlar
              • Yan etkiler
              • Yorumlar
              • Önlemler
              • Etkileşimler
              • Kontrendikasyonlar
              Genel Bakış
              Uncaria Tomentosa, Iltihap, Doğum kontrolü, Kanser, Viral enfeksiyonlar, Bağışıklık geliştirir, Alzheimer hastalığı, Artrit, Divertikülit, Peptik ülserler, Kolit gibi hastalıkların tedavisinde ve diğer durumlarda endikedir. Uncaria Tomentosa ürününün kullanımına, yan etkilerine, ürünle ilgili yorumlara, sorulara, etkileşimlere ve önlemlere ilişkin detaylı bilgiler aşağıdaki gibidir: kullanımlar

              Uncaria Tomentosa, aşağıdaki hastalıkların, durumların ve semptomların tedavisinde, kontrol altına alınmasında, önlenmesinde & iyileştirilmesinde kullanılır:
              • Iltihap
              • Doğum kontrolü
              • Kanser
              • Viral enfeksiyonlar
              • Bağışıklık geliştirir
              • Alzheimer hastalığı
              • Artrit
              • Divertikülit
              • Peptik ülserler
              Kullanımlar Uncaria Tomentosa Yan etkiler

              Uncaria Tomentosa - Sıkça Sorulan Sorular
              • Uncaria Tomentosa, doğum kontrolü ve iltihap tedavisinde kullanılabilir mi?
                Evet, doğum kontrolü ve iltihap, Uncaria Tomentosa ilacının en sık bildirilen kullanım nedenlerindendir. Lütfen Uncaria Tomentosa ilacını, önce doktorunuza danışmadan doğum kontrolü ve iltihap için kullanmayınız. Diğer hastaların Uncaria Tomentosa hakkında neler dediğini öğrenmek için Burayı tıklayın ve anket sonuçlarını görüntüleyin.
              • Bu ürünü kullanırken ağır makineleri sürmek veya kullanmak güvenli midir?
                Eğer, Uncaria Tomentosa kullanırken uyuşukluk, baş dönmesi, hipotansiyon (tansiyon düşüklüğü) ya da baş ağrısı gibi yan etkiler yaşıyorsanız, araba sürmeniz ve/veya iş makinesi kullanmanız güvenli olmayabilir. Eğer kullanılan ilaç sizde uyuşukluk, baş dönmesi meydana getiriyor ya da kan basıncınızı düşürüyorsa, araç kullanmamalısınız. Ayrıca, alkol uyuşukluk gibi yan etkileri yoğunlaştırdığı için, eczacılar hastalara ilaçla birlikte alkol almamalarını tavsiye ederler. Lütfen Uncaria Tomentosa kullanırken bu etkileri vücudunuzda gözlemleyiniz. Vücudunuza ve sağlık durumunuza özel tavsiyeler için daima doktorunuza danışın.
              • Bu ilaç ya da ürünün, bağımlılık yapıcı ya da alışkanlık oluşturucu özelliği var mıdır?
                Birçok ilaç, bağımlılık yapıcı ya da kötüye kullanıma açık bir şekilde piyasaya sürülmemektedir. Genellikle bakanlıklar, ilaçları, denetime tabi bağımlılık yapıcı olanlar ve olmayanlar şeklinde kategorize eder. Örneğin, Hindistan'da bu sınıflandırma H ve X, ABD'de ise II ve V şeklindedir. Lütfen, ilacın bu tür özel bir sınıflandırmaya ait olup olmadığından emin olmak için kutusunu kontrol edin. Son olarak, bir doktor tavsiyesi olmadan, kendi kendinize tedavi olmaya çalışmayın ve vücudunuzun bağımlılığını arttırmayın.
              • Bu ürünü hemen kullanmayı bırakabilir miyim yoksa yavaş yavaş kullanımdan kurtulmuş muyum?
                Bazı ilaçlar azaltılarak bırakılmalıdır ya da yoksunluk etkisi yaşanmaması için kullanımı birden kesilmemelidir. Vücudunuza, sağlık durumunuza özel tavsiyeler ve kullanabileceğiniz diğer ilaçlar için doktorunuza danışın.
              Uncaria Tomentosa hakkındaki diğer önemli bilgiler

              Doz almayı unutmak

              Eğer bir doz ilaç almayı unuttuysanız, fark eder etmez kullanın. Eğer sonraki doz zamanınıza çok yakınsa, almayı unuttuğunuz dozu bırakın ve doz takviminize bağlı kalın. Unuttuğunuz dozu tedavi etmek için ekstra doz almayın. Eğer dozlarınızı düzenli olarak unutuyorsanız, bir alarm kurun ya da bir aile bireyinizden size hatırlatmasını isteyin. Lütfen, doz takviminizde değişiklik yapmak ya da yakın zaman da çok sayıda doz unuttuysanız, almayı unuttuğunuz dozları telafi için doktorunuza danışın.

              Uncaria Tomentosa doz aşımı
              • Reçetedeki dozdan fazla kullanmayın. İlacı daha fazla tüketmek semptomlarını iyileştirmez; aksine, zehirlenmeye ya da ciddi yan etkilere neden olabilir. Sizin ya da bir yakınınızın aşırı dozda Uncaria Tomentosa kullandığından şüpheleniyorsanız, lütfen en yakın hastanenin acil servisinizi ziyaret edin. Doktorlara yardım etmek için, ilaç kutusu, şişesi ya da etiketi gibi gerekli bilgileri beraberinizde götürün.
              • Aynı duruma sahip olduklarını bilseniz ya da benzer durumlar varmış gibi görünse bile, ilaçlarınızı bir başkasına vermeyin. Bu durum aşırı doza sebep olabilir.
              • Daha fazla bilgi için, eczacınıza danışın ya da prospektüsü kontrol edin.
              Uncaria Tomentosa saklanması
              • İlaçları oda sıcaklığında saklayın, sıcaktan ve ışıktan uzak tutun. Prospektüste yazmadıkça ilaçları dondurmayın. İlaçları çocukların ve evcil hayvanların erişemeyeceği bir yerde saklayın.
              • Prospektüste böyle yapmanız söylenmedikçe ilaçları tuvalete ya da lavaboya dökmeyin. Bu şekilde atılan ilaçlar doğayı kirletebilir. Uncaria Tomentosa ilacını nasıl güvenle yok edeceğiniz konusunda lütfen doktorunuza ya da eczacınıza danışın.
              Süresi dolmuş Uncaria Tomentosa
              • Tek bir doz son kullanma tarihi geçmiş Uncaria Tomentosa kullanmak, muhtemelen istenmeyen bir duruma neden olacaktır. Uygun bir tavsiye için ya da kendinizi iyi hissetmiyorsanız, aile hekiminize ya da eczacınıza danışın. Son kullanma tarihi geçmiş ilaçlar, reçetenizdeki durumların tedavisinde verimli olmaz. Güvende kalabilmek için, son kullanma tarihi geçmiş ilaçlar kullanmamak çok önemlidir. Eğer, kalp rahatsızlığı, nöbetler ve yaşamı tehdit eden alerjiler gibi sürekli ilaç kullanmanızı gerektiren kronik bir hastalığınız varsa, süresi dolmuş ilaçların yerine hemen yenisini alabilmeniz için aile hekiminizle temasta kalmak çok daha önemlidir.
              Dozaj Bilgisi

              Lütfen doktorunuza ya da eczacınız danışın ya da prospektüsü okuyun.

              Bu sayfayı Cite

              APA Style CitationMLA Style Citation
              • "Uncaria Tomentosa - Kullanımlar, Yan Etkiler, Yorumlar, Önlemler - TabletWise" Tabletwise.com. N.p., n.d. Web. 05 Nov. 2019.
              Chicago Style Citationİlgili Linkler
              • doğum kontrolü tedavisinde Uncaria Tomentosa
              • iltihap tedavisinde Uncaria Tomentosa
              Uncaria Tomentosa hakkında daha fazla
              • Kullanımlar
              • Yan etkiler
              • Etkileşimler
              • Kontrendikasyonlar
              • Önlemler
              • Yorumlar
              • Sorular

              Yorum yap


              • #8
                Uncaria tomentosa - Meme Kanseri için Adjuvan Tedavi: Klinik Çalışma

                Maria do Carmo Santos Araújo , 1, 2 Iria Luiza Farias , 1, 2 Jessie Gutierres , 1 Sergio L. Dalmora , 3, 4 Nélia Flores , 2 Julia Farias , 1 Ivana de Cruz , 5 Juarez Chiesa , 2 Vera Maria Morsch , 1 ve Maria Rosa Chitolina Schetinger 1, *
                Yazar bilgileri Madde notları Telif Hakkı ve Lisans bilgileri Uyarı
                Bu makale PMC'deki diğer makaleler tarafından alıntılanmıştır .
                Şuraya git: Öz


                Meme kanseri dünya çapında kadınları en sık etkileyen neoplazmdır. Önerilen tedavilerin bazıları toksik etkileri lökopeni ve nötropeni içeren kemoterapiyi içerir. Bu çalışma Uncaria tomentosa'nın etkinliğini değerlendirdi(Ut) randomize klinik bir çalışma ile kemoterapinin olumsuz etkilerini azaltmada. İnvaziv Duktal Karsinomlu Hastalar — FAC (Fluorourasil, Doksorubisin, Siklofosfamid) olarak bilinen bir tedavi rejimi uygulanan Evre II iki gruba ayrıldı: UtCa kemoterapi artı 300 mg kuru Ut ekstresi ve sadece alınan Ca grubu kemoterapi ve kontrol deneyi olarak görev yaptı. Altı kemoterapi döngüsü ve kan sayımı, immünolojik parametreler, antioksidan enzimler ve oksidatif stresin her birinden önce kan örnekleri toplandı. Uncaria tomentosa , kemoterapinin neden olduğu nötropeniyi azalttı ve ayrıca hücresel DNA hasarını geri yükleyebildi. Ut'un meme kanseri için etkili bir adjuvan tedavi olduğu sonucuna vardık.


                1. Giriş
                Meme kanseri, hem insidans hem de mortalite açısından dünya çapında kadınları en sık etkileyen neoplazmdır. Hastalık en sık görülme sıklığı İngiltere, Avustralya, ABD ve Kanada'da olan gelişmiş ülkelerde daha yaygındır. İnvaziv tümörlerden duktal karsinom ve varyantları vakaların% 80'ini temsil eder [ 1 ] ve klinik evre I ve II'de tümörlü kadınların oranı son on yılda% 41'den% 65'e yükselmiştir [ 1 , 2 ]. Meme kanserlerinin yaklaşık% 70'i Östrojen hormonu reseptörlerini ve / veya Progesteron reseptörünü eksprese eder [ 3 ]. Bu markerler HER-2 reseptörü (c-erbB2) ile birlikte tümör ve farklı tedavilere nasıl yanıt verebileceği hakkında bilgi sağlar [ 4 ].

                Kemoterapi, birden fazla ilaçla tek veya kombinasyon tedavisi olabilen meme kanseri için önerilen tedaviler arasındadır. Kemoterapi ilaçları normal dokularda seçici olmayan toksik etkiler açısından çok dar terapötik indekslere sahiptir, nötropeni en sık gözlenen advers reaksiyon olup enfeksiyon riskini artırır [ 5 ].

                Yan etkileri azaltan veya önleyen farmakolojik müdahalelerin kanser tedavisi üzerinde önemli bir etkisi olabilir. Dünya Sağlık Örgütü'ne (WHO) göre, nüfusun% 80'i tıbbi bitkileri hastalıklarının tedavisi için alternatif veya tamamlayıcı prosedürler olarak kullanmaktadır [ 6 ].

                Çalışmalar, kanser hastalarında kemoterapinin etkilerini en aza indirmek için bitkisel ilaçların kullanıldığını bildirmiştir. Uncaria tomentosa (Utor Cat's Claw), kanser de dahil olmak üzere farklı hastalıkların tedavisinde kullanılan tıbbi bir bitkidir. Kemoterapi ve radyasyon gibi geleneksel kanser tedavileri ile birlikte Cat's Claw kullanan hastalar bu tedavilere daha az yan etki bildirmişlerdir [ 7 ]. Kemoterapi ilaçlarının neden olduğu mutasyonları ve hücre hasarlarını önleyerek hücresel DNA'nın restorasyonunda yardımcı olur [ 8 ]. Bu, normal T ve B lenfositlerinin [çoğalması olarak, bağışıklık sisteminin etkinliğini modüle eden 9 ] da dahil olmak üzere, belli bazı sitokinlerin modüle, IL-1 ve IL-6, TNF-a α [ 10]. Ayrıca antioksidan özelliklere sahiptir [ 11 ]. Miyelopoez uyarımı ve Koloni Uyarıcı Faktörler (G-CSF) yoluyla doğrudan miyelostimülatör etkileri [ 8 , 12 ], nötropeni ile ilişkili riskleri en aza indirmek için yararlı bir seçenek gibi görünmektedir.

                Çok sayıda rapor Ut eylem mekanizmalarının teorik bir anlayışını sunar, ancak bu çalışmaların hiçbiri klinik çalışmalardan oluşmamıştır. Bu nedenle bu çalışmanın amaçları, meme kanseri için adjuvan tedavi olarak Uncaria tomentosa Herbaryum tabletleri kullanılarak yapılan klinik bir çalışmadan oluşan bu bağlamda yer almaktadır .

                2. Yöntemler
                2.1. Tasarım ve Hastalar
                Randomize girişimsel bir çalışma yapıldı. Histolojik olarak İnvaziv Duktal Karsinom - Evre II [ 2 ] olarak teşhis edilen ve altı döngü boyunca doksorubisin bazlı şema ile adjuvan kemoterapiye başlayacak 40 hasta ile gerçekleştirildi. Maria Üniversite Hastanesi, Brezilya.

                Hastalar rastgele iki gruba ayrıldı: altı kür kemoterapi + Ut ile tedavi edilen CaUt grubu ve tedavinin başladığı tarihe göre sadece altı kür kemoterapi alan kanser grubu (Ca) aşağıdaki gibidir: çalışmaya katılmayı kabul eden hasta CaUt grubuna, ikincisi Ca grubuna ve dolayısıyla arka arkaya sonuna kadar dahil edildi.

                Kontrol grubu, klinik çalışmalara göre sınıflandırılmış, benzer yaşta olan ve son 30 gün içinde herhangi bir ilaç almayan veya kronik hastalığı olan sağlıklı kadınlara katılmaya davet edildi.

                Hastalar, her biri 21 günlük 6 kemoterapi döngüsü sırasında çalışmanın bir parçasıydı. CaUt grubundaki ilaç dozajı şöyleydi: FAC (Fluorourasil, Doksorubisin ve Siklofosfamid) ve 3 tablet Ut (Unha de Gato Herbaryum), 2. günden 21. güne günlük olarak benzerdi. sulu Ut ekstraktlarında 250-350 mg C-MED-100 ile yapılmış daha önceki çalışmalar [ 13 ].

                Randomize klinik çalışma için gerekli olan örneklem büyüklüğünü tahmin etmek için hesaplama Greenberg ve ark. [ 14 ], Sheng ve ark.'nın çalışmalarını referans alarak,% 5 sabit anlamlılık seviyesi ( α ) ve% 90 ( stat % 10) istatistik gücü ile . [ 15 ].

                Brezilya'daki Santa Maria Üniversite Hastanesi İnsan Etiği Komitesi bu çalışmayı onayladı ve tüm katılımcılardan bilgilendirilmiş olur alındı ​​(protokol numarası: 0169.0.0242.000-07.). Tüm denekler katılmaya davet edildi ve araştırmacı ve katılımcılar tarafından imzalanan bir Onay Beyanı ile bu çalışmanın tasarımı hakkında detaylı olarak bilgilendirildi. Ca veya UtCa grubu için rastgele seçilebilecekleri konusunda bilgilendirildiler.

                2.2. Malzemeler
                Unha de Gato Herbaryum'un her bir tabletinde 100 mg kuru Uncaria tomentosa özü bulunur. Tabletlerde kullanılan biyolojik malzemeler doğal ortamlarındaki bitkilerden elde edildi. Uncaria tomentosa özü% 70 etanol kullanılarak zemin kabuğundan Ultra-Turrax Ekstraksiyon (BIOTRON, Kinematica AG) (Centroflora) (Dipalcool) hazırlandı. Ut kuru ekstraktın HPLC analizi, mitrafilinin harici kalibrasyon eğrileri referans alınarak hesaplanan% 2.57 pentasiklik oksindol alkaloid (POA) içeriği sunar. Ekstrakt analizi, örnekte tetrasiklik oksindol alkaloitlerinin bulunmadığını gösterdi, bu da ABD Farmakopesine uygun olarak terapötik ve araştırma amaçlı kullanılmasına izin verdi.

                2.3. Örnek koleksiyon
                Kan, sitrat, EDTA, heparin Vacutainer tüplerine, antikoagülan olmadan, kemoterapiden önce ve 6 döngünün her birinden sonra toplandı.

                2.4. Biyokimyasal Parametreler
                Kan kimyasal bileşenlerinin kantitatif tayini için bir COBAS INTEGRA sistemi kullanıldı ve veriler bir COBAS INTEGRA 400 Plus cihazı (ABD) aracılığıyla elde edildi.

                2.5. hemogramları
                Kan örnekleri bir Pentra aparatı (Fransa) kullanılarak analiz edildi. En düşük değerler, bir May Grünwald-Giemsa Lekesi ve optik mikroskopi kullanılarak slaytların gözlemlenmesi ile doğrulanmıştır.

                2.6. CD3 +, CD4 + ve CD8 + Hücreleri
                Örnekler EDTA içinde toplandı ve analizler üç renkli bir flüoresanla aktive edilen hücre sıralayıcısı (FACSCalibur, Becton Dickinson Biosciences, Amerika Birleşik Devletleri) ve bir Multiset yazılımı (Becton Dickinson) kullanılarak yapıldı. FITC ile konjüge edilmiş anti-CD4, PE ile konjüge edilmiş anti-CD8 ve PerCP ile konjüge edilmiş anti-CD3 kullanıldı. Bağışıklık alt popülasyonları, toplam CD3 + hücre sayısının yüzdesi olarak ölçüldü.

                2.7. İnterlökin 6 (IL-6)
                IL-6'nın ELISA tahlilleri, daha önce yayınlanmış bir yönteme [ 16 ] göre, Microtiter 96-Kuyucuklu Plakalar (Nunc-Immuno Plaka MaxiSorp) ve optik yoğunluklarda (OD) 490 nm'de oda sıcaklığında gerçekleştirildi; Mikroplaka Okuyucu (Thermo Scientific Multiskan FC, Vantaa, Finlandiya).

                2.8. Tek Hücreli Jel Elektroforezi (Kuyruklu Yıldız Tayini)
                Alkalin kuyruklu yıldız deneyi, Singh ve ark. [ 17 ] kuyruklu yıldız tahlilinin genel kullanım kılavuzuna uygun olarak [ 18 , 19 ]. Lenfositler, 37 ° C'de% 0.7 düşük erime noktalı agaroz ve fosfat tamponlu salin (PBS) içerisinde süspanse edildi ve% 1 agaroz tabakası ile mikroskobik slaytlar üzerine yerleştirildi. Slaytlar, 1 saat boyunca 4 ° C'de lizis çözeltisine daldırıldı ve ardından sabit sıcaklıkta 40 dakika boyunca 25 V, 300 mA'da elektroforez takip edildi. Slaytlar daha sonra Nadin ve ark. [ 20]. Numune toplamadan elektroforeze kadar tüm aşamalar, hücresel DNA hasarı olasılığını en aza indirmek için sarı ışık altında gerçekleştirildi. Yüz hücre (iki kopya sürgünün her birinden 50 hücre) seçildi ve analiz edildi. Hücreler kuyruk uzunluğuna göre görsel olarak skorlandı ve 0 (migrasyon yok) ila 4 (maksimal migrasyon) skorları aldı. Bu nedenle, hücreler için hasar endeksi 0 (göçü olmayan tüm hücreler% 0 hasar endeksini temsil eder) ile 400 (maksimum göçü olan tüm hücreler% 100 hasar endeksini temsil eder) arasında değişmektedir. Slaytlar kör koşullar altında en az iki farklı birey tarafından analiz edildi [ 21 ]. 2.9. Serum Proteinin karbonillenmesi


                Serum proteinlerinin karbonilasyonu modifiye edilmiş Levine yöntemi ile belirlendi [ 22 ]. Süpernatanın 370 nm'de absorbansı bir spektrofotometre kullanılarak ölçüldü. Karbonil muhtevası, molar sönme katsayısı olarak 22 x 10 3  mM- 1  cm- 1 kullanılarak hesaplandı ve sonuçlar, miligram proteini başına nanomol karbonil grubu olarak ifade edildi.

                2.10. Lipid Peroksidasyonunun Belirlenmesi
                Lipid peroksidasyonu, plazma numunelerindeki TBARS seviyelerinin modifiye edilmiş bir Jentzsch ve ark. [ 23 ]. Malondialdehid (MDA) konsantrasyonu, bir spektrofotometre kullanılarak 532 nm'de absorbans ölçülerek belirlendi. Sonuçlar, mililitre plazma başına nanomol MDA olarak ifade edildi.

                2.11. Katalaz (CAT) ve Süperoksit Dismutaz (SOD) Faaliyetleri
                CAT aktivitesi, Nelson ve Kiesow'un modifiye edilmiş bir yöntemine göre belirlendi [ 24 ]. 240 nm'de absorbanstaki değişiklik 2 dakika boyunca ölçüldü. CAT aktivitesi, molar sönme katsayısı (0.046 mM- 1  cm- 1 ) kullanılarak hesaplandı ve sonuçlar, miligram protein başına CAT pikomolleri olarak ifade edildi.

                SOD aktivitesi, McCord ve Fridovich tarafından tarif edildiği gibi adrenalin ile radikal süperoksit reaksiyonunun inhibisyonuna dayanılarak belirlendi [ 25 ]. SOD aktivitesi, glisin-NaOH (50 mM, pH 10) ve adrenalin (1 mM) içeren bir ortamda 480 nm'de gözlenen adrenokrom oluşum hızının ölçülmesiyle belirlenir.

                2.12. İstatistik
                Sonuçlar ortalama ± standart sapma olarak ifade edildi. İstatistiksel analiz, Student t testi kullanılarak Graph-Pad Prism 5.0 (GraphPad Prism 5.0 Software Inc., ABD) ile yapıldı . Tüm testlerde p <0.05'in anlamlı bir fark olduğu düşünüldü.

                3. Sonuçlar
                Çalışmaya dahil edilen tüm hastalarda (40) Amerikan Ortak Kanser Komitesi (AJCC) ve Amerikan Kanser Derneği (ACS) evreleme sistemlerine göre Meme Kanseri, İnvaziv Duktal Karsinom — Aşama II A veya II B vardı [ 2 ].

                Çalışmaya katılan hastaların ve kontrollerin genel özellikleri Tablo 1'de açıklanmıştır .

                tablo 1

                Hastaların klinik özellikleri. Yaş, vücut kitle indeksi (BMI), toplam kolesterol seviyeleri, östrojen reseptörü (ER) ve progesteron reseptörlerini (PR) ve ayrıca farklı gruplarda HER-2 durumunu temsil eder.
                Yaş aralığı 32-79 32-71 40-75
                Ortalama yaş 56.5 ± 11.6 55.0 ± 9.7 54.4 ± 11.0
                BMI 25.0 ± 1.93 27,27 ± 1,49 26.82 ± 5.03
                Kolesterol seviyeleri 202.5 ± 1.90 238.9 ± 57.9 244.2 ± 44.5
                Östrojen reseptör durumu (ER)
                 Pozitif - 14 17
                 Olumsuz - -6 -3
                Progesteron reseptör durumu (PR)
                 Pozitif - 10 11
                 Olumsuz - -10 -9
                HER-2 reseptör durumu (HER2)
                 Pozitif - 2 6
                 Olumsuz - -16 -12
                ER, HER2 ve REP sonuçları, reseptörlerin kadın sayısına göre ekspresyonu için pozitif ve negatif sayılar olarak temsil edilirken, diğer parametreler ortalama ± standart sapma olarak ifade edilir. UtCa grubu: kemoterapi ile tedavi edilen hastalar günlük +300 mg Uncaria tomentosa ( n = 20); Ca grubu: kemoterapi alan hastalar ( n = 20); kontrol grubu ( n = 20).

                * HER-2 alıcısı için tek bir veri 18 hastadan elde edildi.

                Meme kanseri için adjuvan tedavi olarak Ut'un etkinliğini değerlendirmek için hematolojik parametreler kullanıldı ve analiz edildi ( Tablo 2 ). Sıfırıncı günde, kan sayımında analiz edilen hematolojik parametrelerin sonuçları Kontrol, Ca ve UtCa grupları arasında önemli ölçüde farklılık göstermemiştir. Beyaz kan hücresinde (WBC) ve nötrofil sayımlarında, tedavi grubunda Ca grubunda, kontrol grubunda elde edilen referans değerlere yakın kalan UtCa grubundan farklı olarak daha büyük bir azalma gözlendi ( Şekil 1 ). Lenfosit sayısı göz önüne alındığında, kontrol grubu ile kemoterapi döngülerinde Ut ile tedavi edilen veya edilmeyen meme kanseri hasta grupları arasında anlamlı bir fark gözlenmiştir. ( P<0.05). 5-6 kemoterapi döngüsünde meme kanseri (Ut ile tedavi edilen ve tedavi edilmeyen) hastalarda monosit sayısı kontrol grubundan daha yüksekti, ancak UtCa grubunda bu artış daha güçlü olmuştur ( Tablo 2 ).
                Resim, resim vb. İçeren harici bir dosya. Nesne adı ECAM2012-676984.001.jpg
                Şekil 1
                Uncaria tomentosa ve referans değerleri (kontrol) ile kemoterapi alan (UtCa) ve (Ca) takviyesi olmayan meme kanseri olan hastalarda nötrofil granülositlerine değer verir. Veriler ortalama ± standart sapma olarak ifade edildi. Tablo 2


                Meme kanseri hastalarında tedaviden önce ve Uncaria tomentosa beslemesi (Ca grubu) olmadan veya 300 mg / gün Uncaria tomentosa (UtCa grubu) olmadan 6 döngü kemoterapi sonrası lökositler, nötrofiller, lenfositler ve monosit seviyeleri .
                Lökositler
                 Kontrol 6800 ± 1458
                 Utca'ya 6800 ± 1458 7890 ± 1615 6636 ± 2578 5469 ± 1626
                 CA 6653 ± 1158 6617 ± 1504 4092 ± 1047 ∗ # 3247 ± 1117 ∗ #
                Nötrofiller
                 Kontrol 3510 ± 1077
                 Utca'ya 3496 ± 1108 4335 ± 1626 3937 ± 1992 4016 ± 1545
                 CA 3588 ± 1081 2663 ± 1351 * 2028 ± 512 ∗ # 1083 ± 368 ∗ #
                lenfositler
                 Kontrol 2264 ± 490,6
                 Utca'ya 2276 ± 503,3 2376 ± 708,1 1627 ± 578,7 1411 ± 596,6
                 CA 2177 ± 453,3 2284 ± 867,9 1460 ± 512,5 1208 ± 395,1
                Monositler
                 Kontrol 487,6 ± 128,9
                 Utca'ya 515,3 ± 169 560 ± 322 814,9 ± 309 # 817 ± 444,6
                 CA 541,6 ± 161 526,6 ± 154 654,1 ± 310 ∗ # 500,9 ± 226 ∗ #
                Veriler asmean ± standart sapma olarak ifade edildi.

                * Ca ve útca gruplar arasında anlamlı bir fark temsil P < 0.05 .

                # Kontrol grubunun anlamlı farkını gösterir, P < 0.05 (Student t- testi).

                Meme kanseri olan hastaların bağışıklık tepkisini değerlendirmek için CD4 + T hücreleri, CD8 + T hücreleri (mutlak sayım ve oran) ve IL-6 düzeyleri analiz edildi. Kemoterapi tedavi döngüleri sırasında gruplar arasında anlamlı bir fark gözlenmemiştir. Analiz edilen parametrelerin hiçbiri açısından gruplar arasında fark yoktu ( Tablo 3 ). Tablo 3


                Meme kanseri hastalarının tedaviden önce ve Uncaria tomentosa arzı (Ca grubu) olmadan veya 300 mg / gün Uncaria tomentosa (UtCa grubu) almadan 6 döngü kemoterapi sonrasında bağışıklık durumu .
                CD4 + T hücreleri Utca'ya 1008.25 (379.21) 786,60 (310,49)
                Hücreler / μ L CA 1053.00 (620.81) 798.00 (366.14)

                CD8 + T hücreleri Ut Ca 568,81 (295,60) 459.87 (246.46)
                Hücreler / μ L CA 679.84 (273.22) 565,62 (231,05)

                CD4 +  T / CD8 +  T oranı Utca'ya 2.044 (0.62) 1.858 (0.89)
                CA 1.630 (0.69) 1.652 (0.49)

                IL-6 Utca'ya 3,4 (4,50) 2,1 (6,6)
                ug / ml CA 5,6 (5,53) 3,8 (7.312)
                Ortalama ± standart sapma olarak ifade edilen veriler; UtCa grubu: kemoterapi ile tedavi edilen hastalar günlük +300 mg Uncaria tomentosa ( n = 20); Ca grubu: kemoterapi alan hastalar ( n = 20).

                IL-6, CD4 + T / CD8 + T oranı ile yaş, vücut kitle indeksi ve hormon reseptör durumu arasında korelasyon bulunmadı (veriler gösterilmemiştir).

                Antioksidan savunmalar, sıfır ve altı tedavi döngüsüyle ve UtCa ile Ca grupları arasında Superoksit Dismutaz (SOD) ve Katalaz (CAT) aktivitesi ile analiz edildi. Gruplar arasında istatistiksel olarak anlamlı fark yoktu. Ut ile takviye edilen grup için sıfır ve altı tedavi döngülerine kıyasla SOD enziminde bir artış gözlendi, ancak gruplar arasında (UtCa = 11.53 U / mg protein, Ca = 11.43 U / mg protein) veya tedavinin sonu (17.32 U / mg protein, 11.74 U / mg protein). Lipid Peroksidasyonu, TBARS ölçeği ve serum proteinlerinin karbonilasyonu ile de tahmin edildi, ancak gruplar (UtCa ve Ca) arasında fark yoktu.

                Kemoterapinin Ut ekstraktına karşı koruyucu etkisi Kuyruklu Yıldız Tayini ile değerlendirildi. Tedavinin başlangıcında (sıfır döngü), Ca grubu ve UtCa grubu Comet test indeksinde anlamlı bir fark göstermedi. Bununla birlikte, altıncı döngüde (tedavinin sonu), UtCa grubunda indeks testinde Ca grubuna göre anlamlı bir azalma gözlendi ( P <0.05) Şekil 2 .
                Resim, resim vb. İçeren harici bir dosya. Nesne adı ECAM2012-676984.002.jpg
                şekil 2
                Meme kanseri olan ve Ut ile tedavi edilmeyen hastalarda kan hücrelerinin indeks testi. * Tüm gruplar arasındaki anlamlı farkı temsil eder ( P <0.05). ** UtCa grubu (döngü 0) ile UtCa grubu (döngü 5-6) P <0.05 (Student t- testi) arasındaki önemli farkı temsil eder .

                4. Tartışma
                Uncaria tomentosa , bağışıklık sisteminin uyarılmasını, vücut stres, yetersiz beslenme veya bazı ilaçların etkisiyle bağışıklık sistemini baskıladığında hastalıklara karşı direnci arttırır.

                Birçok bitkisel ilaç, genellikle herhangi bir yan etki ile ilişkili olmayan tarihsel veya kişisel kanıtlara dayanan çeşitli kombinasyonlarda (allopatik ve homeopatik, ilaçlar vb.) Çeşitli amaçlar için kullanılır [ 26 ]. Bu nedenle, bu çalışma, randomize bir klinik çalışma yoluyla, Ut'ın kemoterapiyi tamamlayıcı bir tedavi olarak etkinliğini değerlendirmiştir.

                Kemoterapötik ajanların sitotoksik etkisi, diğer vücut hücrelerine de zararlı olan neoplastik hücreler için seçici değildir. Hematopoetik baskılama, bu tür sitostatik ajanların dozajını sınırlayan başlıca komplikasyondur; nötropeni ve trombositopeni en sık görülenlerdir [ 1 ]. Nötrofil sayısı 500 hücre / mm altında olduğunda tedavi kesilmelidir 3 [ 27 ]. Bu nedenle, tedavi sürecinin başarısı nötrofil içeriğine bağlıdır. Kemoterapiye bağlı nötropeninin önlenmesi klinik bir öncelik olarak düşünülmelidir [ 28 ]. Nötropeninin ciddi enfeksiyonlara yatkın olduğu bilindikten sonra, genellikle tedavi döngülerinde gecikmelere ve doz azaltımlarına neden olur.

                Günlük 300 mg kuru Ut ekstresi kullanılarak yapılan tedavi, nötropeni olan ana kemoterapi etkisini azaltmada etkili olmuştur. Kemoterapinin kan hücreleri üzerindeki etkileri tedavi sırasında daha belirgin hale gelir. Bununla birlikte, sonuçlarımız, kemoterapinin sonuna karşılık gelen altıncı döngüde, lökositler ve nötrofil sayımlarındaki farklılıkların Ut ile takviye edilen grubun, kanser grubu (takviyesiz). Takviyesi olmayan grupta hastaların% 67.89'unda nötropeni vardı. Benzer şekilde, aktifleştirilmiş öncüler her iki suş için de ortak olduğundan, aktifleştirilmiş monositlerde bir artış olmuştur.

                Bulgularımız, Ut ekstresinin büyüme üzerinde uyarıcı bir etkiye sahip olduğunu gösteren ve CFU-GM'yi listeriosis modelini kullanarak fare kemik iliği ve dalağından farklı kılan diğer çalışmalarla doğrulanmıştır [ 29 ]. Gönüllülerde art arda altı hafta boyunca Ut sulu ekstrakt kullanılarak artan lökosit sayısı da saptandı [ 13 ]. Lökositlerin geri kazanımı, farelerde, pozitif kontrol olarak Granülosit Koloni Uyarıcı Faktör (Neupogen) kullanılarak kemoterapiye bağlı lökopeni (Doksorubisin) için bir model kullanılarak da gözlenmiştir [ 15 ].

                Grubumuz bu sonuçları, ciddi bir nötropeniye neden olan farelerde ifosfamide bağlı nötropeni için bir model kullanarak doğrulamıştır. Biyolojik tahliller, Ut ile tedavinin nötrofil sayısını önemli ölçüde arttırdığını ve test edilen karşılık gelen dozlarda (5 ve 15 mg / gün Ut ve 3 ve 9 mcg / gün) Filgrastim (rhG-CSF) ile ilgili olarak% 85.2'lik bir gücün hesaplandığını gösterdi. Filgrastim, sırasıyla.) [ 13 ]. Göbek kordon kanından (UCB) elde edilen insan hematopoietik kök öncü hücrelerinde (hHSPC'ler) in vitro analizler yoluyla , bu etkinin Şekillendirme Birimleri-Granülosit-Makrofaj (CFU-GM) çoğalması nedeniyle olduğu sonucuna varıyoruz [ 13 ].

                Bu çalışmada, Ut ile takviye edilmiş olsun ya da olmasın, gruplar arasında kemoterapi döngüleri arasında lenfosit sayısında hiçbir fark gözlenmemiştir; ancak sayıları kontrol grubuna göre kemoterapiye bağlı olarak azaldı. Bu farklılıklar CD4 + ve CD8 + alt popülasyonlarında gözlenmemiştir.

                Bu makale farklı Uncaria tomentosa özütlerinin etkilerini bildirmektedir . En yüksek kinik asit konsantrasyonuna ve düşük konsantrasyonlarda oksindol alkaloitlere sahip olan, sulu immünomodülatör özellikler ile ilişkili olan sulu ekstrakta TNF- a gibi sitokinler aracılık eder [ 30 ]. Başka bir tedavi almayan HIV'li hastalarda 2 ila 5 ay boyunca 20 mg / gün Uncaria tomentosa özütü kullanan klinik çalışmalar , CD4 + ve CD8 + oranında önemli değişiklikler olmaksızın toplam periferik lenfositlerde bir artış olduğunu göstermiştir [ 31 ]. 8 hafta boyunca 350 mg sulu Ut ekstresi alan sağlıklı gönüllüler lökositoz gösterdi ve lenfositlerin proliferasyonunda artış eğilimi gösterdi [ 15]. Bir hayvan modelinde, en yüksek kinik asit konsantrasyonuna ve düşük konsantrasyonlarda oksindol alkaloidlere sahip sulu ekstrakt kullanılarak, lenfositlerde bir artış da gözlenmiştir [ 15 , 32 ].

                Ayrıca, alkollü ekstraktlar ve / veya pentasiklik oksindol alkaloidlerinin daha yüksek miyeloproliferatif etkileri vardır [ 33 , 34 ]. Diğer çalışmalar, lenfosit sayısındaki artışın proliferasyondan ziyade sağkalım oranlarına bağlı olduğunu göstermiştir [ 32 ].

                Bu nedenle, lenfositlerde gözlenen değişiklikler yazarlar tarafından kullanılan sulu ekstraktta bulunan kinik asit olarak in vivo kinik ve biyoaktif asit esterleri olarak tanımlanan kimyasal olarak aktif bileşenlerle ilişkilidir . Çalışmamızda hidroalkolik ekstrakt kullanıldı.

                Yüksek seviyelerde dolaşımdaki IL-6, metastatik meme kanseri olan hastalar için daha kötü sağkalım oranları ile ilişkilidir ve hastalığın derecesi ile ilişkilidir [ 30 ].

                Örneğimizi oluşturan hastalar, tedavi döngüleri sırasında negatif bir ilerleme göstermedi, yani IL-6'da bir artışa yol açabilecek relaps oluşumu veya artmış lezyon boyutu yoktu.

                Farklı Uncaria tomentosa özleri , antioksidan aktivitelerini belirlemek için in vitro test edildi . Sulu ve alkollü özütler, tiyobarbitürik asit (TBARS) ile reaksiyon ürünlerinin üretimini önler ve bu nedenle, değerlendirilen oksidatif stres parametreleri arasında serbest radikallerin [ 35 , 36 ] dönüştürülmemesi nedeniyle sitoplazmik membrana (lipitler) ve DNA'ya zarar verir. SOD, CAT, TBARS ve karbonillenmiş proteinler.

                Meme kanserli kadınlar, lipit peroksidasyonu, proteinler ve DNA'dan türetilen ürünler gibi oksitlenmiş maddelerin kan konsantrasyonlarında artış gösterirler [ 32 , 33 ].

                Gözlenen tek farklılıklar Ut ile takviye edilmiş veya edilmemiş gruplar arasındaki SOD enziminde olmuştur. Bu sonuçlar ayrıca bu enzimin aktivitesinde bir artışın [ 10 ] algılandığı bir hayvan modelinde de bulunmuştur . Meme kanseri olan kadınlar üzerinde yapılan bir çalışmada, SOD aktivitesi klinik evre ve menopoz durumundan bağımsız olarak anlamlı bir artış göstermiştir [ 31 ]. Oksidatif stres durumunun, hastalık evresinin büyük derecesinden daha yüksek olduğuna dair kanıtlar vardır [ 37 , 38 ].

                IL-6'da bulunan sonuçlara benzer şekilde, çalışmadaki tüm hastaların Evre II kanseri olduğu gerçeği bulunan sonuçları açıklayabilir.

                Doksorubisinin kendisini hücre zarı lipidine bağlayabilme kabiliyeti çeşitli hücresel fonksiyonları etkileyebilir. Doksorubisin enzimatik indirgemesinin çeşitli oksidaz, redüktaz ve dehidrogenaz genleri ile reaksiyonu ROS üretir ve bu nedenle apoptozu tetikleyen DNA ve proteinlere zarar verebilir [ 39 , 40 ].

                Antioksidanların in vivo performansı, oluşan serbest radikallerin türlerine, bu radikallerin nerede ve nasıl üretildiğine ve optimal koruma için dozların ne olduğuna bağlıdır. Bu nedenle, bir antioksidanın herhangi bir sistemde koruyucu olarak hareket etmesi tamamen mümkündür, ancak diğer sistemlerde veya dokularda indüklenen lezyonları korumaması veya hatta arttırmaması da mümkündür. Bu nedenle, kanser tedavisinde antioksidanların kullanımı tartışmalıdır.

                Ambrosone ve arkadaşları [ 41 ], daha yüksek ROS düzeyleri ile sonuçlanan genotipleri olan meme kanseri olan kadınların, daha düşük nesil ROS ile ilişkili genotipleri olanlara göre daha iyi sağkalım oranlarına sahip olduğunu gözlemlemişlerdir. Bu tür sonuçlar artmış bir oksidatif stresin kemoterapi ve / veya radyoterapinin etkilerini artırabildiğini ve bunun da iyileştirilmiş tedavi etkinliği ve dolayısıyla daha iyi sağkalım oranları ile sonuçlandığını göstermektedir. SOD'un aşırı ekspresyonu, kolorektal kanser teşhisi konan hastalar için daha iyi sağkalım oranları ile ilişkilidir [ 42 ].

                Cleveland ve Kastan, ROS seviyelerini artırarak ve SOD seviyelerini inhibe ederek bazı kanser türleri için umut verici bir tedavinin olabileceğini öne sürmektedir [ 43 , 44 ]. Diğer yazarlar SOD'nin aşırı ekspresyonunun doksorubisine direnç gösterdiğini bildirmişlerdir [ 43 , 44 ], ancak gastrik hücrelerde 5-florourasil [ 41 ] vermemiştir . Meme kanseri hücreleri üzerine yapılan bir başka çalışma, hücre içi glutatyon seviyesi (GSH) ile Adriamisine karşı artan bir direnç göstermiştir [ 45 ].

                Ut'ın DNA üzerindeki koruyucu etkisi, Comet test analizi ile meme kanseri tedavi döngüleri sırasında gözlenmiştir.

                Doksorubisinin DNA'ya bağlanması ve nükleik asit sentezinin inhibisyonu ile ilgili kendi etki mekanizması vardır. Çalışmalar, sulu Ut ekstraktlarının DNA onarım aktiviteleri sunduğunu göstermiştir [ 15 ]. Mammone ve diğ. (2006) , insan derisi ve organ kültürlerinde Uncaria tomentosa'yı modüle etme ve DNA'nın onarımını gösterebildiğini göstermiştir [ 46 ].

                Bu çalışmada, kuyruklu yıldız testinin sonuçları Ut'ın tedavi döngüleri sırasında DNA'nın koruyucu bir etkisi olduğunu göstermektedir. Bununla birlikte, diğer çalışmaların bu etkileri doğrulaması gereklidir.

                5. Sonuçlar
                Günde 300 mg kuru ekstrakt dozunda kullanılan Uncaria tomentosa , İnvaziv Duktal Karsinom tanısı konan kadınlarda kemoterapinin neden olduğu nötropeniden kurtulmada etkilidir — Aşama II. Ayrıca hücresel DNA'yı geri yükleyebilir. Bu nedenle, olumsuz kemoterapi etkilerini azaltmada güvenli ve etkili bir adjuvan tedavisidir.

                Çıkar Çatışması
                Tüm yazarlar herhangi bir çıkar çatışmasını inkar eder.

                Teşekkür
                Yazarlar, Santa Maria Üniversite Hastanesi Brezilya ve Herbaryum Botanik Laboratuvarı Serviço de Hematoloji / Onkoloji (Hematoloji / Onkoloji Hizmetleri Bölümü) ve hekimlere ve hastalara teşekkür etmek istiyorlar. Bu çalışma hükümet fonları tarafından desteklenmiştir: CNPq ve CAPES.

                Referanslar
                1. DeVita VT, Lawrence TS, Rosenberg SA. DeVita, Hellman ve Rosenberg'in Kanseri: Onkolojinin İlkeleri ve Uygulamaları . 8. baskı. Philadelphia, Pa, ABD: Lippincott Williams & Wilkins; 2008. [ Google Akademik ]
                2. Uluslararası Kanserle Mücadele Birliği - UICC. Malign Tümörlerin TNM Sınıflaması . 6. baskı. New York, NY, ABD: John Wiley & Sons; 2002. LH Sobin ve Ch. Wittekind. [ Google Akademik ]
                3. Phillips T, Murray G, Wakamiya K, vd. Antihormonal tedavi için hasta seçimi için standart östrojen ve progesteron reseptörü immünohistokimyasal testlerin geliştirilmesi. Uygulamalı İmmünohistokimya ve Moleküler Morfoloji . 2007; 15 (3): 325-331. [ PubMed ] [ Google Akademik ]
                4. Anim JT, John B, AbdulSathar S SA, et al. Meme kanserinde çeşitli belirteçlerin ekspresyonu ile prognostik faktörler arasındaki ilişki. Açta Histokimya . 2005; 107 (2): 87-93. [ PubMed ] [ Google Akademik ]
                5. Özer H, Armitage JO, Bennett CL, vd. 2000 Hematopoietik koloni uyarıcı faktörlerin kullanımı için önerilerin güncellenmesi: kanıta dayalı, klinik uygulama kılavuzları. Klinik Onkoloji Dergisi . 2000; 18 (20): 3558-3585. [ PubMed ] [ Google Akademik ]
                6. Dünya Sağlık Örgütü. Farmakovijilans Sistemlerinde Bitkisel İlaçların Güvenlik İzlemesine İlişkin Kılavuz . Cenevre, İsviçre: Dünya Sağlık Örgütü; 2004. [ Google Akademik ]
                7. Riva L, Coradini D, Di Fronzo G, vd. Uncaria tomentosa ekstraktlarının ve fraksiyonlarının meme kanseri hücre dizisinin büyümesi üzerindeki antiproliferatif etkileri . Antikanser Araştırması . 2001; 21 (4): 2457-2461. [ PubMed ] [ Google Akademik ]
                8. Sheng Y, Pero RW, Wagner H. Bir sıçan modelinde kemoterapiye bağlı lökopeni, Uncaria tomentosa'dan sulu ekstraktla tedavi edilir . Fitomedisin . 2000; 7 (2): 137-143. [ PubMed ] [ Google Akademik ]
                9. Wurm M, Kacani L, Laus G, Keplinger K, Dierich MP. Uncaria tomentosa'dan gelen pentasiklik oksindol alkaloidleri, insan endotel hücrelerini bir lenfosit proliferasyonunu düzenleyici faktör salmaya teşvik eder. Planta Medica . 1998; 64 (8): 701-704. [ PubMed ] [ Google Akademik ]
                10. Allen-Hall L, Cano P, Arnason JT, Rojas R, Lock O, Lafrenie RM. THP-1 hücrelerinin tedavisi Uncaria tomentosa özleri diferansiyel olarak, IL-1 durumunda ekspresyonunu düzenleyen β ve TNF- α . Etnofarmakoloji Dergisi . 2007; 109 (2): 312-317. [ PubMed ] [ Google Akademik ]
                11. Pilarski R, Zielinski H, Ciesiołka D, Gulewicz K. Uncaria tomentosa (Willd.) DC'nin etanolik ve sulu ekstraktlarının antioksidan aktivitesi . Etnofarmakoloji Dergisi . 2006; 104 (1-2): 18-23. [ PubMed ] [ Google Akademik ]
                12. Farias I, Araújo MDC, Zimmermann ES, et al. Uncaria tomentosa , miyeloid progenitör hücrelerin proliferasyonunu uyarır. Etnofarmakoloji Dergisi . 2011; 137 (1): 856-863'te açıklanmaktadır. [ PubMed ] [ Google Akademik ]
                13. Sheng Y, Li L, Holmgren K, Pero RW. İnsan gönüllü çalışmasında Uncaria tomentosa'nın sulu ekstraktlarının DNA onarımı artışı . Fitomedisin . 2001; 8 (4): 275-282. [ PubMed ] [ Google Akademik ]
                14. Greenberg RS, Daniels SR, Flanders WD, Eley JW, Sıkıcı JR. Tıbbi Epidemiyoloji . 4. baskı. Columbia, SC, ABD: McGraw-Hill; 2004. Ek A: randomize kontrollü klinik çalışmalar için örneklem büyüklüğü gereksinimlerinin tahmini. [ Google Akademik ]
                15. Sheng Y, Bryngelsson C, Pero RW. Geliştirilmiş DNA tamiri, bağışıklık fonksiyonu ve C-MED-100 (TM) düşük toksisite, gelen yeni bir sulu ekstre Uncaria tomentosa . Etnofarmakoloji Dergisi . 2000; 69 (2): 115-126'da tarif edilmektedir. [ PubMed ] [ Google Akademik ]
                16. Taktak YS, Selkirk S, Bristow AF, vd. Monositik hücre soylarından interlökin-6 salımı ile pirojenlerin tahlili. Eczacılık ve Farmakoloji Dergisi . 1991; 43 (8): 578-582. [ PubMed ] [ Google Akademik ]
                17. Singh NP, McCoy MT, Tice RR, Schneider EL. Tek tek hücrelerdeki düşük DNA hasarı seviyelerini ölçmek için basit bir teknik. Deneysel Hücre Araştırması . 1988; 175 (1): 184-191. [ PubMed ] [ Google Akademik ]
                18. Tice RR, Agurell E, Anderson D, vd. Tek hücreli jel / kuyruklu yıldız tahlili: in vitro ve in vivo genetik toksikoloji testi için yönergeler. Çevresel ve Moleküler Mutajenez . 2000; 35 (3): 206-221. [ PubMed ] [ Google Akademik ]
                19. Hartmann A, Agurell E, Beevers C, vd. İn vivo alkalin kuyruklu yıldız tahlilinin yapılması için öneriler. Mutajenez . 2003; 18 (1): 45–51. [ PubMed ] [ Google Akademik ]
                20. Nadin SB, Vargas-Roig LM, Ciocca DR. Tek hücreli jel analizi için gümüş boyama yöntemi. Histokimya ve Sitokimya Dergisi . 2001; 49 (9): 1183–1186'da açıklanmaktadır. [ PubMed ] [ Google Akademik ]
                21. Collins A, Ai-Guo M, Duthie SJ. Bir ADN oksidativo (mutlak insani insanlar). Mutasyon Araştırması . 1995; 336 : 69-77. [ Google Akademik ]
                22. Levine RL, Garland D, Oliver CN ve diğ. Oksidatif olarak modifiye edilmiş proteinlerde karbonil içeriğinin belirlenmesi. Enzimolojide Yöntemler . 1990; 186 : 464-478. [ PubMed ] [ Google Akademik ]
                23. Jentzsch AM, Bachmann H, Fürst P, Biesalski HK. İnsan vücudu sıvılarında malondialdehitin geliştirilmiş analizi. Serbest Radikal Biyoloji ve Tıp . 1996; 20 (2): 251-256. [ PubMed ] [ Google Akademik ]
                24. Nelson DP, Kiesow LA. (H molar imha katsayıları olan 25 ° C 'de katalaz ile hidrojen peroksitin ayrışma Entalpi 2 O 2 UV solüsyonlar) Analytical Biochemistry . 1972; 49 (2): 474-478. [ PubMed ] [ Google Akademik ]
                25. McCord JM, Fridovich I. Süperoksit dismutaz. Eritrosüprein (hemokuprein) için enzimatik bir fonksiyon Biyolojik Kimya Dergisi . 1969; 244 (22): 6049-6055. [ PubMed ] [ Google Akademik ]
                26. Rahman SZ, Singhal KC. Bitkisel kökenli tıbbi ürünlerin farmakovijilansındaki problemler ve bunları en aza indirgemek için araçlar. Uppsala Raporları . 2002; 17 : 1–4. DSÖ ADR İzleme İşbirliği Merkezi, Uppsala İzleme Merkezi, Uppsala, İsveç. [ Google Akademik ]
                27. Ulusal Kanser Enstitüsü (NCI) Olumsuz Olaylar için Ortak Terminoloji Kriterleri s. 3.0 (CTCAE) http://ctep.cancer.gov/protocolDevel...cs/ctcaev3.pdf .
                28. Crawford J, Dale DC, Lyman GH. Kemoterapiye bağlı nötropeni: riskleri, sonuçları ve yönetimi için yeni talimatlar. Kanser . 2004; 100 (2): 228-237. [ PubMed ] [ Google Akademik ]
                29. Eberlin S, Dos Santos LMB, Queiroz MLS. Uncaria tomentosa özütü, Listeria monositogenleri ile enfekte olmuş farelerin kemik iliğindeki miyeloid progenitör hücrelerin sayısını arttırır . Uluslararası İmmünofarmakoloji . 2005; 5 (7-8): 1235–1246. [ PubMed ] [ Google Akademik ]
                30. Sandoval M, Charbonnet RM, Okuhama NN, et al. Kedi Pençesi TNF inhibe α üretimi ve scavenges serbest radikalleri: rol koruyucu olduğu. Serbest Radikal Biyoloji ve Tıp . 2000; 29 (1): 71-78. [ PubMed ] [ Google Akademik ]
                31. Keplinger K, Laus G, Wurm M, Dierich MP, Teppner H. Uncaria tomentosa (Willd.) DC. - etnomedik kullanım ve yeni farmakolojik, toksikolojik ve botanik sonuçlar. Etnofarmakoloji Dergisi . 1998; 64 (1): 23-34. [ PubMed ] [ Google Akademik ]
                32. Uncaria tomentosa'nın sıcak su özütü olan Akesson C, Pero RW, Ivars F. C-Med 100, in vivo lenfosit sağkalımını uzatır. Fitomedisin . 2003; 10 (1): 23-33. [ PubMed ] [ Google Akademik ]
                33. Gimenez DG, Prado EG, Rodríguez TS, Fernández Arche A, De La Puerta R. Uncaria tomentosa kabuğundan izole edilen pentasiklik oksindol alkaloid mitrafilinin insan ewing sarkomu ve meme kanseri hücre çizgileri üzerindeki sitotoksik etkisi . Planta Medica . 2010; 76 (2): 133-136. [ PubMed ] [ Google Akademik ]
                34. Pilarski R, Filip B, Wietrzyk J, Kuras M, Gulewicz K. Uncaria tomentosa (Willd.) DC'nin antikanser aktivitesi . farklı oksindol alkaloid bileşimli preparatlar. Fitomedisin . 2010; 17 (14): 1133–1139. [ PubMed ] [ Google Akademik ]
                35. Desmarchelier C, Mongelli E, Coussio J, Ciccia G. Uncaria tomentosa (Willd.) DC ekstraktlarındaki in vitro antioksidan aktivitenin değerlendirilmesi . Fitoterapi Araştırmaları . 1997; 11 (3): 254-256. [ Google Akademik ]
                36. Gonçalves C, Dinis T, Batista MT. Uncaria tomentosa kabuğu kaynatma proantosiyanidinlerinin antioksidan özellikleri : anti-enflamatuar aktivite için bir mekanizma. Fitokimya . 2005; 66 (1): 89-98. [ PubMed ] [ Google Akademik ]
                37. Ray G, Batra S, Shukla NK, vd. Meme kanserinde lipit peroksidasyonu, serbest radikal üretimi ve antioksidan durumu. Meme Kanseri Araştırma ve Tedavisi . 2000; 59 (2): 163-170. [ PubMed ] [ Google Akademik ]
                38. Valko M, Moncol J, Rhodes CJ, Izakovic M, Mazur M. Oksidatif stres kaynaklı kanserde serbest radikaller, metaller ve antioksidanlar. Kemiko-Biyolojik Etkileşimler . 2006; 160 (1): 1-40. [ PubMed ] [ Google Akademik ]
                39. Janssen AML, Bosman CB, Sier CFM, vd. Kolorektal kanser hastalarının genel sağkalımına ilişkin süperoksit dismutazları. İngiliz Kanser Dergisi . 1998; 78 (8): 1051-1057. [ PMC ücretsiz makale ] [ PubMed ] [ Google Akademik ]
                40. Halliwell B. Oksidatif stres ve kanser: ilerledik mi? Biyokimyasal Dergi . 2007; 401 (1): 1–11. [ PubMed ] [ Google Akademik ]
                41. Ambrosone CB, Ahn J, Singh KK, vd. Oksidatif stres (MPO, MnSOD, CAT) ve meme kanseri tedavisinden sonra hayatta kalma ile ilgili genlerdeki polimorfizmler. Kanser Araştırmaları . 2005; 65 (3): 1105–1111. [ PubMed ] [ Google Akademik ]
                42. Hur GC, Cho SJ, Kim CH, vd. Manganez süperoksit dismutaz ekspresyonu, insan mide kanseri hücre dizilerinde kemosensitivite ile ilişkilidir. Klinik Kanser Araştırmaları . 2003; 9 (15): 5768-5775. [ PubMed ] [ Google Akademik ]
                43. Cleveland JL, Kastan MB. Kanser: tedaviye radikal bir yaklaşım. Doğa . 2000; 407 (6802): 309-311. [ PubMed ] [ Google Akademik ]
                44. Suresh A, Guedez L, Moreb J, Zucali J. İngiliz Hematoloji Dergisi . 2003; 120 (3): 457-463. [ PubMed ] [ Google Akademik ]
                45. Osbild S, Brault L, Battaglia E, Bagrel D. Sisplatin ve adriamisine direnç, MCF-7'den türetilmiş hücrelerde glutatyon akışının inhibisyonu ile ilişkilidir. Antikanser Araştırması . 2006; 26 (5 A): 3595-3600. [ PubMed ] [ Google Akademik ]
                46. Mammone T, Akesson C, Gan D, Giampapa V, Pero RW. Uncaria tomentosa'dan (kedi pençesi) suda çözünür bir öz , insan derisinin primer organ kültürlerinde güçlü bir DNA onarımı geliştiricisidir. Fitoterapi Araştırmaları . 2006; 20 (3): 178-183. [ PubMed ] [ Google Akademik ]

                Yorum yap


                • #9
                  Kabızlıktan Nasıl Kurtulurum Kabızlığa Ne İyi Gelir


                  Uncaria tomentosa (kedi pençesi): SARS-CoV-2 / ACE-2 birleşimine ve SARS-CoV-2 başak proteinine karşı moleküler modellemeye dayalı umut verici bir bitkisel ilaç

                  Andres F.Yepes-Pérez , Oscar Herrera-Calderon , ve Jorge Quintero-Saumeth


                  Öz
                  COVID-19, yeni bir şiddetli akut solunum sendromu koronavirüsüdür. Şu anda etkili bir tedavi yoktur ve aşılar gelecekte çözüm olarak görünmektedir. Şiddetli akut solunum sendromu korona virüsü 2'nin (SARS-CoV-2) S proteinine karşı potansiyel ilaçların sanal olarak taranması, yüksek bir bağlanma afinitesine sahip küçük moleküler bileşikler sağlamıştır. Ne yazık ki, bu ilaçların çoğu, konukçu hücrelerde reseptör bağlanma alanı (RBD) -anjiyotensin dönüştürücü enzim-2 (ACE-2) kompleksinin bağlanma arayüzüne bağlanmaz. Tıbbi bitki Uncaria tomentosa'nın bileşenlerinin potansiyel antiviral özelliklerini değerlendirmek için moleküler modelleme gerçekleştirildi.(kedinin pençesi), RBD-ACE-2 ve viral diken proteininin bağlanma arayüzüne odaklanır. In silico yaklaşımı, 26 Cat'in pençe anahtar bileşenlerinin protein-ligand kenetlenmesi ve ardından moleküler dinamik simülasyonları ve yeniden yerleştirilmiş hesaplamalarla başlar. Son olarak, en kaliteli kedinin pençe bileşenleri için ilaç benzerliği hesaplamaları yaptık. Yapısal biyoinformatik yaklaşımlar , SARS-CoV-2 RBD viral spike üzerindeki RBD-ACE-2 arayüzü ve ACE-2 bağlanma sahası ile ikili güçlü etkileşim yoluyla potansiyel terapötik etkiye sahip birkaç biyoaktif U. tomentosa bileşiğinin tanımlanmasına yol açtı . Ek olarak, bu bileşenler için silikoda ilaç benzerliği endeksleri hesaplandı ve U. tomentosa'da bulunan bu fitokimyasalların iyi tahmin edilen terapötik profillerini gösterdi.(kedinin pençesi). Bulgularımız, kedi pençesinin COVID-19 tedavisi için tamamlayıcı ve / veya alternatif tıp olarak potansiyel etkinliğini önermektedir.

                  Ramaswamy H. Sarma tarafından iletildi

                  Anahtar Kelimeler: SARS-CoV-2, viral başak proteini, ACE-2, kedi pençesi, Uncaria tomentosa , moleküler modelleme, COVID-19
                  Giriş
                  Şiddetli akut solunum sendromu korona virüsü 2 (SARS-CoV-2), koronavirüs ailesinin (CoV) bir parçasıdır ve başlangıçta Çin'in Wuhan kentinde tanımlanmıştır. COVID-19 (koronavirüs hastalığı 2019), dünyada çok sayıda ölüm ve ekonomik krizle birlikte hızla yayılan ve benzeri görülmemiş bir pandemiye neden olan insanlarda oldukça bulaşıcıdır (Prajapat ve diğerleri, 2020 ). Dünya Sağlık Örgütü'nün (WHO) en son raporuna göre, 27 Eylül 2020 itibarıyla 32,7 milyondan fazla vaka ve 991.000 COVID-19 ölümü doğrulandı (Dünya Sağlık Örgütü, 2020 ). Latin Amerika ve Karayipler'in gelişmekte olan ülkelerinde, halk sağlığı en çok etkilenen bölge olmuştur çünkü insanlar modern bir sağlık sistemine ve ilaçlara erişme fırsatına sahip değildir (Wang ve diğerleri,2020 ).

                  Doğal ürünlere dayalı fitoterapi, viral hastalıkları tedavi etmek için uygun bir alternatif olabilir (Akram ve diğerleri, 2018 ). Dünya Sağlık Örgütü tahminlerine göre, gelişmekte olan ülkelerdeki nüfusun yaklaşık% 80'i, temel sağlık hizmetlerinde geleneksel tıbbı, özellikle şifalı bitkiler kullanıyor (Dünya Sağlık Örgütü, 2018 ). Biyolojik özelliklerinin incelenmesi için doğal ürünlerin seçimi, üç temel metodoloji aracılığıyla ele alınmıştır: rastgele doğal kaynakların seçimi, kemotaksonomiye dayalı seçim (aynı aileye veya cinse ait organizmalardaki benzer bileşiklerin taranması) ve seçim temelli Etnotıp üzerine (Heinrich, 2002). Etnotıp en etkili tedavi olarak kabul edilmiştir ve bazı toplumlarda belirli hastalıkların tedavisi için uzun bir kullanım geçmişine sahip olan ve popüler bilginin fitoterapötik cephaneliğinin bir parçası olan doğal ürünler üzerinde yapılan çalışmalardan oluşmaktadır (Wu ve Tan, 2019 ).

                  Öte yandan , Uncaria tomentosa (Willd. Ex Schult .) DC. adlı kedi pençesi (İspanyolca'da 'uña de gato'), Peru Amazonlarına ve Rubiaceae ailesine ait Güney ve Orta Amerika'nın diğer tropikal bölgelerine özgü odunsu bir asmadır (Sandoval ve diğerleri, 2000 ). Şu anda, U. tomentosa'nın hammaddesi , Tamamlayıcı Tıp Hizmeti (CMS) olarak Sosyal Sağlık Sigortasının Kamu Hastanelerinde (EsSalud-Peru) dağıtılmaktadır (Gonzales ve diğerleri, 2010 ). Geleneksel olarak, kök ve kabuk kaynatma ile hazırlanan özler, alerji, artrit, iltihaplanma, romatizma enfeksiyonları ve kanser gibi çeşitli hastalıklara karşı kullanılmaktadır (Araujo ve diğerleri, 2018 ).

                  U. tomentosa özütlerinin biyoaktif bileşenleri arasında proantosiyanidinler [proantosiyanidin B2 (ana bileşen), proantosiyanidin B4, proantosiyanidin C1, bir epikateşin trimeri, epiafzelechin-4β → 8-epikateşin ve bir epikateşin tetramer] (Batiha ve diğerleri, 2020 ; Navarro- . Hoyos ve arkadaşları, 2017 ), oksindol alkaloidler (isopteropodine, pteropodine, rhynchophylline, mytraphylline, speciophylline, uncarine F uncarine E) indol alkaloit glikozitler (cadambine, 3-dihydrocadambine ve 3-isodihydrocadambine) (Batiha ve ark., 2020 ; Kuraś vd., 2009 ; Laus vd., 1997 ; Lima-Junior vd., 2013 ; Lock vd., 2016 ; Navarro vd.,2019 , 2017 ; Snow ve diğerleri, 2019), kinovic asit glikozitler (Pavei ve diğerleri, 2012 ), tanenler (Ostrakhovich ve diğerleri, 1997 ), polifenoller, kateşinler, beta sitosterol (Aquino ve diğerleri, 1997 ; Navarro ve diğerleri, 2019 ) ve terapötik özelliklerine ayrı ayrı veya sinerjik olarak katkıda bulunan proteinler (Lenzi ve diğerleri, 2013 ).

                  U. tomentosa'nın antiviral özellikleri ile ilgili olarak, alkaloid fraksiyonunun in vitro olarak dang virüsü-2 (DENV) ile enfekte olmuş insan monositleri üzerinde en etkili olduğu gösterilmiştir (Reis ve diğerleri, 2008 ). Başka bir çalışma, sadece alkaloidal fraksiyonun dang virüsü üzerinde inhibe edici aktiviteye sahip olduğunu ve negatif etkinin alkaloid olmayan fraksiyonla gözlendiğini ortaya çıkarmıştır (Lima-Junior ve ark., 2013 ). Başka bir çalışmada, U. tomentosa'nın antiherpetik aktivitesi, polifenollerle veya bunların pentasiklik oksindol alkaloidler veya kinovik asit glikozitler ile sinerjik etkileriyle ilişkili görünmektedir (Caon ve diğerleri, 2014 ). U. tomentosahidroetanolik ekstraktlar, herpes simpleks virüs tip 1'in replikasyonu üzerinde önemli bir in vitro inhibitör etki göstermiştir ve konakçı hücrelerde viral bağlanmanın inhibisyonu, antiviral aktivitesinin ana mekanizması olarak karakterize edilmiştir (Terlizzi ve diğerleri, 2016 ).

                  SARS-CoV-2, sivri uç (S), zar (M), zarf (E) ve nükleokapsid (N) proteinleri olmak üzere dört yapısal protein içerir. S proteini, viral ve konakçı hücre membranlarının konak eklenmesi ve füzyonundan sorumludur (Wu ve arkadaşları, 2020 ). Aksi takdirde, anjiyotensin dönüştürücü enzim 2 reseptörü (ACE-2r), SARS-CoV-2'ye daha yüksek afiniteye sahip konakçı hücresel reseptördür (Jamwal ve arkadaşları, 2020 ). Bu süreç, S proteininin S1 alt birimi bir konak hücre reseptörüne bağlandığında tetiklenir (Han & Král, 2020 ). Bir konak hücre reseptörünü devreye sokmak için, S1'in reseptör bağlanma alanı (RBD), geçici menteşe benzeri konformasyonel hareketlere (reseptör tarafından erişilebilir veya reseptöre erişilemez durumlar) uğrar. U. tomentosaBileşenleri, virüsün insan hücre reseptörlerine bağlanmasını engelleyebilir ve virüs döngüsünü bozarak SARS-CoV-2'nin protein olgunlaşmasını önlemeye ve enfeksiyon yayılmasını sınırlamaya yardımcı olabilir (Li ve diğerleri, 2020 ).

                  Yeni antiviral keşif için SARS-Cov-2'nin ana ilaçlanabilir anahtarı olarak çeşitli moleküler hedefler tanımlanmıştır. Dahası, X-ışını yapısı yakın zamanda piyasaya sürüldü, bu nedenle olası hesaplama analizine izin verdi. Aslında, bu sistem üzerinde 20 μs uzunluğunda bir moleküler dinamik (MD) çalışması ve birkaç veritabanının sanal taraması da dahil olmak üzere birçok hesaplama çalışması yapılmıştır (Huang ve diğerleri, 2020 ).

                  Henüz COVID-19'a karşı onaylanmış ilaç veya aşı olmadığından, pandeminin etkisini azaltacak stratejiler bulmak esastır. Şifalı otlar ve daha özel olarak, U. tomentosa gibi antiviral aktiviteler sergileyenler , hastalığın yayılmasını yavaşlatabilir. Özellikle bu bitkilere erişimin daha kolay ve ekonomik olarak daha uygun olduğu gelişmekte olan ülkelerde, bu şifalı bitkilerin genel tıp kitine eklenmesi faydalı olabilir.

                  Burada, çalışmamız, mevcut son teknoloji ilaç keşif boru hatlarının erken aşamalarında uygulananları anımsatan bir in siliko stratejisine dayanmaktadır ve (1) U. tomentosa'nın tüm biyoaktif bileşiklerinin her ikisine de odaklanmaya karşı protein-ligand yerleştirmesini içermektedir. RBD-ACE-2'nin bağlanma arayüzünde ve SARS-CoV-2 RBD diken proteininin içinde, (2) bileşiklerin bağlanma bölgesine uygun giriş mekanizmasını değerlendirmek için adım 1'den en iyi tahmin edilen bileşiklerin ligand yolunun simülasyonları, (3) En iyi protein-ligand komplekslerinin stabilitesini değerlendirmek için MD simülasyonu, yerleştirme protokolünün önceki bölümlerinden kaynaklanan en nitelikli bileşikler için 1, (4) farmakokinetik parametrelerin hesaplanması. Bu çalışma, U. tomentosa'nın antiviral potansiyelini göstermektedir.COVID-19 için hızlı bir fitoterapötik seçenek olarak uygulanacak bazlı ürünler.

                  Şuraya gidin: materyal ve metodlar

                  Protein yapısı ve kurulumu
                  U. tomentosa'nın ana bileşenlerinin hesaplanan bağlanma afinitesi (tablo 1) SARS-CoV-2 / ACE-2 kompleksini bozma ve anti-koronavirüs tedavisi için kolay bir tedavi seçeneği olan yeni koronavirüs bulgularının SARS-CoV-2 diken proteinini inhibe etme yeteneği nedeniyle araştırılmıştır. Bu amaçla, SARS-CoV-2 / ACE-2 kompleksinin ve SARS-CoV-2 spike proteininin kristal yapıları Protein Veri Bankasından indirildi (sırasıyla PDB giriş kodu 6M17 ve 6VYB) (Yan ve diğerleri, 2020 ) ve tüm bağlı ligandlar, iyonlar ve çözücü molekülleri, DS Visualizer 2.5 programı kullanılarak manuel olarak çıkarıldı. Yerleştirme çalışmaları için, seçilen proteinlerin yapıları AutoDock Araçları kullanılarak parametrelendirildi (Trott & Olson, 2009 ). Hidrojen bağlarının oluşumunu kolaylaştırmak için polar hidrojenler eklendi.

                  Tablo 1.
                  U. tomentosa'nın ana bileşenlerinin RBD / ACE-2 arayüzüne ve SARS-CoV-2 spike protein bağlanma alanına (RBD) (PDB ID: 6VYB) AutoDock puanlamasına dayanan en iyi bağlanma enerjisi (kcal mol –1 ).
                  Spiroksindol alkaloidleri
                   Uncarine F - 7.1 -6.1
                   Speciophylline -6.8 -6.8
                   Mitrafilin -6.8 -6.2
                   Pteropodin -6.7 -6.2
                   İzopteropodin -6.7 -6.3
                   İzomitrafilin -6.6 -6.1
                   Renkofilin -6.0 -5.5
                   İzorenkofilin -6.0 -5.7
                  Indol glikozitler alkaloidler
                   3-izodihidrokadambin - 7.6 -6.4
                   Cadambine - 7.6 -6.1
                   3-dihidrokadambin -7.0 - 7.1
                  Polihidroksile triterpenler
                   Uncaric asit - 7.0 -5.5
                   Floridik asit -7.0 -5.5
                   PHT-1 -6.9 -5.6
                  Quinovic asit glikozitler
                   QAG-2 - 8.2 -6.8
                   QAG-5 - 8.0 -6.1
                   QAG-4 - 7.8 -6.8
                   QAG-6 - 7.8 -6.8
                   QAG-1 - 7.8 -6.1
                   QAG-3 –7.3 -6.2
                  Proantosiyanidinler
                   Proantosiyanidin C1 - 8.6 - 7.0
                   Epiafzelechin-4β-8 - 7.7 -6.2
                   Proantosiyanidin B4 - 7.6 - 7.2
                   Proantosiyanidin B2 - 7.5 - 7.2
                   Epikateşin –7.1 -6.0
                   Klorojenik asit -6.1 -6.4
                  Referans
                   HepOS a - 7,1 (–7,3) b - 7,1 (–7,3) b
                  Ayrı bir pencerede aç
                  a HepOS: PDB 5UE2'den alınan heparin oktasakarit, pozitif kontrol olarak kullanıldı.
                  b Kwon ve ark. ( 2020 ).

                  Ligand veri seti hazırlama ve optimizasyonu
                  Bu çalışmada kullanılan ligandlar, U. tomentosa özütlerinin ana bileşenleridir ve literatürde bildirilen in vitro güçlü bir SARS-CoV-2 inhibitörü olan sülfatlı bir heparin oktasakkarittir (PDB 5UE2'den alınmıştır) (Kwon ve diğerleri, 2020 ). 26 kedinin pençe bileşeninin 2D yapıları ZINC veri tabanından mol.2 dosyaları olarak elde edilmiştir (ChemAxon, 2016 ). Elde edilen bileşikler MarvinSketch 8.3'e sunulmuştur (Morris ve diğerleri, 1998) fizyolojik pH 7.4'te ligandların protonasyon durumlarını düzeltmek için. Ek olarak, tüm ligandların geometri optimizasyonu, HF / 6-31G * teori seviyesi kullanılarak gerçekleştirildi. Daha sonra yapılar, ligandlara tam hidrojen eklemek, dönebilir bağlar atamak ve elde edilen yapıyı AutoDock ile kullanılmak üzere gerekli formatta kaydetmek için AutodockTools kullanılarak parametrelendirildi. Ligand moleküllerinin tüm olası esnek torsiyonları , hedef yapı ile hesaplanan bağlanmayı teşvik etmek için PDB AutoDockTools'ta (Morris ve diğerleri, 2009 ; Walls ve diğerleri, 2020 ) AUTOTORS kullanılarak tanımlandı .

                  Yerleştirme tabanlı sanal tarama
                  Yerleştirme protokolümüz, AutoDock Vina ve esnek bir ligandı sert bir proteine ​​yerleştirmek için varsayılan prosedürler kullanılarak gerçekleştirildi. Ligandların yerleştirme simülasyonu, her iki protein kalıntısının da yakın olduğu SARS-CoV-2 ve ACE-2 (PDB kodu: 6M17) (Yan ve diğerleri, 2020 ) arasındaki arayüzde gerçekleştirildi . Daha sonra, SARS-CoV-2 spike proteininin (PDB kodu: 6VYB) kriyo-EM yapısını açık durumda kullandık (Lipinski et al., 2012) kedinin pençesinin bileşenlerinin potansiyel inhibisyonunu araştırmak, bu çalışmaya ACE-2-bağlama cebi seçmek. Potansiyel bir bağlanma bölgesi belirlendikten sonra, kedinin pençe ekstraktlarının ana bileşenleri olan 26 bileşik, en olası ve enerjik olarak en uygun bağlanma biçimlerini belirlemek için bu enzim alanına yerleştirildi. Belirlenen katalitik bölgeye bir ızgara kutusu içeren titiz yanaşma simülasyonları gerçekleştirmek için Autodock Vina 1.1.2 (Trott & Olson, 2009 ) kullanıldı. Kapsamlılık, her bir protein-ligand çifti için 20 idi (dahili bağımsız çalışmalar sayısı). Aktif bölge, 1 A ızgara aralığına sahip 40 × 40 × 40 A'lık bir yerleştirme kutusu ile çevriliydi. Afinite skorları (kcal mol –1 cinsinden) tüm bileşikler için AutoDock Vina tarafından verilen serbest enerji bağlama teorisine göre elde edilmiş ve sıralanmıştır (daha negatif değer, daha yüksek bağlanma afinitesi anlamına gelir). Ortaya çıkan yapılar ve bağlama yerleştirme pozları, etkileşimleri kontrol etmek için DS Visualizer 2.5 ( http://3dsbiovia.com/products/ ) veya The PyMOL Molecular Graphics System 2.0 programları kullanılarak grafiksel olarak incelendi .

                  MD simülasyonu
                  Yerleştirme simülasyonları ile elde edilen protein-ligand komplekslerinin moleküler etkileşim stabilitesi , SARS-CoV-2 / ACE-2 arayüzü ve SARS-CoV dikkate alınarak Gromacs programı (Abraham ve diğerleri, 2015 ) kullanılarak MD simülasyonları ile doğrulanmıştır. Sırasıyla -2 başak protein aktif bölgesi ve Proantosiyanidin C1, QAG-2, Proantosiyanidin B2 ve 3-dihidrokadambin için en iyi kenetlenme pozisyonu. Protein ve ligandlar için kuvvet alanı parametreleri bağımsız olarak türetildi. Seçilen protein için amber03 kuvvet alanı seçildi ve Gromacs program paketlerinin pdb2gmx aracı kullanılarak atandı, bu arada ligand kuvvet alanı parametreleri genelleştirilmiş AMBER kuvvet alanı (GAFF) ile önceden HF / 6 ile optimize edilmiş moleküler geometriler kullanılarak hazırlandı. Gaz fazında -31G * teori seviyesi, (Foresman ve ark.,1992 ; Glendening ve diğerleri, 2012 ; Roothaan, 1951 ) ile Gamess-US programı (Schmidt ve diğerleri, 1993 ).

                  Ek olarak, her bir ligand, harmonik titreşim normal mod analizi yoluyla minimum olarak doğrulandı. Gamess-US programı (Bayly vd., 1993 ) tarafından bir sınırlı elektrostatik potansiyel (RESP) modeli uydurularak Merz-Kollman şeması (Singh ve Kollman, 1984 ) ile atomik yükler elde edilmiş ve çıktı dosyası AmberTools program paketinin resp alt programı (Cornell ve diğerleri, 1995 ). GAFF kuvvet alanı parametrelerinin atanması Antechamber programı ile gerçekleştirildi (Wang ve diğerleri, 2006) ve moleküler dinamik simülasyonları için gerekli girdi dosyaları ACPYPE python arayüzü kullanılarak hazırlanmıştır. Protein ve protein-ligand kompleksleri, dikdörtgen bir TIP3P su kutusu içinde çözüldü. Elde edilen sistem, proteinin net negatif yükünü nötralize etmek için yedi sodyum karşı iyonu eklenerek nötralize edildi ve ardından fizyolojik koşullar (298 K, pH 7.4,% 0.9 NaCl çözeltisi) oluşturuldu (Hammad ve diğerleri, 2020 ).

                  Sahte kişiyi kaldırmak için, moleküler geometriler 100,000 adımlarla dik iniş algoritması ile optimize edildi protein omurgalar atomuna 1000 kJ.mol bir kuvvet sabiti ile kısıtlı edildi -1 . Daha sonra, MD simülasyonlarının NpT grubunda 1000 ps için çalışmasına izin verildi. Ayrıca üretim aşaması için NpT grubunda 50 ns hesaplandı. Tüm simülasyonlar periyodik sınır koşulları altında gerçekleştirilmiştir. 25 × 25 × 25 nm boyutunda bir kübik kutu kullanıldı. Bağlı olmayan etkileşimleri hesaplamak için 12 kesme mesafesi kullanılmıştır. Elektrostatik etkileşimler Ewald partikül ağ (PME) yöntemiyle işlendi (Nishizawa & Nishizawa, 2010); van der Waals etkileşimleri ise kesme şeması kullanılarak tanıtıldı. Son olarak, 1.0 ps'lik bir bağlantı sabiti ile 300 K'de V-yeniden ölçeklendirmeli termostat kullanıldı ve 2.0 ps'lik bir bağlantı sabiti ve a ile Parinello-Rahman barostatı (Parrinello & Rahman, 1981 ) kullanılarak basınç 1 atm'de sabit tutuldu. 4,5 × 10 −5  bar −1 sıkıştırılabilirlik faktörü . Tüm kovalent bağlar LINCS algoritması kullanılarak kısıtlandı ve kişi listesi her 40 fs'de bir güncellendi.

                  En çok yanaşan menkul kıymet bileşikleri için ilaç benzerliği endekslerinin tahmini
                  Diğer ADME özellikleriyle birlikte ilaca benzerlik tahmini, hızlı ve yeni bir antiviral ilaç keşfi için geniş bir fırsat sunar. U. tomentosa özütünün (en yüksek bağlanma afinitesine sahip bileşenler) en aktif bileşenleri için ilaca benzer ve ADME özellikleri , Molinspirasyon gibi açık erişimli kimformatik platformlar (moleküler ağırlık için - MW, döndürülebilir bağlar ve polar yüzey alanı için) kullanılarak tarandı. - PSA tanımlayıcıları), ALOGPS 2.1 (log P o / w tanımlayıcı için) ve Pre-ADMET 2.0, bağırsak geçirgenliği (App. Caco-2), albümin bağlayıcı proteinler ( K HSA), Madin – Darby Köpek Böbrek (MDCK Hattı) hücre geçirgenliği ve bağırsak absorpsiyonu (% HIA). Bu parametreler, potansiyel ilaçların hareketini, geçirgenliğini, emilimini ve etkisini belirler (Ertl ve diğerleri, 2000 ). PreADMET kullanılarak hem MDCK hem de Caco-2 geçirgenliğinin yorumu aşağıdaki gibidir: (1) 25'ten düşük geçirgenlik: düşük geçirgenlik; (2) 25 ile 500 arası geçirgenlik: orta geçirgenlik; (3) 500'den yüksek geçirgenlik: yüksek geçirgenlik.

                  Şuraya gidin: Sonuçlar ve tartışma

                  U. tomentosa biyoaktif bileşiklerin veritabanı
                  Bu çalışma, U. tomentosa özütlerinin belirli bileşenlerinin COVID-19'a karşı potansiyel terapötik etkilere sahip olup olmadığını belirlemek için yapıldı . Bu amaçla, bitkisel terapötik aktivitede yaygınlık gösteren 26 bileşikten oluşan bir veri tabanı oluşturulmuştur (Şekil 1) (Aquino vd., 1990 , 1997 ; Batiha vd., 2020 ; Keplinger vd., 1998 ; Kitajima vd., 2000 ; Lima-Junior vd., 2013 ; Lock vd., 2016 ; Montoro vd. ark., 2004 ; Navarro vd., 2019 , 2017 ; Pavei vd., 2012 ; Peñaloza vd., 2015 ; Snow vd., 2019; Vera-Reyes vd., 2015 ). İlk hipotezimiz, kedi pençesinin SARS-CoV-2 / ACE-2 ilişkisini bozarak veya SARS-CoV-2 diken proteinini inhibe ederek SARS-CoV-2'ye karşı en yüksek terapötik profilleri olan molekülleri içermesi gerektiğidir.


                  Bir resim, illüstrasyon vb. İçeren harici bir dosya. Nesne adı TBSD_A_1837676_F0001_B.jpg'dir.

                  U. tomentosa'nın başlıca biyoaktif bileşenleri için 2D yapılar, SARS-CoV-2 / ACE-2 birliğine ve SARS-CoV-2 diken proteinine karşı ligand olarak çalışıldı.

                  Yapı tabanlı sanal tarama: Yerleştirme çalışmaları
                  Covid-19 konak enfeksiyonu sırasında SARS-CoV-2, RBD'nin ACE-2 proteinine ilk moleküler tanıması yoluyla insan epitel hücrelerine girer. Koronavirüsler doğrudan ACE-2'nin peptidaz alanına (PD) bağlandığında, vazokonstriksiyon ve kan basıncı regülasyonunu içeren birincil fizyolojik rollerinin kaybına neden olur. Sonuç olarak, SARS-CoV-2 RBD'nin insan ACE-2 reseptörüne bağlanması, hipertansiyon, kalp krizi ve kronik nefropatiler gibi kardiyovasküler hastalıklarla güçlü bir şekilde ilişkilidir. SARS-CoV-2'nin insan ACE-2 reseptörüne bağlanmasının bloke edilmesi, virüsün insan hücrelerine girmesini önlemek için en umut verici yaklaşımla sonuçlanabilir. Son zamanlarda, SARS-CoV-2'nin RBD'sinin insan ACE-2 ile kriyo-EM ko-kristal yapıları çözüldü (Yan ve diğerleri, 2020), viral enfeksiyonun baskılanması için daha iyi ve daha spesifik inhibitörler tasarlama olasılığını açar.

                  Bu nedenle, kedinin pençesinin SARS-CoV-2 / ACE-2 kompleksine karşı etkinliğini incelemek için, uyuşturulabilir site olarak ACE-2-RBD bağlama arayüzünde yerleştirme yaklaşımları uygulandı ve seçilen bölge ile kedi pençesinin temel bileşenleri. Ayrıca, kedi pençesinin bileşenlerinin SARS-CoV-2 başak proteini ile olası bir ilişkisini bulmak için moleküler yerleştirme çalışmaları yaptık. Bu yaklaşım aynı zamanda, insan reseptörü ACE-2 ile SARS-CoV-2 spike protein etkileşimini bloke edebilir. Bu nedenle, bu makalede, spike glikoproteinin yapısı (PDB ID: 6VYB) ek bir ilaçlanabilir hedef olarak düşünülmelidir. Ek olarak, pozitif referans olarak sülfatlanmış bir heparin oktasakkaritin (HepOS) kenetlenmesini de gerçekleştirdik,2020 ).

                  Genel olarak, yerleştirme yaklaşımı, kedinin pençesinde bulunan bileşenlerin çoğunun, ACE-2 – RBD kompleksinin arayüzünde –6.0 ila –8.6 kcal aralığında önemli bağlanma afinitesi gösterdikleri için SARS-CoV-2 / ACE-2 ilişkisini engelleyebileceğini ortaya çıkarmıştır. mol –1 (tablo 1). Öte yandan, yapılar SARS-CoV-2 spike proteinine karşı kenetlendiğinde, –5.5 ile –7.2 kcal mol –1 arasında değişen iyi havuz skorları (özellikle Proantosiyanidin serileri) elde edildi .

                  Bu nedenle, SARS-CoV-2 ile ilgili enzimlere karşı kenetlenme gerçekleştiğinde bu bileşiklerden elde edilen kenetlenme çözeltilerinin titiz bir araştırmasını yaptık. Bu nedenle, bu farklı sonuçların analizine ve görsel incelemeye dayanarak, moleküler yerleştirme boyunca aşağıdaki bölümlerde özetlenebilecek net bir davranış ortaya çıkar.

                  RBD / ACE-2 arayüzü içinde yerleştirme profili
                  SARS-CoV-2'nin insan ACE-2 tarafından tanınması birkaç temasa bölünebilir. ACE-2 yapıdan: a 1 helis alanı gibi GLN24, THR27, ASP30, LYS31, HIS34, GLU35, ASP38, TYR41, GLN42, GLU37, PHE390 ve GLN388 olarak 12 kritik amino asitler ihtiva eder; SARS-CoV-2'yi tanımak için MET82 çevresinde bulunan α 2 sarmal alanı ve β 3 ile β 4 yaprak arasında dört kalıntı (LYS353, GLY354, ASP355 ve ARG357) gereklidir. SARS-CoV-2 yapısından, LYS417, GLN493, TYR453, TYR505, TYR449, ASN501, GLN498, THR500, GLN474 ve PHE486 gibi ACE-2 bağlanması için on kalıntı gereklidir. Bu nedenle, bu önemli bağlama alanları bu makalede U. tomentosa'nın yeteneğini keşfetmek için düşünülmüştür.SARS-CoV-2 RBD'nin insan ACE-2 ile etkileşimini bozmak için (Yan ve diğerleri, 2020 ).

                  Genel olarak, tüm bileşikler bir parçası olarak tomentosa U. sabitlenmiş özellikle α birlikte, RBD / ACE-2 arayüzüne iyi uyum yapılarını gösterir 1 , α 2 β, 3 ve β 4 insan ACE-2'nin alan (şekil 2) ve –6.0 ile –8.6 kcal mol –1 (tablo 1). Hesaplamalar, ligandların çoğunun β 3 ve β 4 tabakaları arasında bulunduğunu ve ACE-2'nin α 1 ve α 2 sarmalına çok yakın bir indirgenmiş grubun bulunduğunu ortaya çıkardı . Viral enfeksiyon sırasında α 1 , α 2 , β 3 ve β 4 alanları SARS-CoV-2'nin insan ACE-2 tarafından tanınmasından sorumlu olduğundan, bulgularımız U. tomentosa'yı SARS-CoV-2 / ACE-2 ilişkisi.
                  Bir resim, illüstrasyon vb. İçeren harici bir dosya. Nesne adı TBSD_A_1837676_F0002_C.jpg'dir.

                  ACE-2-RBD bağlanma arayüzü Uncarine F (mavi), Cadambine (kırmızı), 3-izodihidrokadambin (turuncu), Proanthocyanidin B2 (açık mavi), Proanthocyanidin B4 ( mor mavi), Proantosiyanidin C1 (sıcak pembe), Epiafzelechin-4β-8 (zeytin), QAG-1 (sarı), QAG-2 (gri), QAG-4 (mor), QAG-5 (siyah renkte), QAG-6 (somonda) ve HepOS (bluemarine'de) pozitif referans olarak.

                  Özellikle tahmin edilen komplekslerin çoğu, ACE-2-RBD bağlanma arayüzünün bir parçası olarak kritik kalıntılarınkilerle etkileşim parmak izine sahiptir. RBD / ACE-2 kompleksinin 26 bileşeninin protein-ligand etkileşim analizi, bileşenlerin çoğunun ACE-2'ye HIS34, ASP30, GLU37, PHE390, GLN388, LYS353, THR27, GLU35 kalıntıları ve bu arada SARS ile güçlü bir şekilde bağlandığını ortaya çıkarmıştır. -CoV-2 RBD, TYR505, TYR453, LYS417, TYR449 kalıntıları ile kritik temas gösterdi. Kedinin pençesinin bir parçası olan bu bileşikler ve ACE-2-RBD bağlanma arayüzü içindeki anahtar aminoasitlerle etkileşim nedeniyle, U. tomentosa'nın SARS-CoV-2 başak proteininin ACE-2 ile etkileşimini etkileyebileceğine inanmamız önerilir . Bu yaklaşımın COVID-19'u önlemek veya tedavi etmek için hızlı bir tedavi seçeneği olarak faydalı olabileceğini unutmayın.

                  Basit bir görünüm, tüm ligandların, RBD'nin ACE-2 proteinine moleküler olarak tanınmasında yer alan kritik aminoasitlerle etkileşime girebildiğini gösterdi; burada her kimyasal seriden en az bir bileşik, SARS-CoV-2'ye bağlanma konusunda büyük yetenek gösterdi. Arayüz boyunca -RBD kompleksi. Bu nedenle, Proanthocyanidin C1 (–8.6 kcal mol −1 ), QAG-2 (–8.2 kcal mol −1 ), 3-isodihydrocadambine ( Pozitif referans HepOS'tan (–7.3 kcal mol −1 ) daha yüksek veya benzer afiniteye sahip olan –7.6 kcal mol −1 ), Uncarine F (–7.1 ​​kcal mol –1 ) ve Uncaric asit (–7.0 kcal mol −1 )) SARS-CoV-2-RBD kompleksine (tablo 1). Bu noktada, pozitif referansı içeren yanaşma hesaplamalarının deneysel olanla (–7.3 kcal mol ) 1 ) çok iyi bir uyum içinde bir değer verdiğini ve dolayısıyla bu projenin Autodock puanlama işlevi ile ilgili belirli bir miktar güven sağladığını belirtmekte fayda var.

                  DS görselleştirici programından oluşturulan ACE-2-RBD arayüzüne ligand etkileşimlerinin ayrıntılı bir 2D çizimi, en çok yanaşan aktif ligandlar tarafından hangi etkileşimlerin yer aldığını ve yapılarının onları nasıl etkilediğini ortaya çıkardı. Bu nedenle, en aktif kenetlenme ligandı Proanthocyanidin C1 (afinitesi −8.6 kcal mol −1 olan), SARS-CoV-2 sivri ucunu insan ACE-2 reseptörüne bağlamak için bu kritik aminoasitlerle etkileşime girebildi. Proantosiyanidin C1'in, flavon parçasındaki hidroksil grupları arasında TYR505 (SARS-CoV-2) ve ASP30 (ACE-2 reseptörü) kalıntıları, LYS417 kalıntısı ile bir π-alkil etkileşimi ve aralarında birkaç hidrofobik etkileşim kurduğunu bulduk. molekül ve GLU37, GLN388, LYS353, PHE390, THR37 ve HIS34 kalıntıları. Bu kritik aminoasitlere ek olarak, Proantosiyanidin C1, insan ACE-2 reseptörü ile arayüze çok yakın, ALA386, THR92, LYS26 ve ALA337 gibi RBD'nin ACE-2 ile etkileşimini de etkileyebilecek dört hidrojen teması yoluyla dikkate değer bağlanma etkileşimleri ortaya çıkardı. (Şekil 3 (A)).
                  Bir resim, illüstrasyon vb. İçeren harici bir dosya. Nesne adı TBSD_A_1837676_F0003_C.jpg'dir.
                  Ayrı bir pencerede aç
                  Figür 3.
                  A, B: ACE-2 – RBD arayüzünde (PDB: 6M17) Proantosiyanidin C1 (A) ve QAG-2 (B) 'nin en iyi uyumu. ACE-2 – RBD kompleksine seçilen bileşikler arasındaki 2D etkileşim modu grafikleri. ACE-2-RBD bağlanma alanına her bileşen ve amino asit kalıntıları arasındaki etkileşimler, kesik çizgilerle gösterilir. Daireler halinde D ve F, sırasıyla ACE-2 ve Spike proteinlerini gösterdi.

                  Bundan başka, QAG-2 (-8.2 kcal mol yüksek bir yerleştirme puan göstermek mümkün olan en iyi bağlanma poz daha yakından bakıldığında, -1 ), iki protein arasındaki temas ara yüzeyde kuvvetli etkileşimleri gösterir. Böylece, QAG-2'nin , ACE-2 proteininde -3 ve -4 tabakaları arasında bulunan kritik aminoasitler LYS353 ve ASP355 ile iki hidrofobik etkileşim oluşturduğu bulunmuştur . Ayrıca, QAG-2'nin güçlü hidrojen bağı aracılığıyla VAL407 (spike proteinden) ile arayüzde bir etkileşim gösterdiğini gözlemledik. Ayrıca SARS-CoV-2 RBD – ACE-2 arayüzünde molekül ile SER375, PHE377, VAL510, CYS379, ILE410, GLY404, ASP405, PHE356, ALA386, ARG408 ve GLY502 arasında çeşitli hidrofobik temaslar gözlemlendi (Şekil 3 (B)). Protondan arındırılmış karboksilat kısmının herhangi bir önemli etkileşim oluşturmadığına, bu nedenle RBD-ACE-2 arayüzünde QAG-2 bağlanmasında herhangi bir spesifik rol oynamadığına dikkat edin. Bu gerçek, öncelikle pozitif yüklü kalıntıların (lizin, arginin veya histidin) arayüzde bu kısmı çevrelememesi nedeniyle açıklanabilir.

                  Diğer tarafta, 3-izodihidrokadambin (–7.6 kcal mol –1 ), RBD / ACE-2 bağlanma arayüzünde (Şekil 3 (A)). Bu nedenle molekül, SARS-CoV-2 spike bağlanması için gerekli olan kritik insan ACE-2 kalıntılarıyla, aralarında bir hidrojen bağı teması ve GLU37 kalıntısı ile bir π-alkil etkileşimi olmak üzere çeşitli etkileşimler gösterdi. Önemli olarak, p-karbolin parçasındaki protonlanmış nitrojen atomu, ASP30'daki (ACE-2 proteininden) karboksil ile bir tuz köprüsü etkileşimi ve PHE390, THR27 ve GLN388 ile üç hidrofobik etkileşim oluşturur. Ayrıca, 3-izodihidrokadambin, ACE-2 tanıma sırasında bir ilk temas noktası olarak iyi rapor edilen SARS-CoV-2 diken proteininin TYR505 amino asidi ile önemli bir H-bağı temasına da sahipti. 3-İzodihidrokadambin ayrıca β-karbolin parçasındaki kaynaşmış aromatik halka ile anahtar kalıntı LYS417 ve GLU406 dahil olmak üzere sivri protein kalıntıları ile sekiz van der Waals teması arasında bir π-katyon etkileşimi gösterdi ASP405, GLN409, PHE456 LEU455, ASP405, TYR453 ve TYR421. SARS-CoV-2-RBD ve ACE-2 arasındaki etkileşimlerin kesintiye uğramasını teşvik edebilecek başka etkileşimler de gözlemlendi, bunların arasında arginin artıkları başına 393 (ACE-2 proteininden) ve 403 (diken proteininden) başına iki H-bağı oluşturuldu. ) şeker kısmı ile etkileşim.

                  İlginç bir şekilde, -7.1 kcal mol bağlanma afinitesi ile RBD / ACE-2 ara yüzünde Uncarine F bağlandığı -1 insan ACE-2 SARS CoV-2 tanınması için bu baz kalıntıları ile çeşitli etkileşim yoluyla (Şekil 3 (B)). SARS-CoV-2 spike proteininden insan ACE-2'nin HIS34'ü ve TYR505 ile iki güçlü hidrojen temasının yanı sıra, Uncarine F arayüzde LYS353, ASP30, PHE390, GLU37, TYR453 ve GLN388 gibi anahtar aminoasitlerle birkaç hidrofobik etkileşim gösterdi. . Son olarak, Uncaric asit için 2D etkileşim haritasının analizi (yerleştirme skoru −7.0 kcal mol −1 olan), ACE-2-RBD bağlanması için temel aminoasit kalıntıları ile önemli temasları ortaya çıkardı. Bu nedenle Uncaric asit, ACE-2'nin ASP30 kalıntısında hidroksil gruplarından biri ile bir hidrojen bağı yoluyla bağlanır. Ayrıca, molekül ve arayüzdeki bu anahtar kalıntıların beşi arasındaki hidrofobik etkileşimler şu şekilde gösterildi: HIS34, TYR453, PHE390, GLN388 ve TYR505. Özellikle, Uncaric asit, LEU29 (D), VAL93 (D), LYS26 (D), PRO389 (D) ve LYS417 gibi muhtemelen ACE-2 – RBD bağlanma bölünmesini teşvik edebilecek diğer arayüz kalıntılarıyla beş π-alkil etkileşimine sahipti. (F).

                  Yukarıda bahsedilene uygun olarak, yerleştirme çalışmalarımız, U. tomentosa'nın birkaç bileşeninin , SARS-CoV-2 spike proteininin insan ACE-2 reseptörü ile ilişkisini bozma yeteneğine sahip olabileceğini göstermektedir. Bu bileşenler arasında Proanthocyanidin C1 (–8.6 kcal mol −1 ), QAG-2 (–8.2 kcal mol −1 ), 3-isodihydrocadambine (–7.6 kcal mol −1 ), Uncarine F (–7.1 ​​kcal mol −1 ) ve Unkarik asit (–7.0 kcal mol- 1 ), bağlanma arayüzü için iyi tahmin edilen bağlanma afinitesine sahipti ve farkedilir enerji maliyeti olmadan buna doğal olarak erişebilirler. Bu bulgular, U. tomentosa'nın COVID-19 enfeksiyonunun ilk aşamasında uygulanabilir bir tedavi seçeneği olabileceğini düşündürmektedir .

                  SARS-CoV-2 spike RBD'ye karşı yerleştirme profili
                  Son zamanlarda, SARS-CoV-2 spike glikoproteininin kriyo-EM yapısı, kapalı ve açık durumlarında çözüldü (sırasıyla PDB ID: 6VXX ve 6VYB) (Walls ve diğerleri, 2020 ). SARS-CoV-2 spike protomer, NTD, RBD, FP, HR1 ve CD (Şekil 4). RBD alanı, konakçı hücre reseptörüne (ACE-2) bağlanmadan sorumlu olduğundan, yerleştirme araştırmalarımızı RBD'nin ACE-2 bağlanma yüzeyinin içine odakladık. Bu nedenle, yerleştirme hesaplamalarımızı gerçekleştirmek için başlangıç ​​yapısı olarak seçtik, SARS-CoV-2 spike glikoproteini açık haldeyken (PDB ID: 6VYB), çünkü son zamanlarda moleküler dinamik simülasyonları açık durumu SARS'ın en aktif formu olarak ortaya çıkardı. İnsan ACE-2'ye bağlanmak için CoV-2 spike (Gur ve diğerleri, baskıda). Bu nedenle, SARS-CoV-2 spike (PDB ID: 6VYB) üzerine yerleştirme çalışmaları, enfeksiyonun ilk adımında koronavirüs tanıma için moleküler temele ilişkin önemli bilgiler sağlayabilir.
                  Bir resim, illüstrasyon vb. İçeren harici bir dosya. Nesne adı TBSD_A_1837676_F0004_C.jpg'dir.

                  A – C: ACE-2 – RBD arayüzünde (PDB: 6M17) 3-izodihidrokadambin (A), Uncarine F (B) ve Uncaric asit (C) 'nin en iyi uyumu. ACE-2 – RBD kompleksine seçilen bileşikler arasındaki 2D etkileşim modu grafikleri. ACE-2-RBD bağlanma alanına her bileşen ve amino asit kalıntıları arasındaki etkileşimler, kesik çizgilerle gösterilir. 'D' ve 'F' kod harfi sırasıyla ACE-2 ve başak proteinlerini gösterdi.

                  TYR449, TYR453, GLY496, THR500, TYR505, LYS417, GLN493, ASN501 ve GLN498 (Lan ve diğerleri, 2020 ). Bu nedenle, U. tomentosa bileşenlerinin SARS-CoV-2 spike proteininin insan ACE-2 reseptörüne bağlanmasını bloke etme yeteneğini göstermek için yukarıda belirtilen kritik amino asitler etrafında moleküler yerleştirme çalışmaları yaptık, yani bu yerleştirme çalışmaları içeride gerçekleştirildi. RBD'nin ACE-2 bağlanma yüzeyi. Genel bir perspektiften, U. tomentosa'nın ana bileşenleri SARS-CoV-2'nin RBD'sine bağlandığında (–5.5 ila –7.2 kcal mol −1 arasında değişmektedir) ümit verici yerleştirme skorları elde edilmiştir.).

                  Bu nedenle, SARS-CoV-2 RBD içindeki U. tomentosa ve HepOS'un (pozitif referans) en fazla kenetlenme aktif bileşenlerinin en iyi bağlanma pozunu karşılaştırmak için ,Şekil 5 listelenen AutoDock puanlamasına göre en kararlı bağlanma pozlarını gösterir tablo 1RBD bağlanma alanındaki tüm bileşenler için. Pozitif referansın (HepOS) üst üste binmesi ve seçilen kenetlenmiş bileşikler için teorik olarak elde edilen en iyi konformasyon, U. tomentosa'nın etanolik ekstraktındaki ana bileşenlerin, kenetlenme işlemi sırasında bu bağlanma bölgesini işgal eden kararlı biçimlere uyum sağlayabildiğini gösterdi.
                  Bir resim, illüstrasyon vb. İçeren harici bir dosya. Nesne adı TBSD_A_1837676_F0005_C.jpg'dir.

                  A: SARS-CoV-2 başak protein protomer yapısı. Protomer alanları RBD (camgöbeği), NTD (mor), HR1 (sarı), CD (mavi) ve FP (yeşil). B: SARS-CoV-2 başak proteininin RBD alanını gösteren birleşik yüzeyi. Bağlama bölgesi camgöbeği ile görünür.

                  Özellikle, U. Tomentosa'nın tüm ana bileşenleri, SARS-CoV-2 RBD'nin H-bağları, π-temasları veya hidrofobik temaslar yoluyla insan ACE-2'ye bağlanması için anahtar aminoasitlerle en az iki etkileşime sahipti ve bu da bu bitkiyi umut verici bir tedavi haline getirdi. COVID-19 enfeksiyonunun erken aşamalarında kullanılabilir. Bunlardan dördü, RBD'yi bağlama potansiyeli yüksek: 3-dihidrokadambin (kahverengi), Proanthocyanidin B4 (mor mavi), Proanthocyanidin B2 (açık mavi) ve Proanthocyanidin C1 (pembe)Şekil 5), -7.1 en yüksek yerleştirme skoru olan, -7.2, -7.2 ve -7.0 kcal mol -1 , sırasıyla bu -7.3 kcal mol güçlü bir inhibitörü HepOS için rapor edilene benzer olacaktır -1 . Bu nedenle, RBD-ACE-2 etkileşimini engelleyebilecek kritik temasların aranmasında, aşağıda belirtildiği gibi bu bileşenler için yanaşma sonuçlarının kapsamlı bir analizi yapılmıştırŞekil 6.
                  Bir resim, illüstrasyon vb. İçeren harici bir dosya. Nesne adı TBSD_A_1837676_F0006_C.jpg'dir.

                  U. tomentosa'nın tüm bileşenlerinin en iyi uyumu ve SARS-CoV-2 RBD bağlanma alanı (PDB: 6VYB) ile birlikte pozitif referansların süperpozisyonu. Kritik aminoasitler, mavi denizde camgöbeği ve pozitif referans (HepOS) ile temsil edilir.

                  Da gösterildiği gibi Şekil 7Bulgularımız, SARS-CoV-2 RBD ile kompleks haline getirilmiş en çok kenetlenen aktif moleküllerin, insan reseptörü ACE-2'ye SARS-CoV-2 diken bağlantısında ima edilen yedi kritik kalıntıyı içeren bir etkileşim parmak izine sahip olduğunu ortaya çıkardı: TYR453, GLY496, LYS417 , ASN501, TYR505, GLN498 ve ASN501. Dolayısıyla, 3-dihidrokadambin, sırasıyla şeker ve asetil kısmı ve anahtar TYR453 ve GLY446 kalıntıları arasında bağlanma yoluyla iki güçlü H-bağı sergiler. Özellikle, TYR453 ayrıca P-karbolin parçasındaki kaynaşmış aromatik halka ile bir π – π istifleme etkileşimi kurmuştur. Ek olarak, RBD'den gelen kritik kalıntılar LYS417 ve ARG403, 3-dihidrokadambin ile üç c-katyon teması oluşturarak bağlanma olayına dahil olurken, ASN501, TYR449, GLN493, TYR505 kalıntıları ile oluşturulan hidrofobik etkileşimler, SARS-CoV- için afinitesini açıkça tercih etti. 2 başak proteini.

                  Bir resim, illüstrasyon vb. İçeren harici bir dosya. Nesne adı TBSD_A_1837676_F0007_C.jpg'dir.

                  RBD'nin ACE-2 aktif bölgesi içindeki en aktif ligandlar arasındaki 2D etkileşim modu grafikleri. SARS-CoV-2 RBD'nin her bir bileşeni ve kalıntıları arasındaki etkileşimler, kesik çizgilerle gösterilmiştir.

                  Bununla birlikte, 3-dihidrokadambinin 2D-protein-ligand etkileşim grafiğinin görsel bir incelemesi, protonlanmış nitrojenin, protein-ligand kompleksinin kararlılığında büyük öneme sahip olabilecek iki olumsuz pozitif-pozitif etkileşim (kırmızı noktalı çizgilerle temsil edilir) oluşturduğunu göstermektedir. .

                  Proantosiyanidin B2, fonksiyonel alan RBD'ye iyi bir şekilde yerleştirildi ve hidroksil grupları, sırasıyla GLY496, ASN501, GLN493 ve TYR505, TYR453, LYS417, GLN498 dahil olmak üzere ACE-2'ye bağlanmak için kritik kalıntılarla dört hidrojen bağı ve dört hidrofobik temas oluşturdu. Proantosiyanidin B2, SARS-CoV-2 RBD'ye bağlandığında, SER494 ve bir hidroksil grubu ile başka bir H-bağı, kenetlenme ile tahmin edildi. Son olarak, Proantosiyanidin C1, SARS-COV-2 RBD'yi insan ACE-2 ile ilişki için çok önemli olan kritik kalıntılarla (GLY496, LYS417, ASN501) üç güçlü H-bağı aracılığıyla bağlayabildi. Ayrıca, Proantosiyanidin C1 ve RBD alanına bağlanma olayını stabilize edebilen önemli GLN498, TYR453, GLN493, TYR505, GLN498 kalıntıları arasında daha fazla van der Waals etkileşimlerinin oluşacağı tahmin edildi.

                  MD simülasyon çalışmaları
                  Örneğin proantosiyanidin C1 (-8.6 kcal mol olarak en yüksek bağlanma afinitesi olan en iyi bileşiğin eden yerleştirme tahminler, canlılığı üzerindeki yüksek güvenle -1 ) ve QAG-2 (-8.2 kcal mol -1 RBD / ACE-2 içinde) SARS-CoV-2 RBD bağlanma alanı içinde 3-dihidrokadambin (–7.1 ​​kcal mol −1 ) ve Proanthocyanidin B2 (–7.2 kcal mol −1 ), 50.0 ns için MD simülasyonları boyunca kenetlenmiş komplekslerin stabilitesini daha da değerlendirdik. Bu amacı gerçekleştirmek için, ilk önce seçilen bağlanma cebine gerçek doğal koşullarda 50 ns MD simülasyonu için ligandlar için kök ortalama kare sapmayı (RMSD) hesapladık. MD simülasyon sonuçları (Şekil 8 (A – D)), sistemlerin RMSD'sinin yaklaşık 5 ns simülasyon süresinden sonra dengeye ulaştığını gösterdi. Genel olarak, dengelemeden sonra, RMSD'de küçük dalgalanmalar gözlemlendi, bu da simülasyonlar sırasında tüm kompleksler için önemli bir kararlılık olduğunu düşündürdü; bu, 2 Å civarında ideal aralıkta yer alır (daha küçük RMSD değerleri, simülasyonun daha yüksek kararlılığını gösterir) (Gohlke ve diğerleri, 2000 ; Kramer ve diğerleri, 1999 ).

                  Bir resim, illüstrasyon vb. İçeren harici bir dosya. Nesne adı TBSD_A_1837676_F0008_C.jpg'dir.

                  SARS-CoV-2 RBD aktif bölgesi (kırmızı) ve ligandsız protein (mavi) içindeki (A) 3-dihidrokadambinin omurga RMSD değerleri. B: SARS-CoV-2 RBD bağlanma bölgesi (kırmızı) ve ligandsız protein (mavi) içindeki proantosiyanidin B2. C: RBD / ACE-2 arayüzünde proantosiyanidin C1 ve ligandsız (mavi) RBD / ACE-2 kompleksi. D: QAG-2, RBD / ACE-2 arayüzüne (kırmızı) ve ligandsız RBD / ACE-2 kompleksine (mavi).

                  Ligand-SARS-CoV-2 RBD kompleksleri için RMSD değerlerinin titiz bir araştırması, 3-dihidrokadambin ve Proantosiyanidin B2 yapılarının, 1.866 ± 0.300 ve 2.233 ± 0.304 Å RMSD değerleri ile 50 ns MD simülasyonu sırasında iyi stabilite sinyalleri gösterdiğini göstermektedir. , sırasıyla (Şekil 8 (A, B)). Önemli olarak, benzer davranış, sırasıyla 2.151 ± 0.237 ve 1.775 ± 0.361 RMSD değerlerinde simülasyon süresi boyunca dikkate değer bir stabilite sergileyen, RBD / ACE-2 arayüzüne Proantosiyanidin C1 ve QAG-2'den oluşan kenetlenmiş komplekse sahipti (Şekil 8 (C, D)). RBD / ACE-2 arayüzüne QAG-2 için RMSD grafiğine daha yakından bir bakış, ligandın 5 ns'den sonra kademeli olarak stabilize olduğunu ortaya çıkardı; bu, RBD ve ACE-2 proteinleri arasındaki arayüzdeki daha yüksek konformasyonel esnekliğinin bir göstergesidir. Birlikte ele alındığında bu bulgular, ligandların SARS-CoV-2 RBD ve RBD / ACE-2 viral hedeflerinin aktif alanlarına doğru bağlanma stabilitesini gösterir.

                  Dönme yarıçapı ( R g ), protein yapısının kompaktlığını ve tüm sistemlerin (yani protein-ligand kompleksleri) konformasyonel stabilitesini temsil eder. Dönme yarıçapı nispeten sabit kalırsa, kompleksin kararlı bir şekilde katlandığı kabul edildi; aksi takdirde, katlanmamış olarak kabul edildi. Bu senaryoda, 50 ns simülasyon süresi içinde her bir viral proteinin konformasyonel değişimlerini ve dinamik stabilitesini gözlemlemek için dönme yarıçapı değerleri hesaplanmıştır.

                  Şekil 9 (A – D)görüntülemektedir R, g , sırasıyla komplekslerde protein ve ligand için değerleri. Da gösterildiği gibiŞekil 9 (A – D), 3-dihidrokadambin (5.065 ± 0.144 Å), Proantosiyanidin B2 (4.356 ± 0.087 Å) için SARS-CoV-2 RBD proteinine ligandlar için hesaplanan R g değerleri ve Proantosiyanidin C1 (5.542 ± 0.095 Å) ve QAG-2 (6.818 ± 0.083 Å) simülasyon sırasında nispeten sabit kaldı, bu nedenle her bir protein-ligand kompleksinin kararlı bir şekilde katlandığı düşünülebilir. RMSD değerleri ligandlar olarak etkin alanları içinde önemli bir değişiklik geçirebilir gösterecektir, ancak ek olarak, tahmin edilen R ' g değerleri proteinin genel şekli 50 ns MD simülasyonu sırasında ligand bağlanması üzerine kararlı olduğunu göstermektedir.

                  Bir resim, illüstrasyon vb. İçeren harici bir dosya. Nesne adı TBSD_A_1837676_F0009_C.jpg'dir.

                  Dönme yarıçapı ( R g ) grafikleri: (A) 3-dihidrokadambinin bağlanma boşluğuna (kırmızı) ve SARS-CoV-2 spike proteini için ligandsız (mavi). B: Proanthocyanidin B2 için aktif bölge (kırmızı) ve SARS-CoV-2 spike proteini için ligand (mavi). C: Bağlanma yarığı içindeki Proantosiyanidin C1 ve ligandsız (mavi ve mor) RBD / ACE-2 kompleksi için. D: QAG-2 için bağlanma bölgesi (kırmızı) ve ligand içermeyen RBD / ACE-2 kompleksi (mavi ve mor).

                  Son olarak, bu gözlemler ayrıca 2D bağlanma etkileşimleri çizimleri ve sırasıyla bağlanma cebine seçilen ligandların 3D gösterimi ile desteklenir (bkz. Destekleyici bilgiler Şekiller S1-S4). Ek olarak, ligandların ilk 50 ns pencere MD simülasyonu boyunca viral proteinlerin aktif bölgesine konformasyonel değişikliklerini göstermek için (Figür 9), bu grafikler, MD simülasyonlarından sonra başlangıçta yerleştirme sonuçlarıyla gösterilen temel protein-ligand etkileşimlerinin korunduğunu ve SARS-CoV-2 RBD içindeki 3-dihidrokadambin ve Proantosiyanidin B2'nin yanı sıra RBD / ACE-2'de Proantosiyanidin C1 olduğunu ortaya çıkardı. ilk yanaşma pozuna kıyasla ciltleme cebinde sabit kaldı. Bu nedenle, 50-ns MD simülasyonundan sonra SARS-CoV-2 RBD'nin bağlanma cebine LYS417, ARG403, TYR453, GLN493, ASN501, TYR505, SER494, TYR449, TYR495 PHE497 ve GLY496 ile önemli bağlanma ligand etkileşimleri sürdürüldü. Benzer şekilde yerleştirme sonuçlarına kıyasla, RBD-ACE-2 stabilitesini korumak için esas olarak tanımlanan amino asit kalıntıları ile bu anahtar ligand etkileşimleri de MD simülasyonlarından sonra mevcuttur. Dışında, MD simülasyonundan ve yerleştirmeden en iyi konformasyon pozlarını karşılaştırmak amacıyla seçilen ligandların her bir ciltleme cebine 3B temsilleri kullanıldı, bu nedenle 50 ns MD simülasyonundan önce ve sonra yerleştirilmiş karmaşık 3B yapıların aktif olana süperpozisyonunu çizdik. boşluk (bkz. Destekleyici bilgiler Şekiller S5 – S8). Genel olarak, 50-ns MD simülasyonundan sonra çıkarılan yapılar ile ligandların kenetlenme pozisyonu arasında önemli bir fark yoktur, sadece hafif öteleme ve dönme hareketleri gözlenmiştir.

                  Elde edilen MD simülasyon sonuçları, (1) bağlanma cebinin ve ligandların konformasyonunun MD simülasyonları sırasında stabil olduğunu, (2) ligandların MD simülasyonunu çalıştırırken bağlanma cebini terk etmediğini ve (3) tercih edilen her iki seçilmiş viral hedefte aktif cep olduğunu göstermektedir. Sadece yerleştirme çalışmalarımızın rasyonelliğini ve geçerliliğini değil, aynı zamanda U. tomentosa'nın bu bileşenlerinin çoğunun SARS-CoV-2 spike proteini ve RBD / ACE-2 kompleksinin ikili inhibitörleri olarak hareket edebileceğini öne süren ligand bağlanması , Bunlar çoğunlukla yeni koronavirüsün insan konakta bağlanması ve içselleştirilmesinden sorumludur.

                  Son aşamada, seçilen ligandlar, SARS-CoV-2 RBD'ye (3-dihidrokadambin ve Proantosiyanidin B2) veya RBD / ACE-2 arayüzüne (Proantosiyanidin C1 ve QAG-2) sonuncunun ortalama geometrilerinden başlanarak yeniden kenetlendi. Doğru bağlama enerjilerini ve pozlarını elde etmeyi amaçlayan 3 ns MD simülasyon yörüngeleri. Vina yeniden yerleştirilmiş sonuçlar şurada özetlenmiştir:Tablo 2 ve en iyi ligand bağlı reseptör biçimleri Destekleyici bilgiler Şekil S9 – S12'de gösterilmektedir.

                  Tablo 2.


                  Aktif bölgesinde her ligandın yeniden kenetlenmesi için enerjileri ve kritik etkileşimleri puanlama.
                  3-Dihidrokadambin a –7.1 –7.5 ASN501 (H-bağı), GLY496 (üç H-bağı), TYR453 (H-bağı), TYR505 (-katyon) ve hidrofobik etkileşimler: PHE497, TYR495, TYR449, GLN493, GLN498, GLU406.
                  Proantosiyanidin B2 a –7.2 -6.5 ARG403 (H-bağı), SER494 (H-bağı), LYS417 (H-bağı), ARG403 (π-katyon), GLU406 (π-anyon) TYR505 (π – π yığılmış) ve hidrofobik etkileşimler: PHE497, TYR453, TIR495 , GLN409.
                  Proantosiyanidin C1 b -8.6 -9.0 GLN388 (H-bağı), ASP30 (iki H-bağı), TYR505 (H-bağı), ASP405 (H-bağı), ARG408 (H-bağı), ARG403 (H-bağı), ALA387 (amid-π istifleme etkileşimi ) ve hidrofobik etkileşimler: HIS34, PHE390, GLU37, LYS353, GLY354, LYS417.
                  QAG-2 b -8.2 -8.1 TYR505 (H-bağı), GLY354 (H-bağı) ve hidrofobik etkileşimler: GLU37, GLN388, LYS353 ve ASP355.
                  a SARS-CoV-2 RBD aktif sahası içinde yeniden kenetlenme.
                  b RBD / ACE-2 arayüzüne yeniden yerleştirme.
                  Özellikle, yeniden yerleştirilmiş bir işlem 3-dihydrocadambine ekranlar sonra daha yüksek bağlanma enerjisi (-7.5 kcal.mol -1 ) ilk tahmin edilen yerleştirme puanından (-7.1 kcal.mol -1 ). 3D koordinatlardan protein-ligand etkileşimlerinin 2D ve 3D diyagramları, 3-dihidrokadambinin, başlangıçta kenetlenme ile tahmin edilen gözlemlenen bağlanma pozlarına kıyasla bağlanma modlarında önemli bir konformasyonel değişikliğe sahip olduğunu gösterdi. Görülebileceği gibiTablo 2SARS-CoV-2 RBD bağlanma sahasındaki etkileşim profili, ASN501 (H-bağı), GLY496 (üç H-bağı), TYR453 (H-bağı), TYR505 (π) dahil olmak üzere bu kritik kalıntılarla temasları göstererek önemli ölçüde değiştirildi. katyonik nitrojen ile katyon). Öte yandan, Proanthocyanidin B2, ilk yerleştirmeden önemli ölçüde daha düşük bir yeniden yerleştirme puanı göstermesine rağmen. Bununla birlikte, okuyucular, Proantosiyanidin B2'nin, SARS-CoV2'nin insan ACE-'sine bağlanması için gerekli olan TYR453, SER494, LYS417, GLN493, ARG403, TYR495, TYR505, GLU406 ve PHE497 ile temel temasları vurgulayan RBD bağlama cebi içinde iyi yerleştirildiğini gözlemleyebilirler. 2 reseptör. Ek olarak, tahmin edilen bağlanma pozları Destekleyici bilgi Şekil S10'da karşılaştırılmıştır, bu nedenle yeniden yerleştirme çalışmalarından elde edilen en iyi bağlanma pozu, ilk yerleştirmeden elde edilenden önemli ölçüde farklıdır.

                  İlginç bir şekilde, Proanthocyanidin C1, son 3 ns MD simülasyon yörüngesinin ortalama geometrisi kullanılarak yeniden kenetlendiğinde , ilk kenetlemeden daha yüksek bir bağlanma puanı (-9.0 kcal mol- 1 ) elde edildi (-8.6 kcal mol- 1 ). Destekleyici bilgiler Şekil S11'de gösterildiği gibi, Proantosiyanidin C1, SARS-CoV-2 ile insan ACE-2 birleşimindeki bu kritik kalıntılarla etkileşime giren RBD / ACE-2 arayüzüne iyi uyum sağlar, örneğin GLU37, HIS34, ASP30, GLN388 , TYR505, PHE390, LYS353, GLU354, LYS417. En iyi ilk yerleştirme pozu ile aktif bölgeye en iyi yeniden yerleştirme pozu arasındaki 3 boyutlu bir karşılaştırma, bu bağlanma pozunun Proantosiyanidin C1 bağlanmasını önemli ölçüde desteklediğini açıkça ortaya koydu.

                  Son olarak, QAG-2 RBD / ACE-2 arayüzüne yeniden yerleştirme hesaplamalar, çok benzer bir bağlanma afinitesi (-8,1 kilokalori mol gösterdi -1 ilk yerleştirme tahminine) (-8.2 kcal mol -1). 2D ve 3D ligand-protein diyagramları grafiğinin yakından görünümü, QAG-2'nin bağlanma cebi içinde iyi oturduğunu ve ACE-2 proteininde β3 ve β4 yapraklara kapalı olarak yerleştirildiğini ortaya çıkardı. Yeniden yerleştirilen işlem, QAG-2'nin tam uzunlukta insan ACE-2 tarafından SARS-CoV-2'nin tanınması için kritik olan aminoasit kalıntılarına bağlanabildiğini doğrular. Yeniden yerleştirme analizinden sonra, QAG-2'nin sırasıyla anahtar GLY354 ve TYR505 kalıntıları ile iki hidrojen bağı etkileşimi oluşturduğunu belirledik. Benzer şekilde ligand, bağlanma olayını stabilize etme üzerinde bir etkiye sahip olabilecek üç kritik kalıntı ASP355, GLN388 ve GLU37 ile van der Waals temasları boyunca bağlanabilmiştir. Destekleyici bilgiler Şekil S12'de görülebileceği gibi,

                  Birlikte ele alındığında, bu hesaplama sonuçları, U. tomentosa bileşenlerininkararlı komplekslerde insan ACE-2'ye viral bağlanma için çok önemli olan anahtar aminoasitlerle güçlü etkileşimler yoluyla SARS-CoV-2 spike proteinine bağlanabilir. Araştırmalarımız, SARS-COV-2 RBD'nin ACE-2 tarafından tanınmasını engellemek için yeni bir strateji olabilir ve bu nedenle koronavirüsün konak hücrelere girişini engelleyebilir. Hesaplamalı modelleme, bu bitkinin bileşenlerinin ACE-2'ye neden olabileceğini ve protein bölünmesine neden olabileceğini, çünkü RBD / ACE-2 arayüzündeki anahtar kalıntılarla etkileşime girerek çok kararlı kompleksler oluşturabileceğini gösterdi. Bu nedenle, kedi pençesinin etanolik özütünün COVID-19 enfeksiyonunu tedavi etmek için yeni bir bitkisel bazlı tedavi seçeneği olabileceğine inanıyoruz çünkü bileşenleri SARS-CoV-2 RBD / ACE-2 kompleksinin bozulmasına neden olabilir veya SARS'ın bağlanmasını engelleyebilir. -COV-2'den giriş reseptörü ACE-2'ye.

                  İlaç benzerliği endekslerinin hesaplanması ve puanlama
                  Hesaplanan ilaç benzerliği profilleri, yeni antiviral adayların kalitesinin değerlendirilmesinde kritik bir rol oynar. Gelecek vaat eden antiviral bileşiklerin yapısına dayalı olarak farmakokinetik davranışının erken tahminleri, klinik öncesi testler için daha güvenli ve etkili yolların bulunmasına yardımcı olabilir. Burada, yerleştirme çalışmalarıyla tahmin edilen U. tomentosa'nın en nitelikli bileşenleri için çeşitli ilaç benzerlik endekslerini hesapladık ve analiz ettik (Tablo 3). Bu amaçla Speciophylline, Uncarine F, Uncaric acid, Cadambine, 3-isodihydrocadambine, 3-dihydrocadambine, Proanthocyanidin B2, Proanthocyanidin C1, Proanthocyanidin B4, Epiafzelechin-4β-8, QAG- için ilaç benzerliği filtresi olarak on farmakokinetik parametre hesaplanmıştır. Sırasıyla 1, QAG-2, QAG-4, QAG-5 ve QAG-6. Elde edilen sonuçlar, kedi pençesinin etanolik ekstraktından seçilen bileşenlerin ilaç verilebilirliğini ortaya çıkardı ve olası oral olarak aktif antiviral potansiyellerini gösterdi. Tablo 3.


                  En nitelikli kedinin pençe bileşenleri için hesaplanan ilaç benzerliği özellikleri.
                  Speciophylline 368.432 82,804 1 8 1 1.709 -0.044 307 153 81 0
                  Uncarine F 368.432 85.271 2 6 1 1.826 -0.016 342 171 83 0
                  Uncaric asit 488.706 82.031 1 5 4 4.192 0.580 135 72 90 0
                  Cadambine 544.557 158.806 8 11 5 0.037 -0.592 27 11 27 1
                  3- i Dihidrcadambine 560.600 156.433 6 12 6 -0.707 -0.839 16 6 6 2
                  3-Dihidrokadambin 546.573 172.263 5 12 6 -0.576 -0.827 13 5 5 2
                  Proantosiyanidin B2 578.528 209.177 3 12 10 0,505 –0.300 1 1 <25 2
                  Proantosiyanidin C1 866.784 316.351 5 18 15 0.217 -0.336 0 0 0 3
                  Proantosiyanidin B4 578.528 209.177 3 12 10 0,505 –0.300 1 1 <25 2
                  Epiafzelechin-4β-8 562.529 191.954 3 11 9 0.880 -0.149 5 1 6 2
                  QAG-1 957.117 312.05 10 19 11 -0.455 –1.266 1 0 0 3
                  QAG-2 957.117 263.06 10 19 11 -0.455 –1.266 1 0 0 3
                  QAG-4 780.948 204.447 7 14 8 1.491 -0.443 5 2 10 3
                  QAG-5 796.948 226.081 8 15 9 0.434 -0.924 2 0 0 3
                  QAG-6 780.948 204.507 7 14 8 1.220 -0.677 6 2 9 3
                  HepOS j 2291.77 1373.67 46 80 12 <0.0 - - - - 5
                  Ayrı bir pencerede aç
                  a Hibridin moleküler ağırlığı (150–500).
                  b Polar yüzey alanı (PSA) (7.0–200 Å 2 ).
                  c n -ON hidrojen bağı alıcısı sayısı <10.
                  d n -OHNH sayısı hidrojen bağları donör ≤5.
                  e Oktanol su bölme katsayısı (log P o / w ) (–2.0 - 5.0).
                  f Bağlayıcı serum albümini ( K HSA ) (–1,5 ila 1,5).
                  g İnsan bağırsak geçirgenliği (<25 zayıf,> 500 büyük).
                  h Madin – Darby köpek böbrek (MDCK) hücre geçirgenliği.
                  i İnsan bağırsak emilimi (% SED) (>% 80 yüksek, <% 25 zayıf).
                  j Heparin oktasakkarit bu çalışmada pozitif referans olarak kullanılmıştır.
                  Ana bileşenlerin 5 kuralı ve uyuşturulabilirlik için ikiden fazla ihlali olmasına rağmen, Speciophylline, Uncarine F, Uncaric asit ve Kadambin için tahmin edilen değerler, ROF-5'te açıkça önemli ihlaller sergileyen pozitif referans HepOS ile karşılaştırıldığında olumlu fizyokimyasal profiller sergilemiştir. Bu dört aktif bileşiğe odaklanan tartışma, Lipinski'nin beş kuralına (ROF-5) göre (birden fazla ihlal kabul edilemez) gösterdi (Lipinski ve diğerleri, 2012), bileşikler insanlarda ağızdan alınan ilaçlar olarak kullanılabilir. Speciophylline, Uncarine F ve Uncaric asit için tahmin edilen insan bağırsak absorpsiyonu (% HIA),% 81 ile% 90 arasında daha yüksek HIA değeri ortaya koyarken,% 27'lik nispeten düşük değerlere sahip olan Cadambin, pazarlanan ilaçların% 95'i içinde kabul edilebilir olabilir. Daha yüksek SIA değerlerinin, bu bileşiklerin oral uygulama üzerine bağırsak segmentleri boyunca absorbe edilebileceğini gösterdiğine dikkat edin. Öte yandan, membranlar aracılığıyla pasif moleküler taşınımla ve polar yüzey alanı (PSA) gibi ilaç-membran etkileşimleriyle ilişkili en önemli fizikokimyasal özelliği hesapladık (Ertl ve diğerleri, 2000 ). Öngörülen PSA, 82 ila 158 Å 2 arasında değişen bileşikler için uygun değerler gösterdibu da enfekte olmuş konukçu hücrelere daha verimli bir şekilde nüfuz edeceklerini gösterir. Ek olarak, bileşenlerin lipit çift katmanlarından geçme kabiliyetini keşfetmek için n- oktanol ve su (log P o / w ) arasındaki bölme katsayısı hesaplandı (Veber ve diğerleri, 2002 ). Özellikle, Speciophylline, Uncarine F ve Uncaric asit, onaylı ilaçlar için ideal aralıkta değerler sunmuştur (1,7 ile 4,20 arasında). Serum albümine bağlanma (log K HSA olarak ifade edilir ), sistemik dolaşımdaki antiviral ilaçların dağıtımı ve taşınması için en önemli parametredir (Colmenarejo, 2003 ; Zhivkova, 2015). Bu parametrenin erken tahmini, antiviral tedavi ve yönetimde ilaç geliştirme adayları için boşa harcanan zamanı ve kaynakları azaltır. Ligandların, –0.592 ile 0.58 arasındaki log K HSA sayılarını gösteren önerilen değerler aralığında (-1.5 ile 1.5 arasında değişen) iyi uyduğunu bulduk. Son olarak, model olarak Caco-2 hücre tek katmanlarını veya MDCK hücrelerini kullanarak pasif transmembran geçirgenliğini de tahmin ettik. Şu anda, her iki model de ilaç geliştirmede bağırsak emilimi için basitleştirilmiş bir in vitro model olarak kullanılmaktadır (Broccatelli ve diğerleri, 2016 ; Pham-The ve diğerleri, 2018 ; Press ve Di Grandi, 2008). Sonuçlarımız, referans ilaçlarla karşılaştırıldığında Speciophylline, Uncarine F ve Uncaric acid'in 72–342 nm / s'ye sahip olduğunu gösterdi. Bu tür gözlemlerden, bu bileşikler, referans ilaç değerlerine (% 96'nın üzerinde) çok benzer şekilde,% 81'in üzerinde büyük insan bağırsak emilim değerleri (% HIA) sergilemiştir.

                  Yukarıda belirtilen sonuçlar göz önüne alındığında, burada bildirilen kedi pençesinin en az dört bileşeninin ilaç gibi olumlu özellikler sağlayabileceğine inanıyoruz, bu nedenle U. tomentosa , COVID-19 enfeksiyonuna karşı savaşmak için bir taahhüt seçeneği oluşturabilir.

                  Silico yaklaşımlarını entegre ederek, bu makale U. tomentosa'nın birkaç bileşeninin SARS-CoV-2 spike proteininin insan ACE-2 reseptörü ile ilişkisini bozarak veya COVID-19 sırasında RBD-ACE-2 etkileşimini bloke ederek hareket edebileceğini kanıtladı. virülans. Ayrıca, kedi pençesinin çeşitli bileşenlerinin, potansiyel bir antiviral yanıt olarak oral yoldan kullanılacak optimal farmakokinetik özellikleri taşıdığını belirledik. Bu nedenle, U. tomentosa'nın etanolik özütünün , enfeksiyonun erken aşamalarında COVID-19'a hızlı bir yanıt olarak dikkate alınması gerektiğine inanıyoruz.

                  Sonuç
                  Çin'in Wuhan kentinden ortaya çıkan COVID-19 salgını, pandemi statüsüne kavuştu ve şiddetli akut solunum sendromu, dünya çapında etkilerini iyileştirmek için olası güvenli ve etkili ilacı keşfetmek için akademisyenlerin dikkatini gerektiriyor. Bu çalışmada, 26 U. tomentosa bileşeni , RBD-ACE-2'nin bağlanma arayüzüne ve yeni korona virüsünün SARS-CoV-2 RBD diken proteininin içine yerleştirilmiştir.

                  Proantosiyanidin C1, QAG-2, 3-izodihidrokadambin, Uncarine F ve Uncaric asit gibi U. tomentosa bileşenlerinin , sülfatlanmış heparin oktasakarit ile karşılaştırıldığında RBD-ACE-2 ara yüzü için iyi bir tahmini bağlanma afinitesine sahip olduğu gözlendi. (HepOS). Benzer şekilde, 3-dihidrokadambin, Proanthocyanidin B4, Proanthocyanidin B2 ve Proanthocyanidin C1, açık durumlarında SARS-CoV-2 spike glikoproteininde en yüksek kenetlenme skoruna sahipken, 50 ns'deki MD simülasyonları kenetlenme ile tahmin edilen bağlanma serbest enerjisinin hem uygulanabilirliğini gösterdi. protokoller ve kenetlenmiş protein-ligand komplekslerinin kararlılığı.

                  Sanal tahmin ADME, Speciophylline, Uncarine F ve Uncaric asitin Lipinski kuralına göre ilaç verilebilirlik değerleri sunduğunu ve bunların oral olarak aktif antiviral olarak potansiyel biyoyararlanımlarını gösterdiğini ortaya koydu. Bulgularımıza ve Güney Amerika ülkelerindeki geleneksel tıpta atalarından kalma kullanımına dayanarak, U. tomentosa , yeni koronavirüs hastalığının tedavisindeki etkinliğini değerlendirmek için hem klinik öncesi hem de klinik aşamalarda güvenlik ve etkinlik parametreleri ile bitkisel bir destek olarak uygulanabilir. (COVID-19). Ayrıca, U. tomentosa'da bulunan tüm bileşenler , SARS-CoV-2'nin yayılmasıyla mücadele etmek için farklı mekanizmalar tarafından sinerjizm içinde çalışabilir.

                  Ek materyal

                  Tamamlayıcı Materyal:
                  Açıklama bildirimi
                  Referanslar
                  • Abraham MJ, Murtola T., Schulz R., Páll S., Smith JC, Hess B. ve Lindah E. (2015). Gromacs: Dizüstü bilgisayarlardan süper bilgisayarlara kadar çok seviyeli paralellik yoluyla yüksek performanslı moleküler simülasyonlar . SoftwareX , 19–25. 10.1016 / j.softx.2015.06.001 [ CrossRef ] [ Google Akademik ]
                  • Akram M., Tahir IM, Shah SMA, Mahmood Z., Altaf A., Ahmad K., Munir N., Daniyal M., Nasir S., & Mehboob H. (2018). Tıbbi bitkilerin HIV, HSV, influenza, hepatit ve coxsackievirüse karşı antiviral potansiyeli: Sistematik bir inceleme . Fitoterapi Araştırması , ( 5 ), 811–822. 10.1002 / ptr.6024 [ PubMed ] [ CrossRef ] [ Google Akademik ]
                  • Aquino R., De Simone F., Vincieri FF, Pizza C. ve Gaćs-Baitz E. (1990). Uncaria tomentosa'dan yeni polihidroksile triterpenler . Doğal Ürünler Dergisi , ( 3 ), 559–564. 10.1021 / np50069a004 [ PubMed ] [ CrossRef ] [ Google Scholar ]
                  • Aquino R., De Tommasi N., De Simone F. ve Pizza C. (1997). Uncaria tomentosa'dan triterpenler ve kinovik asit glikozitler . Fitokimya , ( 5 ), 1035–1040. 10.1016 / S0031-9422 (96) 00716-9 [ CrossRef ] [ Google Scholar ]
                  • Araujo LCC, Feitosa KB, Murata GM, Furigo IC, Teixeira SA, Lucena CF, Ribeiro LM, Muscará MN, Costa SKP, Donato J., Bordin S., Curi R., & Carvalho CRO (2018). Uncaria tomentosa, deneysel NAYKH'de insülin duyarlılığını ve inflamasyonu iyileştirir . Scientific Reports , ( 1 ), 11013. 10.1038 / s41598-018-29044-y [ PMC içermeyen makale ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
                  • Batiha GE-S., Magdy Beshbishy A., Wasef L., Elewa YHA, Abd El-Hack ME, Taha AE, Al-Sagheer AA, Devkota HP ve Tufarelli V. (2020). Uncaria tomentosa (Willd. Ex Schult .) DC .: Kimyasal bileşenler ve biyolojik aktiviteler üzerine bir inceleme . Uygulamalı Bilimler , ( 8 ), 2668 10.3390 / app10082668 [ CrossRef ] [ Google Scholar ]
                  • Bayly CI, Cieplak P., Cornell WD ve Kollman PA (1993). Atomik yükleri türetmek için yük sınırlamalarını kullanan iyi bir elektrostatik potansiyele dayalı yöntem: RESP modeli . Journal of Physical Chemistry , ( 40 ), 10269-10280. 10.1021 / j100142a004 [ CrossRef ] [ Google Akademik ]
                  • Cornell WD, Cieplak P., Bayly CI, Gould IR, Merz KM, Ferguson DM, Spellmeyer DC, Fox T., Caldwell JW ve Kollman PA (1995). Proteinlerin, nükleik asitlerin ve organik moleküllerin simülasyonu için ikinci nesil kuvvet alanı . Amerikan Kimya Derneği Dergisi , ( 19 ), 5179–5197. 10.1021 / ja00124a002 [ CrossRef ] [ Google Scholar ]
                  • Broccatelli F., Salphati L., Plise E., Cheong J., Gobbi A., Lee ML ve Aliagas I. (2016). İlaç benzeri moleküllerin pasif geçirgenliğini kimyasal yapıdan tahmin etmek: Neredeyiz? Molecular Pharmaceutics , ( 12 ), 4199–4208. 10.1021 / acs.molpharmaceut.6b00836 [ PubMed ] [ CrossRef ] [ Google Scholar ]
                  • Caon T., Kaiser S., Feltrin C., de Carvalho A., Sincero TCM, Ortega GG ve Simões CMO (2014). Uncaria tomentosa'dan (kedi pençesi) farklı preparatların antimutajenik ve antiherpetik aktiviteleri . Gıda ve Kimyasal Toksikoloji , 30–35. 10.1016 / j.fct.2014.01.013 [ PubMed ] [ CrossRef ] [ Google Scholar ]
                  • ChemAxon. (2016). ChemAxon - Kimya ve biyoloji için yazılım çözümleri ve hizmetleri . MarvinSketch, Sürüm 16.10.31 . ChemAxon. [ Google Scholar ]
                  • Colmenarejo G. (2003). İnsan serum albüminine ilaç bağlama kuvvetlerinin in silico tahmininde . Tıbbi Araştırma İncelemeleri , ( 3 ), 275–301. 10.1002 / med.10039 [ PubMed ] [ CrossRef ] [ Google Scholar ]
                  • Ertl P., Rohde B. ve Selzer P. (2000). Parçacık temelli katkıların bir toplamı olarak moleküler polar yüzey alanının hızlı hesaplanması ve ilaç taşıma özelliklerinin tahminine uygulanması . Journal of Medicinal Chemistry , ( 20 ), 3714–3717. 10.1021 / jm000942e [ PubMed ] [ CrossRef ] [ Google Akademik ]
                  • Foresman JB, Head-Gordon M., Pople JA ve Frisch MJ (1992). Uyarılmış durumlar için sistematik bir moleküler yörünge teorisine doğru . Journal of Physical Chemistry , ( 1 ), 135–149. 10.1021 / j100180a030 [ CrossRef ] [ Google Akademik ]
                  • Glendening ED, Landis CR ve Weinhold F. (2012). Doğal bağ yörünge yöntemleri . WIREs Hesaplamalı Moleküler Bilimler , ( 1 ), 1–42. 10.1002 / wcms.51 [ CrossRef ] [ Google Scholar ]
                  • Gohlke H., Hendlich M. ve Klebe G. (2000). Protein-ligand etkileşimlerini tahmin etmek için bilgiye dayalı puanlama işlevi . Journal of Molecular Biology , ( 2 ), 337–356. 10.1006 / jmbi.1999.3371 [ PubMed ] [ CrossRef ] [ Google Akademik ]
                  • Gonzales GF, Aguilar J. ve Villar M. (2010). Peru, Lima'da geleneksel, alternatif ve tamamlayıcı tıpta (TACM) dünya uyum zirvesi . Kanıta Dayalı Tamamlayıcı ve Alternatif Tıp , ( 2 ), 271–275. 10.1093 / ecam / nen042 [ PMC içermeyen makale ] [ PubMed ] [ CrossRef ] [ Google Akademik ]
                  • Hammad S., Bouaziz-Terrachet S., Meghnem R. ve Meziane D. (2020). Yeni CK2 inhibitörlerinin tanımlanması için farmakofor geliştirme, ilaç benzerliği analizi, moleküler yerleştirme ve moleküler dinamik simülasyonları . Journal of Molecular Modeling , ( 6 ), 160.10.1007 / s00894-020-04408-2 [ PubMed ] [ CrossRef ] [ Google Scholar ]
                  • Han Y. ve Král P. (2020). SARS-CoV-2'nin ACE2 tabanlı peptid inhibitörlerinin hesaplamalı tasarımı . ACS Nano , ( 4 ), 5143–5147. 10.1021 / acsnano.0c02857 [ PMC ücretsiz makale ] [ PubMed ] [ CrossRef ] [ Google Akademik ]
                  • Heinrich M. (2002). Etnotıp ve ilaç keşfi . Journal of Ethnopharmacology , ( 2–3 ), 244 10.1016 / s0378-8741 (02) 00173-3 [ CrossRef ] [ Google Scholar ]
                  • Huang X., Pearce R., Zhang Y. (2020). SARS-CoV-2 spike proteininin insan ACE2 ile ilişkisini bloke etmek için protein peptidlerinin de novo tasarımı . Yaşlanma , ( 12 ), 11263–11276. https://doi.org/ 10.18632 / aging.103416 [ PMC ücretsiz makale ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
                  • Jamwal S., Gautam A., Elsworth J., Kumar M., Chawla R., Kumar P. (2020). COVID-19 pandemisinin moleküler patogenezi, ikincil komplikasyonları ve potansiyel terapötiklerine ilişkin güncellenmiş bir içgörü . Life Sciences , 118105. .10.1016 / j.lfs.2020.118105 32687917 [ PMC ücretsiz makale ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
                  • Keplinger K., Laus G., Wurm M., Dierich MP ve Teppner H. (1998). Uncaria tomentosa (Willd.) DC. - Etnomedikal kullanım ve yeni farmakolojik, toksikolojik ve botanik sonuçlar . Journal of Ethnopharmacology , ( 1 ), 23-34. 10.1016 / S0378-8741 (98) 00096-8 [ PubMed ] [ CrossRef ] [ Google Scholar ]
                  • Kitajima M., Hashimoto KI, Yokoya M., Takayama H. ​​ve Aimi N. (2000). Peru "Una de Gato" dan ( Uncaria tomentosa ) iki yeni 19-hidroksursolik asit tipi triterpen . Tetrahedron , ( 4 ), 547–552. 10.1016 / S0040-4020 (99) 01048-0 10.1016 / S0040-4020 (99) 01048-0 [ CrossRef ] [ CrossRef ] [ Google Scholar ]
                  • Kramer B., Rarey M. ve Lengauer T. (1999). Protein-ligand yerleştirme için FlexX artımlı yapı algoritmasının değerlendirilmesi . Proteinler: Yapı, İşlev ve Genetik , ( 2 ), 228–241. [ PubMed ] [ Google Akademik ]
                  • Kuraś M., Pilarski R., Nowakowska J., Zobel A., Brzost K., Antosiewicz J. ve Gulewicz K. (2009). Uncaria tomentosa kabuğundan alkaloid içermeyen ve alkaloid bakımından zengin preparatların Allium Testi ile değerlendirilen mitotik aktivite ve kromozom morfolojisi üzerindeki etkisi . Journal of Ethnopharmacology , ( 1 ), 140–147. 10.1016 / j.jep.2008.10.023 [ PubMed ] [ CrossRef ] [ Google Scholar ]
                  • Kwon PS, Oh H., Kwon S.-J., Jin W., Zhang F., Fraser K., Hong JJ, Linhardt RJ ve Dordick JS (2020). Sülfatlanmış polisakkaritler, in vitro olarak SARS-CoV-2'yi etkili bir şekilde inhibe eder . Hücre Keşfi , ( 1 ), 50 10.1038 / s41421-020-00192-8 [ PMC içermeyen makale ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
                  • Lan J., Ge J., Yu J., Shan S., Zhou H., Fan S., Zhang Q., Shi X., Wang Q., Zhang L. ve Wang X. (2020). SARS-CoV-2 spike reseptör bağlanma alanının yapısı ACE2 reseptörüne bağlıdır . Nature , ( 7807 ), 215–220. 10.1038 / s41586-020-2180-5 [ PubMed ] [ CrossRef ] [ Google Akademik ]
                  • Laus G., Brössner D. ve Keplinger K. (1997). Peru Uncaria tomentosa'nın alkoitleri . Fitokimya , ( 4 ), 855–860. 10.1016 / S0031-9422 (97) 00061-7 10.1016 / S0031-9422 (97) 00061-7 [ CrossRef ] [ CrossRef ] [ Google Scholar ]
                  • Lenzi RM, Campestrini LH, Okumura LM, Bertol G., Kaiser S., Ortega GG, EM, Bovo F., Zawadzki-Baggio SF, Gomes Stevan-Hancke FR ve Maurer JBB (2013). Uncaria tomentosa (Willd.) DC'nin sulu fraksiyonlarının makrofaj düzenleyici aktiviteler üzerindeki etkileri . Food Research International , ( 2 ), 767–779. 10.1016 / j.foodres.2013.02.042 [ CrossRef ] [ Google Akademik ]
                  • Li S.-R., Tang Z.-J., Li Z.-H., Liu X. (2020). Anjiyotensin dönüştürücü enzim 2'den yeni koronavirüs pnömonisinin tedavi stratejisinin araştırılması: COVID-19 ve SARS-CoV'nin hedefi . European Journal of Clinical Microbiology & Infectious Diseases , ( 6 ), 1021-1026. https://doi.org/ 10.1007 / s10096-020-03883-y [ PMC ücretsiz makale ] [ PubMed ] [ CrossRef ] [ Google Akademik ]
                  • Lima-Junior RS, Da Silva Mello C., Kubelka CF, Siani AC ve Valente LMM (2013). Uncaria tomentosa alkaloidal fraksiyon, dang virüsü ile enfekte olmuş insan mikrovasküler endotel hücrelerinde aracelüler geçirgenliği, il-8 ve ns1 üretimini azaltır . Natural Product Communications , ( 11 ), 1547–50. 10.1177 / 1934578X1300801112 [ PubMed ] [ CrossRef ] [ Google Akademik ]
                  • Lipinski CA, Lombardo F., Dominy BW ve Feeney PJ (2012). İlaç keşif ve geliştirme ortamlarında çözünürlük ve geçirgenliği tahmin etmek için deneysel ve hesaplamalı yaklaşımlar . Advanced Drug Delivery Reviews , 4–17. 10.1016 / j.addr.2012.09.019 [ PubMed ] [ CrossRef ] [ Google Akademik ]
                  • Lock O., Perez E., Villar M., Flores D. ve Rojas R. (2016). Peru geleneksel tıbbında kullanılan bitkilerden elde edilen biyoaktif bileşikler . Doğal Ürün İletişimi , ( 3 ), 315–37. [ PubMed ] [ Google Akademik ]
                  • Montoro P., Carbone V., de Dioz Zuniga Quiroz J., De Simone F. ve Pizza C. (2004). Uncaria tomentosa özütlerindeki bileşenlerin HPLC-ES / MS ile tanımlanması ve miktarının belirlenmesi . Fitokimyasal Analiz , ( 1 ), 55–64. 10.1002 / pca.740 [ PubMed ] [ CrossRef ] [ Google Scholar ]
                  • Morris GM, Huey R., Lindstrom W., Sanner MF, Belew RK, Goodsell DS, Olson AJ (2009). AutoDock4 ve AutoDockTools4: Seçici alıcı esnekliği ile otomatik yerleştirme . Hesaplamalı Kimya Dergisi , ( 16 ), 2785–2791. https://doi.org/ 10.1002 / jcc.21256 19399780 [ PMC ücretsiz makale ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
                  • Morris GM, Goodsell DS, Halliday RS, Huey R., Hart WE, Belew RK ve Olson AJ (1998). Lamarckian genetik algoritma ve ampirik bağlayıcı serbest enerji işlevi kullanılarak otomatik yerleştirme . Hesaplamalı Kimya Dergisi , ( 14 ), 1639-1662. [ Google Scholar ]
                  • Navarro M., Arnaez E., Moreira I., Hurtado A., Monge D. ve Monagas M. (2019). Uncaria tomentosa ticari ağaç kabuğu ürünlerinin polifenolik bileşimi ve antioksidan aktivitesi . Antioksidanlar , ( 9 ), 339 10.3390 / antiox8090339 [ PMC içermeyen makale ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
                  • Navarro M., Zamora W., Quesada S., Azofeifa G., Alvarado D. ve Monagas M. (2017). Uncaria tomentosa'nın proantosiyanidinlerinin parçalanması . Bileşim ve yapı-biyoaktivite İlişkisi . Antioksidanlar , ( 3 ), 60 10.3390 / antiox6030060 [ PMC içermeyen makale ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
                  • Navarro-Hoyos M., Lebrón-Aguilar R., Quintanilla-López J., Cueva C., Hevia D., Quesada S., Azofeifa G., Moreno-Arribas M., Monagas M. ve Bartolomé B. (2017 ). Uncaria tomentosa L.'nin (kedi pençesi . Antioksidanlar , ( 1 ), 12 10.3390 / antiox6010012 [ PMC içermeyen makale ] [ PubMed ] [ CrossRef ] [ Google Scholar ] farklı kısımlarından elde edilen ekstrelerin proantosiyanidin karakterizasyonu ve biyoaktivitesi
                  • Nishizawa M. ve Nishizawa K. (2010). Faz geçişine eğilimli membranlarda viral füzyon peptidlerinin moleküler dinamik simülasyon analizleri: Membran eğriliği, faz davranışı ve lipit-su arayüzü istikrarsızlığı üzerindeki etkiler . Biyofiziksel Kimya Dergisi , ( 01 ), 19–32. 10.4236 / jbpc.2010.11003 [ CrossRef ] [ Google Scholar ]
                  • Ostrakhovich EA, Mikhal'chik EV, Getmanskaya NV ve Durnev AD (1997). Uncaria Tomentosa'dan ekstraktın antioksidan aktivitesi . Farmasötik Kimya Dergisi , ( 6 ), 326–329. 10.1007 / BF02464127 [ CrossRef ] [ Google Scholar ]
                  • Parrinello M. ve Rahman A. (1981). Tek kristallerde polimorfik geçişler: Yeni bir moleküler dinamik yöntemi . Uygulamalı Fizik Dergisi , ( 12 ), 7182–7190. 10.1063 / 1.328693 [ CrossRef ] [ Google Akademik ]
                  • Pavei C., Kaiser S., Verza SG, Borre GL ve Ortega GG (2012). UPLC / Q-TOF-MS analizi ile ilişkili kedi pençesinde ( Uncaria tomentosa ) kinovik asit glikozitler testi için HPLC-PDA yöntemi . Journal of Pharmaceutical and Biomedical Analysis , 250–257. 10.1016 / j.jpba.2011.12.031 [ PubMed ] [ CrossRef ] [ Google Akademik ]
                  • Peñaloza EMC, Kaiser S., De Resende PE, Pittol V., Carvalho Â. R. ve Ortega GG (2015). Uncaria tomentosa (kedi pençesi) vahşi popülasyonunda kimyasal bileşim değişkenliği . Quimica Nova , ( 3 ), 378–386. 10.5935 / 0100-4042.20150007. [ CrossRef ] [ Google Akademik ]
                  • Pham-The H., Cabrera-Pérez M. Á., Nam N.-H., Castillo-Garit JA, Rasulev B., Le-Thi-Thu H., & Casañola-Martin GM (2018). ADME özelliklerinin silico değerlendirmesinde: Caco-2 hücre tek tabakalı geçirgenlik modellemesindeki gelişmeler . Tıbbi Kimyada Güncel Konular , ( 26 ), 2209–2229. 10.2174 / 1568026619666181130140350 [ PubMed ] [ CrossRef ] [ Google Scholar ]
                  • Prajapat M., Sarma P., Shekhar N., Avti P., Sinha S., Kaur H., Kumar S., Bhattacharyya A., Kumar H., Bansal S. ve Medhi B. (2020). Corona virüsü için ilaç hedefleri: Sistematik bir inceleme . Indian Journal of Pharmacology , ( 1 ), 56 10.4103 / ijp.IJP_115_20 [ PMC ücretsiz makale ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
                  • B. ve Di Grandi D. (2008) basın. Bağırsak emilimi için geçirgenlik: Caco-2 testi ve ilgili sorunlar . Güncel İlaç Metabolizması , ( 9 ), 893–900. 10.2174 / 138920008786485119 [ PubMed ] [ CrossRef ] [ Google Akademik ]
                  • Reis SRIN, Valente LMM, Sampaio AL, Siani AC, Gandini M., Azeredo EL, D'Avila LA, Mazzei JL, Henriques M. d GM ve Kubelka CF (2008). Dang Virüsü-2 ile enfekte insan monositlerinde Uncaria tomentosa'nın immünomodüle edici ve antiviral aktiviteleri . International Immunopharmacology , ( 3 ), 468-476. 10.1016 / j.intimp.2007.11.010 [ PubMed ] [ CrossRef ] [ Google Akademik ]
                  • Roothaan CCJ (1951). Moleküler yörünge teorisinde yeni gelişmeler . Modern Fizik İncelemeleri , ( 2 ), 69-89. 10.1103 / RevModPhys.23.69 [ CrossRef ] [ Google Akademik ]
                  • Sandoval M., Charbonnet RM, Okuhama NN, Roberts J., Krenova Z., Trentacosti AM ve Miller MJS (2000). Kedi pençesi TNFa üretimini engeller ve serbest radikalleri temizler: Sitoproteksiyondaki rolü . Ücretsiz Radikal Biyoloji ve Tıp , ( 1 ), 71–78. 10.1016 / S0891-5849 (00) 00327-0 [ PubMed ] [ CrossRef ] [ Google Scholar ]
                  • Schmidt MW, Baldridge KK, Boatz JA, Elbert ST, Gordon MS, Jensen JH, Koseki S., Matsunaga N., Nguyen KA, Su S., Windus TL, Dupuis M. ve Montgomery JA (1993). Genel atomik ve moleküler elektronik yapı sistemi . Hesaplamalı Kimya Dergisi , ( 11 ), 1347–1363. 10.1002 / jcc.540141112 [ CrossRef ] [ Google Scholar ]
                  • Singh UC ve Kollman PA (1984). Moleküller için elektrostatik yükleri hesaplamaya bir yaklaşım . Hesaplamalı Kimya Dergisi , ( 2 ), 129-145. 10.1002 / jcc.540050204 [ CrossRef ] [ Google Scholar ]
                  • Snow AD, Castillo GM, Nguyen BP, Choi PY, Cummings JA, Cam J., Hu Q., Lake T., Pan W., Kastin AJ, Kirschner DA, Wood SG, Rockenstein E., Masliah E., Lorimer S ., Tanzi RE ve Larsen L. (2019). Amazon yağmur ormanı bitkisi Uncaria tomentosa (kedi pençesi) ve onun spesifik proantosiyanidin bileşenleri, hem beyin plaklarının hem de düğümlerin güçlü inhibitörleri ve azaltıcılarıdır . Scientific Reports , ( 1 ), 561. 10.1038 / s41598-019-38645-0 [ PMC ücretsiz makale ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
                  • Terlizzi ME, Occhipinti A., Luganini A., Maffei ME ve Gribaudo G. (2016). Herpes simplex tip 1 ve tip 2 enfeksiyonlarının, yüksek A tipi proantosiyanidin (PACs-A) içeriğine sahip bir kızılcık özütü olan Oximacro® tarafından inhibisyonu . Antiviral Araştırma , 154–164. 10.1016 / j.antiviral.2016.06.006 [ PubMed ] [ CrossRef ] [ Google Akademik ]
                  • Trott O. ve Olson AJ (2009). AutoDock Vina: Yeni bir puanlama işlevi, verimli optimizasyon ve çoklu okuma ile kenetlenme hızını ve doğruluğunu iyileştirme . Hesaplamalı Kimya Dergisi , ( 2 ), 455–461. 10.1002 / jcc.21334 [ PMC ücretsiz makale ] [ PubMed ] [ CrossRef ] [ Google Akademik ]
                  • Veber DF, Johnson SR, Cheng HY, Smith BR, Ward KW ve Kopple KD (2002). İlaç adaylarının oral biyoyararlanımını etkileyen moleküler özellikler . Journal of Medicinal Chemistry , ( 12 ), 2615–2623. 10.1021 / jm020017n [ PubMed ] [ CrossRef ] [ Google Akademik ]
                  • Vera-Reyes I., Huerta-Heredia AA, Ponce-Noyola T., Cerda-Garcà ‐ A-Rojas CM, Trejo-Tapia G. ve Ramos-Valdivia AC (2015). Monoterpenoid indol alkaloidler ve fenoller, glutatyondan yoksun Uncaria tomentosa kök kültürlerinde gerekli antioksidanlardır . Çevre Biliminde Sınırlar , 27. 10.3389 / fenvs.2015.00027 [ CrossRef ] [ Google Scholar ]
                  • Walls AC, Park YJ, Tortorici MA, Wall A., McGuire AT ve Veesler D. (2020). SARS-CoV-2 spike glikoproteininin yapısı, işlevi ve antijenitesi . Cell , ( 2 ), 281–292.e6. 10.1016 / j.cell.2020.02.058 [ PMC ücretsiz makale ] [ PubMed ] [ CrossRef ] [ Google Akademik ]
                  • Wang C., Horby PW, Hayden FG, Gao GF (2020). Küresel sağlık endişesinin yeni bir koronavirüs salgını . Lancet , ( 10223 ), 470–473. https://doi.org/ 10.1016 / S0140-6736 (20) 30185-9 [ PMC ücretsiz makale ] [ PubMed ] [ CrossRef ] [ Google Akademik ]
                  • Wang J., Wang W., Kollman PA ve Case DA (2006). Moleküler mekanik hesaplamalarda otomatik atom tipi ve bağ tipi algısı . Journal of Molecular Graphics & Modeling , ( 2 ), 247–260. 10.1016 / j.jmgm.2005.12.005 [ PubMed ] [ CrossRef ] [ Google Akademik ]
                  • Dünya Sağlık Örgütü. (2018). Bitkisel ilaçlar için iyi bitkisel işleme uygulamalarına ilişkin Ek 1 WHO yönergeleri (WHO Teknik Rapor Serisi, No. 1010). DSÖ. [ Google Scholar ]
                  • Dünya Sağlık Örgütü. (2020). Koronavirüs hastalığı (COVID-19): haftalık epidemiyolojik güncelleme. Dünya Sağlık Örgütü . [ Google Scholar ]
                  • Wu J., Yuan X., Wang B., Gu R., Li W., Xiang X., Tang L., Sun H. (2020). Şiddetli Akut Solunum Sendromu Coronavirus 2: Gen Yapısından Patojenik Mekanizmalara ve Potansiyel Tedaviye . Mikrobiyolojide Sınırlar ,, 1576. https://doi.org/10.3389/fmicb.2020.01576 32719672 [ PMC ücretsiz makale ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
                  • Wu XM ve Tan RX (2019). Bağırsak mikrobiyotası ve etnotıp bileşenleri arasındaki etkileşim . Doğal Ürün Raporları , ( 5 ), 788–809. 10.1039 / c8np00041g [ PubMed ] [ CrossRef ] [ Google Akademik ]
                  • Yan R., Zhang Y., Li Y., Xia L., Guo Y. ve Zhou Q. (2020). SARS-CoV-2'nin tam uzunlukta insan ACE2 tarafından tanınması için yapısal temel . Bilim (New York, NY) , ( 6485 ), 1444–1448. 10.1126 / science.abb2762 [ PMC ücretsiz makale ] [ PubMed ] [ CrossRef ] [ Google Akademik ]
                  • Zhivkova Z. (2015). İlaç-insan serum albümini bağlanması üzerine çalışmalar: Maddenin mevcut durumu . Güncel Farmasötik Tasarım , ( 14 ), 1817–1830. 10.2174 / 1381612821666150302113710 [ PubMed ] [ CrossRef ] [ Google Akademik ]

                  Yorum yap


                  • #10
                    Kronik Yorgunluk Nedir ? Cat's Claw Faydaları Nelerdir ?
                    Dirençli Candida albicans olmayan izolatlara karşı flukonazol ve terbinafin ile kombine Uncaria tomentosa'nın suda çözünmeyen bir fraksiyonunun in vitro sinerjizmi

                    Renata Cougo Moraes , bir Anderson Ramos Carvalho , bir jameel Jacobi Dalla Lana , bir Samuel Kaiser , bir Bruna Pippi , b Alexandre Meneghello Fuentefria , a, bve George González Ortega a
                    Yazar bilgileri Makale notları Telif hakkı ve Lisans bilgileri Sorumluluk reddi
                    Bu makale PMC'deki diğer makaleler tarafından alıntılanmıştır .
                    Şuraya gidin: Öz

                    Bağlam: Uncaria tomentosa DC (Rubiaceae), dirençli Candida suşlarına karşı aktivite dahil olmak üzere birçok biyolojik aktiviteye sahiptir . Terbinafin veya flukonazol ile sinerjik etkileşim, bu direncin üstesinden gelmek için önemli bir alternatif olabilir.

                    Amaçlar: Uncaria tomentosa kabuğundan suda çözünmeyen bir fraksiyon (WIF) ile Candida albicans dışı dirençli suşlara karşı antifungaller terbinafin (TRB) ve flukonazol (FLZ) arasındaki potansiyel sinerji araştırıldı.

                    Malzemeler ve yöntemler: TRB ve FLZ, tek başına ve WIF ile birleştirildiğinde, yedi Candida glabrata ve C. krusei izolatına karşı mikro seyreltme tekniği kullanılarak dama tahtası prosedürü ile test edildi . Hücre duvarının dışında meydana gelen moleküler etkileşimler, taramalı elektron mikroskobu, Fourier dönüşümü kızılötesi (FT-IR) ve diferansiyel taramalı kalorimetri (DSC) analizi ile değerlendirildi.

                    Sonuçlar: Dama tahtası inhibitör testi, sırasıyla WIF: TRB ve WIF: FLZ kombinasyonları için sinerji gösterdi. En iyi sinerjistik hücre hasarı, WIF ve TRB (1.95: 4.0 μg / mL) ve WIF ve FLZ (1.95: 8.0 μg / mL) birliktelikleri için tartışmasız bir şekilde gösterilmiştir. Tek başına antifungalin FT-IR spektrumlarının karşılaştırılması ve WIF ile kombinasyon halinde, 3000, 1600, 1400 ve 700–800 cm −1 bantlarında net farkların tanınmasına olanak sağlar . Ek olarak, TRB ve FLZ termogramlarındaki değişiklikler, WIF ile kombinasyonlarından sonra açıkça fark edildi.

                    Sonuçlar: DSC ve kızılötesi analiz, WIF ile TRB veya FLZ arasındaki moleküller arası etkileşimleri gösterdi. Bu nedenle, büyük olasılıkla sinerjistik etki, antifungal ve kedi pençesi proantosiyanidinleri arasında hücre duvarının dışında meydana gelen etkileşim olaylarıyla ilgilidir. ABC boşaltma pompası mekanizmasıyla bağlantı olmadan hücre duvarına doğrudan bir eylem önerilir.

                    Anahtar Kelimeler: Doğal ürünler, dama tahtası, antifungal direnç, kandida, polifenoller
                    Şuraya gidin: Giriş

                    Candida türleri zararsız saprofit mayalarıdır, mide-bağırsak yolunda ve oral ve vajinal mukozada insan biyotasının normal bir bileşeni. Bu mayalar, pamukçuk ve vajinit şeklinde kendini gösteren yüzeysel enfeksiyonlara neden olabilir; örneğin, ciddi sistemik enfeksiyonlara neden olabilecekleri bağışıklık sistemi zayıflamış ve bağışıklık sistemi baskılanmış hastalar dışında Hastalar için risk faktörleri arasında insan immün yetmezlik virüsü (HIV) enfeksiyonu, anti-kanser tedavisi, organ nakli, abdominal cerrahi, kateter, diyabet ve geniş spektrumlu antibiyotik kullanımı yer alır (Cruz ve diğerleri 2002 ; Morschhäuser 2002 ).

                    Ek olarak, yeni ortaya çıkan Candida albicans (NCA) olmayan türler ve ondan daha fazla izolatlar, antifungal direnç nedeniyle halk sağlığı sorunu haline gelir. Ayrıca, terapötik yaklaşımlar, mantar hücresi ve memeli hücre arasındaki biyokimyasal ve metabolik benzerlikler nedeniyle ilaç güvenliği ile sınırlıdır (Méan ve diğerleri, 2008 ).

                    Flukonazol (FLZ) ve terbinafin (TRB), hücre zarı biyosentezinin farklı aşamalarında etki gösteren, mantar önleyici tedavide halihazırda kullanılan ana antifungaldir. Triazol türevi FLZ eskiden kandidiyazis tedavisinde kullanılan tercih edilen antifungaldi (Bossche 1985 ). Bununla birlikte, mantıklı olmayan kullanımı, Candida spp. (Sanglard 2003 ). Alilamin sınıfı bir antifungal olan TRB, şu anda dermatofitlerin neden olduğu enfeksiyonların tedavisi için endikedir. Ek olarak TRB, çok çeşitli Candida spp.'ye karşı in vitro aktivite göstermiştir . (Ryder ve ark. 1998 ) ve aynı zamanda tırnak kandidiyazisinin oral tedavisi için (Segal ve ark.1996 ).

                    Mantar direncinin üstesinden gelmek için, antifungal ve antifungal olmayan ilaçların kombinasyonu, mevcut ajanların etkili olduğu çok sayıda mantar hedefi göz önüne alındığında başarılı bir terapötik yaklaşımı temsil eder (Mukherjee ve ark. 2005 ). FLZ'nin bitki özleri ve bunlardan izole edilen maddelerle etkili kombinasyonlarını içerir (Amber ve diğerleri 2010 ; Endo ve diğerleri 2010 ; Yan ve diğerleri 2012 ). Bununla birlikte, kandidiyazis tedavisi için TRB ile sinerjik bir etki amaçlayan bitki türevlerinin ilişkisi şimdiye kadar rapor edilmemiştir.

                    Uncaria tomentosa DC (Rubiaceae), Güney Amerika yağmur ormanlarında yaygın olarak yayılan ve popüler olarak kedi pençesi olarak bilinen bir asmadır (Heitzman ve diğerleri 2005 ; Zhang ve diğerleri 2015 ). Birçok çalışmada Kabuğu biyolojik etkinliklerini, özellikle tümöre karşı odaklama yapılmıştır (Kaiser ve ark. 2016 ), bağışıklık uyarıcı (Montserrat-De La Paz ve ark. 2015 ), anti-enflamatuar (Aguilar ve ark. 2002 ), antiviral (caon ve diğerleri 2014 ), antioksidan (Pilarski ve diğerleri 2006 ), antimikrobiyal aktiviteler (Heitzman ve diğerleri 2005 ; Ccahuana-Vasquez ve diğerleri 2007 ; Kloucek ve diğerleri 2007 ; Zhang ve diğerleri.2015 ), sıklıkla oksindol alkaloid fraksiyonuna atfedilmiştir.

                    Öte yandan, bağışıklık düzenleyici (Lenzi ve ark. 2013 ), antioksidan ve anti-inflamatuar aktiviteler (Amaral ve ark. 2009 ), kedinin pençesi düşük moleküler ağırlığı ve suda çözünür polifenollerle bağlantılıydı. Kedinin pençe kabuğundaki yüksek moleküler ağırlıklı polifenol fraksiyonu ile ilgili olarak, bildiğimiz kadarıyla herhangi bir biyolojik aktivite hakkında hiçbir bilimsel rapor bulunmamaktadır. Sulu ve hidro-etanolik özütlerin konsantrasyonu ile daha sonraki bir özüt işleme sırasında düşebilen suda çözünürlüğü çok düşük bir fraksiyondur. Belki de biyolojik çalışmalarda neden genellikle göz ardı edildiğini açıklıyor.

                    Bu çalışmada, kedinin pençe kabuğundan elde edilen çözünmeyen polifenol fraksiyonunun NCA türlerine karşı antifungal aktivitesini ve con uconazole ve terbinafine ile kombinasyon halinde sinerjisini araştırdık. Hücre duvarının dışında meydana gelen olası moleküler etkileşimlerin katılımı da tartışılmaktadır.

                    Şuraya gidin: Malzemeler ve yöntemler

                    Suda çözünmeyen kısmın (WIF) elde edilmesi

                    Peru'dan temin edilen, Induquímica SA (Lima, Peru) tarafından nazikçe bağışlanan otantik bir U. tomentosa gövde kabuğu örneği, 2 mm çelik elek ile sağlanan bir kesici değirmende (SK1 Retsch, Almanya) ufalandı. Kedi pençe kabuğundan ekstraksiyon, oda sıcaklığında (23 ± 1 °) manyetik karıştırma plakasında (300 rpm) (RO 15 Power, IKA, Almanya) 2 saat dinamik maserasyon ile% 50 (v / v) hidro-etanolik solüsyonlarla gerçekleştirildi. C) (Kaiser ve diğerleri 2013a), ardından filtreleme ve vakum altında 40 ° C'de orijinal ağırlıklarının yarısına kadar (BüchiR-114, Almanya) etanolü ortadan kaldırmayı amaçlayan konsantrasyon. Konsantre öz, gece boyunca soğukta (10 ± 1 ° C) bekletildi. Daha sonra, hacimli bir çökelti doğrulanabilir. Suda çözünmeyen fraksiyonu (WIF) elde etmek için, bu çökeltilen suda çözünür fraksiyondan vakum altında süzülerek ayrıldı ve 24 saat boyunca fırında (37 ° C ± 1 ° C) kurutuldu. WIF'in kimyasal karakterizasyonu

                    WIF'in tam kimyasal karakterizasyonu, önceki bir çalışmada uygun şekilde gerçekleştirilmiştir (Moraes ve diğerleri, 2015 ). Kısaca, oksindol alkaloidlerin (Kaiser ve ark. 2013b ), kinovik asit glikozitlerin (Pavei ve ark. 2012 ) ve düşük moleküler ağırlıklı polifenollerin (Pavei ve ark. 2010 ) içerikleri ve profilleri, daha önce doğrulanmış HPLC-PDA yöntemleri kullanılarak gerçekleştirilmiştir . . Öte yandan proantosiyanidin içeriği vanilin asit yöntemi ile gerçekleştirilmiştir (Sun ve ark. 1998 ). Mikroorganizmalar

                    NCA suşları seti şunları içerir: Candida krusei ATCC 6258, CK01, CK04; Candida glabrata CG40039, CG10, RL02, RL03, hepsi Uygulamalı Mikolojik Araştırma Laboratuvarı, Universidade Federal do Rio Grande do Sul, Porto Alegre, Brezilya kültür koleksiyonlarından. Çalışma örnekleri ve referans ilaç çözümleri

                    Tüm çalışma örnekleri metanol% 2.5 içinde çözülmüştür (h / h), 1.0 mg ml bir konsantrasyona ulaşmak için -1 . TRB (Cristália, Brezilya) ve FLZ (Cristália, Brezilya) ultra saf suda (Milli Q, Millipore, Bedford, MA, ABD) çözüldü. Örnekleri çözmek için kullanılan çözücüler, doğru inokülum büyümesini doğrulamak için pozitif kontrol ve tek başına RPMI içeren negatif kontrol, kontrol olarak kullanıldı. Hücre büyümesi inhibisyonu

                    TRB ve FLZ, tek başına ve WIF ile birlikte mikro-seyreltme tekniği kullanılarak dama tahtası prosedürü ile test edilmiştir (Kontoyiannis & Lewis 2004). Test edilen ürünlerin MIC değerlerinden belirlenen konsantrasyonlarda çözeltileri kullanıldı. Her çalışma örneğinden 50 μL'lik alikotlar, 96 kuyucuklu bir mikroplakaya dağıtıldı ve daha önce ekstrakte edilen ilaç ve maddelerin benzersiz bir konsantrasyonunu elde etmek için 100 μL inokülum ile karıştırıldı. Mikroplakalar 35 ° C'de 48 saat inkübe edildi ve optik yoğunluk görsel ve spektrofotometrik olarak değerlendirildi (Envision 2104 Multilaber Reader, Perkin Elmer, ABD). Sonuçlar hücresel hasar yüzdesi olarak ifade edildi. Tahlil, dört kez gerçekleştirildi. Antifungaller ve fraksiyonlar arasındaki etkileşimler Fraksiyonel İnhibitör Konsantrasyon İndeksi (FICI) ile belirlendi.A  + FIC B ). Etkileşim, FICI ≤0.5 için sinerjistik, 0.5 2002 ; White ve diğerleri 1996 ) . MTT ile hücresel hasar analizi

                    Sinerjizmin kantitatif değerlendirmesi, modifikasyonlarla hücre hasarı tahlilinin yüzdesi ile değerlendirildi (Chiou ve diğerleri, 2001 ). İnkübasyon süresinden (3 saat) sonra, her kuyudan süpernatan dikkatlice çıkarıldı ve atıldı. Her kuyuya 100 uL'lik MTT solüsyonu (0.05 mg mL- 1 ) eklenmiş, ardından 32 ° C'de 3 saat inkübasyon yapılmıştır. Daha sonra süpernatan tekrar çıkarıldı ve atıldı. Ayrı olarak, 100 uL izopropanol eklendi ve hücre içeriği ayrı ayrı homojenleştirildi. Daha sonra, pipetleme sırasını izleyerek her kuyudan bir kısım yeni bir mikroplakaya aktarılır. Absorbans 570 nm ve 690 nm'de ölçüldü. [(A - hücre hasarı yüzde Denklem 1 ile hesaplanmıştır 570 nm - bir 690 nm ilaç) / (A570 nm - bir 690 nm ilaç ile absorbans ilgi verileri ve pozitif kontrol olarak görev yapar ilaçsız absorbans olan ilaç)] x 100 olmadan. Numune karışımının elde edilmesi - WIF-TRB ve WIF-FLZ

                    Ayrı olarak, WIF-TRB ve WIF-FLZ için sırasıyla 1: 4 ve 1: 2 (ağırlık / ağırlık) karışım oranlarına ulaşmak için uygun miktarlarda WIF, TRB ve FLZ doğru şekilde ağırlıklandırıldı. Her numune% 2.5 metanol içinde çözüldü, manyetik olarak bir su banyosunda 48 saat, 32 ° C'de gün ışığından korunarak karıştırıldı. Bu sürenin sonunda, tüm numuneler genellikle olduğu gibi (Edwards EF4 Modulyo dondurarak kurutucu, İngiltere) dondurularak kurutuldu ve kullanıma kadar 4 ° C'de tutuldu. Mayaların taramalı elektron mikroskobu (SEM)

                    Daha önce yukarıda Antifungal duyarlılık deneyinde tarif edildiği gibi tedavi edilen Candida krusei (CK04), tek başına WIF kullanılarak ve FLZ ve TRB ile kombine edilerek, 10 ° C'de 24 saat boyunca% 2.5 glutaraldehit ile sabitlendi. Sonradan fiksasyon, 1 saat süreyle kakodilat tamponu içerisinde% 1 osmiyum tetroksit ile gerçekleştirildi. Daha sonra numuneler aseton derecelerinde dehidre edildi, kritik nokta altınla kaplanmış CO 2 içinde kurutuldu ve bir taramalı elektron mikroskobu (AG - EVO 50 Carl Zeiss, Almanya) ile incelendi (Maurya ve ark. 2011 ). İşlem görmemiş maya, pozitif kontrol olarak kullanıldı. Numune karışımının taramalı elektron mikroskobu (SEM)

                    Numunelerin fotomikrografları, 10 kV voltajda bir Taramalı elektron mikroskobu (JSM 6060, Tokyo, Japonya) kullanılarak alındı. Numuneler önceden çift taraflı yapışkan bant kullanılarak alüminyum saplamalar üzerine monte edilmiş ve ince bir altın tabakası ile vakumla kaplanmıştır. Numune karışımının FT-IR analizi

                    WIF-TRB ve WIF-FLZ karışımlarından alınan FT-IR spektrumları , 4 cm- 1 çözünürlük kullanılarak ve 40 birikimden sonra (Shimadzu DR-8001 FTIR spektrometresi, Japonya) 4000-600 cm- 1 frekans aralığında kaydedildi . KBr diskleri, her biri yaklaşık 1.5 mg'lık fiziksel harmanların vakum altında sıkıştırılmasıyla hazırlandı. Diferansiyel taramalı kalorimetri (DSC) analizi

                    Her bir WIF-TRB ve WIB-FLZ karışımından yaklaşık 2 mg kadar doğru tartılmış numuneler kıvrımlı alüminyum kaplarda (Shimadzu DSC-60 kalorimetre, Japonya) analiz edildi. Çalışma koşulları, 10 ° C min -1 ısıtma hızı (25 ila 350 ° C) ve 50 mL dak -1'de nitrojen akışı idi . Pseudomycelium'un FT-IR analizi

                    WIF, TRB ve WIF- TRB'nin C. krusei suşu CK04'ün hücre duvarı ve hücre zarı üzerindeki etkisi, 8: alt inhibitör konsantrasyonunda bir WIF: antifungal karışım oranı 1: 4 (w / w) kullanılarak değerlendirildi: 32 μg / mL. Ayrı olarak, 1 x 10 içeren her bir mantar süspansiyonunun 100 uL alikot 6 5 10 × 6 CFU mL -1 eşit agar patates dekstroz içeren Petri kapları üzerine uygulandı ve (7 mm çapında bir merkezi delik arasında Galindo ve diğ. 2013), her numuneden 100 μL almak için kasıtlı olarak kazılmıştır. Milli-Q su (Milli-Q Sistemi, Millipore) kontrol olarak kullanıldı. 32 ° C'de 48 saat inkübasyondan sonra, dikkatlice kazıyarak bir maya numunesi toplandı, bir kerede -20 ° C'de donduruldu, liyofilize edildi ve analize kadar uygun şekilde saklandı. Bu prosedür, üç kopya halinde gerçekleştirildi. Efluks pompası deneyi

                    Dışa akış pompalarının aktivitesi, direnç ATP-bağlayıcı Cassete (ABC) dışarı akış pompası mekanizmasıyla ilişkilendirildiğinde MIC'yi düşüren inhibitör verapamil kullanılarak test edildi (Prudêncio ve diğerleri, 2000 ). Verapamil, nihai konsantrasyon 0.098 mg mL- 1 (200 μM) olan RPMI kültür ortamı içinde doğrudan çözündürüldü . Tüm suşlar, RPMI 1640 ortamına verapamil eklenerek ve eklenmeden test edildi. Minimal inhibe edici konsantrasyon (MIC) değerleri, RPMI-MOPS ( 1 içeren RPMI 1640 besiyeri içeren RPMI 1640 besiyeri) ile CLSI kılavuzlarına (M27-A3) göre iki kat seyreltme yöntemi kullanılarak broth mikro seyreltme ile belirlenmiştir.-glutamin ve sodyum bikarbonatsız) (Sigma-Aldrich Co., St Louis, MO) 0.165 M MOPS tamponu ile pH 7.0'a tamponlandı. Test edilen FLZ ve TRB konsantrasyonları, C. krusei ve C. glabrata'ya karşı 500 ila 0.98 μg mL- 1 arasında değişmiştir . Tahlil, üç kez yapıldı. istatistiksel analiz

                    ANOVA ve ardından Tukey testi uygulandı ve sonuçlar ortalama ± SEM olarak ifade edildi. Farklar, p  <.05 için istatistiksel olarak anlamlı kabul edildi . Veri analizleri Minitab 16.0 yazılımı (Minitab Inc., State College, PA) kullanılarak yapıldı.

                    Şuraya gidin: Sonuçlar

                    WIF'in kimyasal karakterizasyonu

                    WIF'nin tam kimyasal karakterizasyonu, Moraes ve ark. ( 2015 ) önceki bir çalışmada. Bu fraksiyon, katekin ve epikatenin oligomerlerinden türetilen yüksek bir proantosiyanidin içeriği (% 70.80, w / w) gösterdi. Dahası, WIF ayrıca az miktarda oksindol alkaloidleri (% 7.91, ağırlık / ağırlık), kinovik asit glikozitler (% 7.79, ağırlık / ağırlık) ve düşük moleküler ağırlık polifenolleri (% 3.77, ağırlık / ağırlık) gösterdi. Oksindol alkaloidleri profiliyle ilişkili olarak, WIF yalnızca pentasiklik oksindol alkaloidlerinden, özellikle mitrafilin ve pteropodinden oluşmuştur. Ek olarak, daha önce MS analizi ile karakterize edilen kinovik asitten diglikosilatlı bir türev olan pik 3 (Pavei ve diğerleri , 2012 ), WIF'de bulunan ana türevdi . Dama tahtası tahliliyle inhibe edici çalışmalar

                    WIF'in TRB ve FLZ ile kombinasyonu, inhibitör test ile belirlenen MIC değerlerini azaltabilmiştir ve hem katkı maddesi hem de sinerjik etkiler test edilen tüm izolatlarda açıkça fark edilebilmiştir. İncelenen mayalar için dama tahtası mikro-seyreltme deneylerinin medyan FICI'leri şu şekilde gösterilmiştir:tablo 1. WIF-TRB kombinasyonu için, iki C. krusei ve iki C. glabrata olmak üzere dört farklı izolatta sinerjistik bir etki gözlendi , ancak aynı zamanda WIF-FLZ için bir C. krusei ve iki C. glabrata (tablo 1). Diğer izolatlarda ilave bir etki gözlemlendi. Tablo 1.

                    Fraksiyonel inhibitör konsantrasyon (FIC) ve antifungal ajanların bir kombinasyonunu test etmek için dama tahtası mikrodilüsyon testiyle elde edilen etkileşim türü.
                    C. krusei CK01 0.500 0.260 0.760 katkı 0.250 0.266 0.516 katkı
                    CK04 0.125 0.133 0.258 sinerji 0.250 0.250 0.500 katkı
                    CK6258 0.062 0.250 0.312 sinerji 0.125 0.250 0.375 sinerji
                    C. glabrata CG10 0.500 0.266 0.766 katkı 0.250 0.266 0.516 katkı
                    CG40039 0.062 0.250 0.312 sinerji 0.125 0.266 0.391 sinerji
                    RL03 / RL02 * 0.062 0.066 0.129 sinerji 0.250 0.033 0.283 sinerji
                    WIF: U. tomentosa'dan suda çözünmeyen fraksiyon ; TRB: terbinafin; FLZ: flukonazol.

                    * RL03, TRB + WIF'e ve RL02, FLZ + WIF'e karşılık gelir. MTT ile hücresel hasar analizi

                    Sonuçlar, 64 μg mL- 1 konsantrasyona kadar tek başına test edilen TRB ve FLZ'nin , dikkate alınan herhangi bir izole edilmişin büyümesini inhibe edemediğini göstermektedir (Tablo 2). WIF'nin TRB'ye eklenmesi, TRB'nin antifungal aktivitesinin artmasıyla sonuçlandı. Bu nedenle, TRB ve WIF , sırasıyla 8: 1.95 μg mL- 1 konsantrasyon oranında birleştirildiğinde, CK6258 terbinafine dirençli izolatta (yaklaşık% 88), tek başına TRB ve WIF'den (% 40.7 ve yaklaşık% 20, sırasıyla). Sırasıyla 4: 1.95 μg mL -1 konsantrasyon oranındaki TRB ve WIF , CK04 izolatı ile ilgili olarak önemli hücre hasarına (% 79.52) neden olmuştur. Terbinafin, WIF-FLZ neredeyse tüm izolatlar üzerinde önemli bir sinerjik etki oluşturabilmiştir. Flukonazole dirençli CK04 izolatı ile ilgili olarak, 1,95: 8 μg mL- 1 konsantrasyon oranında WIF ve FLZ için yaklaşık% 80'lik bir hücre hasarı fark edilebilir.. Bu durumda, bileşikler tek başına aynı konsantrasyon oranını kullanarak% 50 altında hücre hasarı gösterdi. Tablo 2.

                    Dama tahtası mikrodilüsyon yönteminden sonra tek başına terbinafin (TRB) ve flukonazolün (FLZ) neden olduğu hücre hasarının yüzdesi ve bunların U. tomentosa kabuğundan (WIF) suda çözünmeyen fraksiyonla kombinasyonları .
                    CK04
                     C (μg / mL) 7,81 / 64 7,81 / 32 15.62 / 32 15.62 / 16 7,81 / 16 3.91 / 16
                     CDA (%) 45.07 D / 50.23 CD 45.07 D / 52.51 CD 52,51 CD / 52,51 CD 52,51 B / 40,05 C 45.07 / 40.05 C 35.80 ° C /40.05
                     HKM (%) 90.05 AB 91,22 A * 70.01 89,52 A 82,67 A * 73,13 A
                    CK01
                     C (μg / mL) 7.81 / 4 3.91 / 4 1.95 / 4 7,81 / 8 3.91 / 8 1.95 / 8
                     CDA (%) 26.02 B / 15.52 B 24.54 B /15.52 B 14.69 B /15.52 B 26.02 B / 32.49 B 24.54 B /32.49 B 14.69 B / 32.49 B
                     HKM (%) 57,56 A 72.42 Bir 79,52 A * 80,22 A * 73,27 A 73,96 A
                    CK6258
                     C (μg / mL) 1.95 / 4 1.95 / 8 1.95 / 16 7,81 / 16 3.91 / 16 3.91 / 32
                     CDA (%) 19,83 C / 18,38 C 19,83 C / 40,74 B 19,83 C / 37,92 70.40 C /12.61 D 49.68 D /12.61 D 49.68 G / 13.04 D
                     HKM (%) 85,16 A * 87.95 A 86,4 A 91.36 Bir 79.15 B 94,15 A *
                    CG10
                     C (μg / mL) 15.62 / 32 3.91 / 32 0.98 / 64 15.62 / 16 7,81 / 16 3.91 / 16
                     CDA (%) 51.02 CD / 57.12 BCD 42.92 DE /57.12 BCD 16.89 E / 55.01 CD 51.02 BC / 39.58 D 40,51 D / 39,58 D 42,92 CD / 39,58 D
                     HKM (%) 88,89 A 75,74 ABC * 82.73 AB 55.08 B 86,77 Bir * 52.67
                    CG40039
                     C (μg / mL) 3.91 / 4 1.95 / 4 1.95 / 8 3.91 / 8 1.95 / 8 0.98 / 8
                     CDA (%) 35.26 B /33.77 B 32.86 B /33.77 B 32.86 B /37.85 B 35.26 B /31.59 B 32.86 B /31.59 B 28,20 B / 31,59 B
                     HKM (%) 67,54 A 70,25 Bir * 87,65 A 62,89 A 64,57 Bir 60,79 A *
                    RL03 / RL02
                     C (μg / mL) 1.95 / 8 0.98 / 8 0.98 / 4 3.91 / 8 1.95 / 8 0.98 / 32
                     CDA (%) 22.88 / 31.37 B 7.32 D / 31.37 B 7.32 G / 11.62 CD 30.22 C /16.77 D 30,19 C / 16,77 G 24.02 CD / 40.84 B
                     HKM (%) 61.16 A 65,35 A 56,92 A * 44.03 B 24.55 CD 65,00 A *
                    Ayrı bir pencerede aç
                    WIF: U. tomentosa'dan suda çözünmeyen fraksiyon ; TRB: terbinafin; FLZ: flukonazol; tek başına antifungal hücre hasarı (CDA) ve kombinasyon halinde (CDC) yüzde (%) olarak ifade edilir. Hücresel hasarın, ilgili antifungal ajanların konsantrasyonları (C) gösterilir. Etkileşimi göstermek için ilave ve sinerjik etkilere sahip üç kombinasyon seçildi.

                    * FIC hesaplaması için kullanılan kombinasyonlar.
                    ** Farklı harfler  , MIC'ler için istatistiksel olarak farklı ( p <.05) sonuçları temsil eder . Mayaların taramalı elektron mikroskobu (SEM)

                    WIF, WIF-TRB ve WIF- FLZ'nin dirençli izolatların morfolojisi ve ultra yapısı üzerindeki etkisi C. krusei CK04 (Şekil 1). Normal tomurcuklanma profili (Şekil 1 (A), (C) ve (E)). Düzensiz tomurcuklanma kalıpları, hücre duvarlarında biriken materyal ve tek başına WIF ile tedaviden sonra hücre bütünlüğünün kaybı ile tezat teşkil eder (Şekil 1 (B)) ve TRB (Şekil 1 (D)) ve FLZ (Şekil 1 (F)).
                    Bir resim, illüstrasyon vb. İçeren harici bir dosya. Nesne adı IPHB_A_1242631_F0001_B.jpg'dir.
                    Ayrı bir pencerede aç
                    Şekil 1.
                    Tek başına ve terbinafin (TRB) ve flukonazol (FLZ) ile kombinasyon halinde Uncaria tomentosa'dan WIF fraksiyonu ile muamele edilen Candida krusei'nin (CK04) SEM mikrografları . (A) Tedavi olmaksızın kontrol (10.000 x); (B) WIF 7,81 ug ml-1 (10.000 x); (C) FLZ dirençli suş 64 ug ml-1 (10.000 x); (D) WIF-FLZ 3.91: 16 ug ml-1 konsantrasyon oranı (18.000 x); (E) TRB dirençli suş 32 ug ml-1 (5000 x); (F) WIF-TRB 7.81: 16 μg ml-1 (1000 ×). Numune karışımının taramalı elektron mikroskobu (SEM)

                    WIF, FLZ, WIF-FLZ, TRB ve WIF-TRB'den fotomikrograflar (şekil 2) kesin kristal modifikasyonlarının açık bir şekilde gözlemlenmesine izin verir. FLZ mikrografları, düzensiz ve çatlak yüzeye ve bazen sivri alışkanlığa sahip topaklaşmış partiküller gösterdiŞekil 2 (A) ve (B)), TRB olanlar çeşitli boyutlarda düz plaka şeklinde kristaller sunarken (Şekil 2 (E)). FLZ'nin kristal habitatındaki değişiklikler, FLZ: WIF karışımının (Şekil 2 (D)), özellikle, şekilsiz ve gevşek bir matris içinde emilen iğne şeklindeki mikro kristallerin görünümü. WIF-TRB karışımı, hafif düzensiz bir yüzeye ve etrafındaki amorf yapılara sahip kırık plakalar halinde meydana geldi (Şekil 2 (F)). İlk bakışta, kristal habitatındaki bu morfolojik değişim, dondurarak kurutma ve kristalizasyon ortamının kendisi gibi faktörlere atfedilebilir, ancak bu, bu modifikasyonların nedeni olarak moleküler etkileşim olasılığını tamamen dışlamaz.
                    Bir resim, illüstrasyon vb. İçeren harici bir dosya. Nesne adı IPHB_A_1242631_F0002_B.jpg'dir.
                    Ayrı bir pencerede aç
                    Şekil 2.
                    U. tomentosa (WIF), (C) flukonazol, (D) dondurularak kurutulmuş WIF-flukonazol karışımı, (E) terbinafin, (F) dondurularak kurutulmuş WIF'nin (A) ve (B) suda çözünmeyen fraksiyonundan elde edilen SEM fotomikrografları -terbinafin ilişkisi. Diferansiyel taramalı kalorimetri (DSC) analizi

                    WIF, FLZ, TRB ve ilgili kombinasyonların DSC termogramları Figür 3. WIF, yaklaşık 80 ° C'de geniş ve tanımlanmamış bir endotermik tepe sunarak amorf durumunu (Şekil 3 (A)). FLZ termogramı, 140 ° C'de tek, keskin bir tepe ve yaklaşık 300 ° C'de ortalanmış geniş bir endotermik süreç gösterdi, termal bozunmayı yansıtıyor (Şekil 3 (B)). TRB termogramı, 205 ° C'de karakteristik bir açık başlangıç ​​pik gösterdi ve bunu geniş bir endotermik işlem izledi. Hem TRB hem de FLZ'nin WIF ile kombinasyonunun etkisi, kritik konsantrasyon oranları (Şekil 1 (D) ve (F)). TRB ve FLZ termogramlarındaki değişiklikler, WIF ile kombinasyonlarından sonra açıkça fark edildi. TRB zirvesinin tamamen kaybolması ve FLZ başlangıç ​​zirvesinin 175 ° C'ye yer değiştirmesi, WIF'in TRB ve FLZ ile belirsiz bir şekilde güçlü bir moleküler etkileşimini gösterdi. Ayrıca, daha fazla DSC analizi, moleküler etkileşimin yoğunluğunun antifungal: WIF konsantrasyon oranına (atlanan veriler) bağlı olduğunu gösterdi.
                    Bir resim, illüstrasyon vb. İçeren harici bir dosya. Nesne adı IPHB_A_1242631_F0003_C.jpg'dir.
                    Ayrı bir pencerede aç
                    Figür 3.
                    Diferansiyel tarama kalorimetrisi (DSC), (A) suda çözünmeyen fraksiyonun eğrileri A.B.D. tomentosa kabuğu (WIF), (B), flukonazol (FLZ), (C) WIF: FLZ 1: 2 kombinasyon oranı, (D), terbinafin (TRB ), (E) WIF: TRB 1: 4 kombinasyon oranı. U. tomentosa , terbinafin, flukonazol ve bunların kombinasyonlarından WIF'in FT-IR analizleri

                    WIF'den FT-IR spektrumu, 3230 cm- 1 (bir OH polimer birliğine atanmış), 1613 cm- 1 (polifenol bileşiklerinde fenil karakteristiğinin C-C halkası), 1445 cm- 1 ( aromatik C = C) ve 1065 cm −1 (halka aromatik C – H bağı) (Şekil 4 (A) ve (D)). Literatür verilerine (fan olarak karşılaştırarak 1981 ), bazı gruplar 1.540--1.520 cm kateşin ve prosiyanidin türevleri, örneğin, bantların mevcudiyetini öne -1 (kateşinlerin hidroksil ile ilgili) ve 780-770 cm parmak bantları - 1 (düzlem dışı deformasyon aromatik H-bağları).
                    Bir resim, illüstrasyon vb. İçeren harici bir dosya. Nesne adı IPHB_A_1242631_F0004_C.jpg'dir.
                    Ayrı bir pencerede aç
                    Şekil 4.
                    (A) WIF fraksiyonunun FT-IR spektrumu; (B) terbinafin; (C) kompleks (WIF: 1: 4 kombinasyon oranında TRB); (D) WIF; (E) flukonazol; (F) ilişki (WIF: FLU, 1: 2 kombinasyon oranında).

                    TRB spektrumu (Şekil 3 (B)) 2440 cm büyük bir yoğunluk bandı göstermiştir -1 ek bantlar ile ilişkili (C = C titreşim), 1450-1500 cm- -1 (aromatik C = C) ve 600-800 cm -1 (Cı-Cı) izin veren bir terbinafin hidroklorürün güvenilir bir şekilde tanımlanması (Silverstein ve diğerleri 1991 ; Arunprasad ve diğerleri 2010 ). Üçüncül bir amin olarak, 3300–3500 cm- 1 spektrum aralığında tipik N – H bağ bantları yoktur .

                    FLZ spektrumu literatür verileriyle (Cyr ve ark. 1996 ), özellikle 3119, 1507 ve 1420 cm- 1 (triazol CH bağları), 1618 cm- 1 (aromatik halka germe), 1074 cm- 1 (C –OH bağı) ve 1114 cm −1 (C – F bağı).

                    WIF-TRB kombinasyonunun FT-IR spektrumları, 1: 4 konsantrasyon oranında WIF: TRB karışımı ile gösterildi. Değerlendirilebilecek ana modifikasyon 3308 ve 1613 cm, WIF tayf bantlarında tamamen yok olduğunu -1 ve 2440 cm alan eski TRB bant -1 (bir C = C titreşime verilen). Son bir, 2631 cm yeni bir bandın aynı zamanda oluşumu ile ilgili olarak -1 fark edildi. TRB tek başına 1360-1470 cm üç bant gösterdi -1 1453 cm-yer sadece bir düşürülmüştür bölgesi, -1 . 700–900 cm- 1 bölgesinde ek spektral değişiklikler fark edilebilir .

                    WIF-FLZ kombinasyonunun FT-IR spektrumları, 1: 2 konsantrasyon oranına sahip karışımla örneklendi. Ana değişiklik , sırasıyla WIF ve FLZ'nin 3308 cm- 1 ve 3119 cm- 1 bantlarının kaybolmasıydı ; 2600–2900 cm- 1 aralığında yeni bir bandın ortaya çıkması ve aromatik halka karbon bağlarına atıfta bulunarak 1614 cm- 1 bandında bir yoğunluk düşüşü . Ayrıca, 1300–1400 cm −1 ve 600–800 cm −1 aralığı bazı değişiklikleri kanıtladı. TRB ile birleştirilen çözünmeyen fraksiyonla işlemden sonra psödomyceliumun FT-IR analizi

                    C. krusei'nin psödomyceliumunun FT-IR spektrumları, WIF ile tedaviden sonra, tek başına veya TRB (Şekil 5). WIF ile tedaviden sonra , daha önce tarif edildiği gibi, absorpsiyon bantları membran lipidleriyle ilişkili olan 2996–2800 cm- 1 ve 1500-1200 cm- 1 bölgesinde önemli bir değişiklik gözlenmedi (Galindo ve ark. 2013 ). 1359 cm- 1 bandında WIF-TRB tarafından indüklenen küçük değişiklik , geçici olarak hücre duvarı lipidleri ile etkileşimlere atanmıştır. Bunun aksine, 1600-400 cm- 1 ve 900-600 cm- 1 bölgelerindeki daha yoğun spektral değişiklikler, WIF'nin hücre duvarı proteinleri ve polisakkaritlerle moleküler bir etkileşimini düşündürmektedir (Şekil 4), ancak yalnızca TRB ile gözlenenden farklıdır (Şekil 4 (C)). WIF-FLZ'nin FT-IR spektrumu, yalnızca FLZ ve WIF spektrumlarında açıklanan özelliklerin aynısını korudu (veriler gösterilmemiştir).
                    Bir resim, illüstrasyon vb. İçeren harici bir dosya. Nesne adı IPHB_A_1242631_F0005_C.jpg'dir.
                    Ayrı bir pencerede aç
                    Şekil 5.
                    C. krusei pseudomycelium'un (A) işlem görmeden kontrole, (B) U. tomentosa kabuğundan suda çözünmeyen fraksiyonuna (WIF) , (C) terbinafine dirençli suşa, (D) WIF: 1: 4'te TRB'ye maruz kalan FT-IR spektrumları kombinasyon oranı. Efluks pompası deneyi

                    Efluks pompalarının aktivitesi, direnç ATP-bağlayıcı Cassete (ABC) efluks pompasına bağlı olduğunda MIC'yi azaltan inhibitör verapamil kullanılarak kontrol edildi. İki çoklu dirençli izolatın, yani CK6258 ve CG40039'un mantar duyarlılığı, TRB ve FLZ için test edilmiştir. Her iki durumda da, MİK değerlerinde önemli bir değişiklik tespit edilememiştir.

                    Şuraya gidin: Tartışma

                    Antifungal ilaçların bitkisel bileşiklerle kombinasyonu, katkı ve sinerjistik etkiler yoluyla antifungal aktiviteyi iyileştirmek için potansiyel bir strateji olarak anılmıştır (Wagner & Ulrich-Merzenich 2009 ). Bitki polifenolleri ile ilgili olarak, çok az çalışma bu konuya odaklanmıştır. Punica granatum'dan polifenollerin flukonazol ile kombinasyonu, C. albicans ve C. parapsilosis'e karşı MIC değerlerinin iki kat azalmasına izin vermesidir.suşlar (10). Sinerjik etki polifenol punikalajine atfedilmiş olsa da, bu bulgunun arkasındaki mekanizmayı daha iyi aydınlatmak için başka kanıt sunulmadı. Benzer şekilde, çeşitli çalışmalar bitki türevlerinin antifungal aktivitesini göstermeye odaklanmıştır (Silva ve diğerleri 2011 ; Ahmad ve diğerleri 2013 ; Jun ve diğerleri 2013 ); ancak çok azı, bu bileşikler arasında meydana gelen kimyasal ve fizikokimyasal etkileşimlerin hücre morfolojisi üzerindeki etkisine yaklaşmıştır.

                    WIF'in kimyasal karakterizasyonu önceki bir çalışmada yapılmıştır (Moraes ve diğerleri 2015 ). Kedinin pençe kabuğundan elde edilen bu suda çözünmeyen fraksiyon, esas olarak proantosiyanidinleri (% 70.80, ağ / ağ) ve az miktarda oksindol alkaloidleri (% 7.91, ağ / ağ), kinovik asit glikozitleri (% 7.79, ağ / ağ) ve düşük moleküler ağırlıklı polifenoller (% 3.77, a / a). Ayrıca, anti- Candida WIF aktivitesi, daha önce (15.62 ug 3.90 den MİK / ml karşı kuruldu glabrata C , C. krusei ve C. parapsilosis ) (Moraes ve ark. 2015). Bununla birlikte, FLZ ve TRB ile potansiyel sinerjisi o dönemde çok az ilgi gördü. Esasen, kedinin pençe kabuğunun hidroetanolik ekstraktından suda çözünen ve suda çözünmeyen fraksiyonlardaki oksindol alkaloidler (OALK), düşük moleküler kütleli polifenoller (LMPOL) ve kinovik asit türevleri (QAD) içerikleri daha önce HPLC-PDA ile test edildi. . Çözünmeyen proantosiyanidin benzer analizi (PROAN) fraksiyonu oligomerleri (veri atlanmıştır) kateşin ve epikateçin esas olarak gösteren, daha önceki çalışmaları onaylamıştır (Gonçalves ve ark. 2005 ) Buna ek olarak, PROAN içeriği vanilin testi (Moraes tarafından her iki fraksiyonda da belirlendi , vd. 2015 ). Bu yazarlar ayrıca Candida'ya karşı antifungal aktivite arasında yakın bir ilişki olduğunu bildirdiler.türleri ve her iki fraksiyonun kimyasal bileşimi ile ilgili bazı özellikler. Bu nedenle, önemli miktarlarda OALK, LMPOL ve QAD içeriyorlardı, ancak PROAN içeriği diğerlerini geride bıraktı ve suda çözünmeyen fraksiyonda açıkça daha yüksekti (% 21.07'ye karşı% 70.80). PROAN fraksiyonunun, terbinafin ve flukonazol için belirlenenleri bile aşan, Candida'ya karşı en yüksek antifungal aktiviteyi gösterdiği gerçeğiyle ilişkili görünüyordu . Bu arada OALK, LMPOL ve QAD fraksiyonları, ayrı ayrı test edildiğinde her iki türe karşı oldukça etkisizdi.

                    Bu çalışmada, bu amaç için azol ve terbinafin direnci gösteren altı C. krusei ve C. glabrata izolatı seçildi ve ayrı ayrı FLZ ve TRB ile ama aynı zamanda WIF ile birleştirilerek muamele edildi. Test edilen tüm izolatlarda WIF-antifungal kombinasyonun tek başına TRB ve FLZ'den daha etkili olduğu kanıtlanmıştır. Aslında, fraksiyonel inhibitör konsantrasyon (FIC) verileri (tablo 1), her iki antifungalin WIF ile kombinasyonuyla ilişkili sinerjik ve ilave etkileri ortaya çıkardı. Hücre hasar testinden elde edilen veriler bu bulguyu güçlendirmeye izin verdi (Tablo 2). Sinerjistik etki, WIF-TRB kombinasyonunun test edildiği durumlarda, özellikle testlerin% 66'sında yaygındı. WIF-FLZ kombinasyonuyla ilgili olarak benzer bir etki gözlendi, ancak burada% 50'ye düşüyor. Ayrıca, C. krusei izolatları, özellikle% 80'in üzerindeki inhibisyon seviyelerinin fark edildiği TRB-WIF kombinasyonuna en duyarlı olanlardı. Bu durumda, TRB-WIF'in MİK değeri, tek başına TRB ile karşılaştırıldığında 16 kata kadar düşmüştür. Candida izolatları arasında antifungal duyarlılık farklı olsa da , hücre morfolojisindeki bazı önemli değişiklikler SEM analizi ile fark edilebilir. Bu vesileyle, C. kruseiCK04, bu izolat için şüpheye yer bırakmayacak şekilde gözlemlenen sinerjistik etki nedeniyle örnekleme amacıyla seçilmiştir. WIF-TRB ve WIF-FLZ'nin alt inhibitör konsantrasyonu ile tedavi edilen CK04 sözde hifinin SEM mikrografları (Şekil 1), düzensiz tomurcuklanma modeli, hücre duvarında biriken materyal ve hücre bütünlüğünün kaybı gibi önemli morfolojik değişiklikleri ortaya çıkardı. Düşünce çizgisini diğer izolatlara doğru genişleterek, hem antifungal hem de sinerjistik etkilerin, en azından hücre duvarının yapısındaki hasarla doğrudan ilişkili olabileceğini varsayabiliriz. Buna ek olarak, maya hücresi duvarı üst yapısında ve bitki ekstraktları ile ilişkili antifungallerin neden olduğu değişiklikler hakkında literatürde bildirilen benzer bulgular (Nakamura ve diğerleri 2004 ; Ishida ve diğerleri 2006 ; Endo ve diğerleri 2010 ) varsayımımızı destekleme eğilimindedir. .

                    Bitkisel ürünlerle bağlantılı olarak antifungaller ile ilgili moleküler etkileşimler DSC tarafından kolaylıkla değerlendirilebilir (Pawar ve ark. 2012 ). Bu çalışmada, WIF'in terbinafin ve flukonazol ile kombinasyonları için kaydedilen termogramlarda gözlemlenen değişiklikler, 205 ° C ve 140 ° C'de TRB ve FLZ'nin karakteristik endotermik zirvelerinin kaybolmasının yanı sıra, Sırasıyla 195 ° C ve 175 ° C. Benzer şekilde, Al-Marzouqi ve ark. Flukonazol-siklodekstrin sistemlerini inceleyen ( 2009 ), DSC ile ölçülen flukonazol zirvelerinin kayması yoluyla inklüzyon komplekslerini doğrulamayı başardı. Bu nedenle bulgular, WIF ve her iki ilaç arasında meydana gelen moleküler etkileşimler hakkında çok az şüphe bırakmaktadır.

                    WIF'in FT-IR analizi, daha önce fark edildiği gibi, kateşin türevlerinin baskınlığını ve tanenlerin bazı karakteristik absorpsiyon modellerini ortaya çıkarmıştır (Morais ve diğerleri 1999 ; Hye ve diğerleri 2009 ). Ayrıca, WIF bileşiminden düşük moleküler ağırlıklı polifenollerin en azından somut miktarlarda çıkarılmasına ve ayrıca WIF ile her iki antifungaller TRB ve FLZ arasındaki etkileşimlerde yer alan fonksiyonel grupların tespit edilmesine izin verdi. Verilen 1750 cm civarındaki bir absorpsiyon bandı -1 (titreşim C = O gerilme ya da COOH, genellikle karboksilik asit ile ilgili (Manrique ve Lajolo 2002) gözlendi, gallik ve klorojenik asit ve bunların türevleri WIF bileşiminden çıkarılabilir. Ek olarak, WIF'in metanolik solüsyonunun UV analizi ile, 360 nm'nin üzerinde hiçbir absorpsiyon tespit edilmediğinden flavonoidler, izler gibi tespit edildi (veriler gösterilmemiştir) (Geiger & Quinn 1975 ).

                    Tanenler, alkaloidleri kovalent bağların (Spencer ve diğerleri 1988 ) ve muhtemelen TRB ve FLZ gibi diğer zayıf bazların oluşumu yoluyla kompleksleştirebilen polimerik polifenollerdir . Sonuç olarak, alkaloidlerin suda çözünürlüğü geliştirilebilir. Bu bağlamda, FT-IR tekniği, daha önce TRB ve polimer PEG 6000 ile ilişkili olduğu gibi, polimer-antifungal arasındaki moleküler etkileşimlerin veya yokluğunun doğrudan karakterizasyonuna izin verir (Kuminek ve diğerleri, 2013 ).

                    WIF, TRB ve FLZ'nin FT-IR ve DSC tarafından analizi, polifenoller ile antifungal arasındaki moleküler etkileşimlerin hücre zarının dışında gerçekleştiği hipotezini tutarlı bir şekilde desteklemektedir. Bu nedenle, antifungalin FT-IR spektrumlarının tek başına ve WIF ile kombinasyon halinde karşılaştırılması, 3000, 1600, 1400 ve 700–800 cm −1 bantlarında net farkların tanınmasına olanak tanır . Bu nedenle, hem antifungal ilaçlar hem de kedi pençe kabuğundan elde edilen WIF fraksiyonu arasındaki moleküler etkileşimleri yansıtır.

                    Ayrıca, TRB ve FLZ'nin ayrı ayrı ve WIF ile birlikte SEM analizi, antifungal: WIF etkileşiminin oluşumunu destekleyen ek bir bilgi sağlamıştır. Kristal habitatındaki değişim, yalnızca TRB'den alınan ve WIF ile birleştirilen fotomikrograflarda, yani pürüzsüz yüzey kristalleri ile kaplanmış bir şekilden (Şekil 2 (E)) amorf kütlelerin izine sahip çok yüzlü bloklara (Şekil 2 (F)). Benzer şekilde, FLZ kristalin habitat, düzensiz formlardan (Şekil 2 (C)) daha organize bir iğne şekilli forma (Şekil 2 (D)) WIF ile karıştırdıktan sonra.

                    Mikro yapı habitatındaki değişiklikler, TRB ve FLZ'yi WIF ile karıştırdıktan sonra erime noktasındaki termal değişiklikler ve diğer endotermik süreçler şüphesiz meydana geldiğinde yukarıda açıklanan DSC verileriyle uyumludur (Figür 3). Polimorfizm, mikonazol olarak bazı azol türevlerinde zaten tanınmış olsa da (Pedersen ve diğerleri , 1993 ), bu noktada, analiz izole maddeler yerine fiziksel karışımlar kullanılarak yapıldığında, polimorfizm lehine böyle bir ifade sorgulanabilir olacaktır. TRB ve FLZ dahil olmak üzere bazı antifungallerin kristal habitatları, kristalizasyon ortamına ve teknolojik işlemeye göre, ancak gerçek bir polimorfizmi ima etmeden belirgin bir değişikliğe uğrayabilir (Pedersen ve diğerleri 1993 ; Kuminek ve diğerleri 2013 ). Sonuç olarak, FT-IR ve DSC verileriyle kanıtlandığı üzere, polimorfik olaylar somut bir antifungal-WIF etkileşimi lehine atılmalıdır.

                    C. krusei'nin (CK04) psödomikelyumunun FT-IR analizi , hücre duvarındaki WIF etkisini doğruladı. WIF ve WIF-TRB kombinasyonu, 1600-400 cm bulunan IR bantlarının değiştirilmesi ile muamele yoluyla -1 ve 900-600 cm -1 de fark edilemez olan duvar zarında bulunan protein ve polisakaritten modifikasyonlar belirtmektedir işlenmemiş mantar örneği. Galindo ve ark. ( 2013 ), bu bileşenlerin içeriğindeki bir azalma veya değişiklik, hücre bütünlüğünün kaybı ve antifungal membran geçirgenliğinin artması ile ilgili olabilir.

                    Verapamil, efluks pompasının bilinen bir inhibitörüdür ve sıklıkla antifungal direncin geri dönüşünü incelemek için kullanılmıştır. Glikoprotein-P (P-gp) amino asit dizisi ve mantar ATP bağlayıcı kaset (ABC) protein taşıyıcıları arasındaki büyük homolojiye rağmen, maya ABC proteinlerinin duyarlılığında büyük bir değişkenlik daha önce bildirilmiştir (Sanglard ve diğerleri 1997). ; Sanglard & Odds 2002 ). Bununla birlikte, FLZ ve TRB ile yapılan testten elde edilen veriler, TRB ve FLZ-çoklu dirençli izolatlar CK6258 ve CG40039'un direncinin ABC dışarı akma pompası ile ilgisiz olduğunu gösterdi (Guinea ve ark. 2006 ).

                    Şuraya gidin: Sonuç

                    Bir kedinin pençesinde suda çözünmeyen fraksiyonu, C. krusei ve C. glabrata'ya karşı FLZ ve TRB ile sinerjik etki gösterir . DSC ve FT-IR verileri, esas olarak proantosiyanidinlerden oluşan bu fraksiyonun FLZ ve TERB ile tartışılmaz etkileşime girdiğini gösterdi. Polimorfik olayların ve ABC dışarı akış pompasının katılımı söz konusu değil gibi görünüyor. Mantar önleyici aktivite, hücre duvarı dışındaki moleküler etkileşim temelinde açıklanır, konu önemlidir ve aynı zamanda zordur.

                    Şuraya gidin: Açıklama bildirimi

                    Yazarlar çıkar çatışması olmadığını beyan ederler.

                    Şuraya gidin: Finansman

                    Bu çalışma Coordenação de Aperfeiçoamento do Pessoal de Nível Superior (CAPES) tarafından desteklenmiştir.

                    Şuraya gidin: Referanslar

                    • Aguilar JL, Rojas P, Marcelo A, Plaza A, Bauer R, Reininger E, Klaas CA, Merfort I. 2002. Uncaria tomentosa'nın (Rubiaceae) iki farklı özünün anti-inflamatuar aktivitesi . J Ethnopharmacol . 81 : 271–276. [ PubMed ] [ Google Akademik ]
                    • Ahmad A, Khan A, Manzoor N .. 2013. Akma aracılı antifungal direncin tersine çevrilmesi, flukonazol ile iki monoterpenin sinerjistik aktivitesinin altında yatar . Eur J Pharm Sci . 48 : 80–86. [ PubMed ] [ Google Akademik ]
                    • Al-Marzouqi AH, Elwy HM, Shehadi I, Adem A .. 2009. Süper kritik karbon dioksit ve geleneksel tekniklerle hazırlanan antifungal ilaç-siklodekstrin komplekslerinin fizikokimyasal özellikleri . J Pharm Biomed Anal . 49 : 227–233. [ PubMed ] [ Google Akademik ]
                    • Amaral S, Mira L, Nogueira JMF, Silva APD, Helena Florêncio M .. 2009. Anti-enflamatuar özelliklere sahip bitki özleri: biyoaktif bileşiklerinin karakterizasyonu ve yapı-antioksidan aktivite ilişkilerinin kurulması için yeni bir yaklaşım . Bioorgan Med Chem . 17 : 1876–1883. [ PubMed ] [ Google Akademik ]
                    • Amber K, Aijaz A, Immaculata X, Luqman KA, Nikhat M .. 2010. Ocimum sanctum uçucu yağının antikandidal etkisi ve flukonazol ve ketokonazol ile sinerjisi . Bitkisel Tıp . 17 : 921–925. [ PubMed ] [ Google Akademik ]
                    • Arunprasad K, Narayanan N, Rajalakshmi G .. 2010. Terbinafin hidroklorürün katı dispersiyonunun hazırlanması ve değerlendirilmesi . Int J Pharm Sci Rev Res . 3 : 131–134. [ Google Scholar ]
                    • Bossche HV.1985. Antifungal azol türevleri için biyokimyasal hedefler: etki modu üzerine hipotez . Curr Konular Med Mycol . 1 : 313–351. [ PubMed ] [ Google Akademik ]
                    • Caon T, Kaiser S, Feltrin C, Carvalho A, Sincero TCM, Ortega GG, Simões CMO .. 2014. Uncaria tomentosa'dan (kedi pençesi) farklı preparatların antimutagenik ve antiherpetik aktiviteleri . Food Chem Toxicol . 66 : 30-35. [ PubMed ] [ Google Akademik ]
                    • Ccahuana-Vasquez RA, Santos SSFD, Koga-Ito CY, Jorge AOC .. 2007. Oral insan patojenlerine karşı Uncaria tomentosa'nın antimikrobiyal aktivitesi . Brezilya Oral Res . 21 : 46–50. [ PubMed ] [ Google Akademik ]
                    • Chiou CC, Mavrogiorgos N, Tillem E, Hector R, Walsh TJ .. 2001. Aspergillus fumigatus'a karşı nikkomisin Z ve ekinokandin FK463 arasındaki etkileşimin sinerji, farmakodinamik ve zaman sekanslı ultra yapısal değişiklikleri . Antimicrob Agents Ch . 45 : 3310–3321. [ PMC ücretsiz makale ] [ PubMed ] [ Google Akademik ]
                    • Cruz MC, Goldstein AL, Blankenship JR, ​​Del Poeta M, Davis D, Cardenas ME, Perfect JR, McCusker JH, Heitman J. 2002. Calcineurin, Candida albicans'ta membran stresi sırasında hayatta kalmak için gereklidir . EMBO J. . 21 : 546–559. [ PMC ücretsiz makale ] [ PubMed ] [ Google Akademik ]
                    • Cyr T, Dawson B, Neville G, Shurvell H. 1996. Flukonazolün spektral karakterizasyonu . J Pharm Biomed Anal . 14 : 247–255. [ PubMed ] [ Google Akademik ]
                    • Endo EH, Garcia Cortez DA, Ueda-Nakamura T, Nakamura CV, Dias Filho BP .. 2010. Nar kabuklarından izole edilen ekstraktların ve saf bileşiğin güçlü antifungal aktivitesi ve Candida albicans'a karşı flukonazol ile sinerjizm . Res Microbiol . 161 : 534–540. [ PubMed ] [ Google Akademik ]
                    • Foo L.1981. Proantosiyanidinler: kızılötesi spektrumlara göre genel kimyasal yapılar . Bitki kimyası . 20 : 1397–1402. [ Google Scholar ]
                    • Galindo T, Pereira R, Freitas A, Santos-Rocha T, Rasteiro M, Antunes F, Rodrigues D, Soares A, Gonçalves F, Duarte A. 2013. Organik ve inorganik nanopartiküllerin dört beyaz çürük mantar türüne toksisitesi . Sci Total Environ . 458 : 290–297. [ PubMed ] [ Google Akademik ]
                    • Geiger H, Quinn C .. 1975. Flavonoidler: Biflavonoidler . 1. baskı New York: Springer. [ Google Scholar ]
                    • Gonçalves C, Dinis T, Batista MT .. 2005. Uncaria tomentosa kabuğu kaynatmasının proantosiyanidinlerinin antioksidan özellikleri: anti-enflamatuar aktivite için bir mekanizma . Bitki kimyası . 66 : 89–98. [ PubMed ] [ Google Akademik ]
                    • Gine J, Sanchez-Somolinos M, Cuevas O, Pelaez T, Bouza E. 2006. Candida krusei'de flukonazole direnç mekanizmaları: efluks pompalarının katkısı . Med Mycol . 44 : 575–578. [ PubMed ] [ Google Akademik ]
                    • Heitzman ME, Neto CC, Winiarz E, Vaisberg AJ, Hammond GB .. 2005. Uncaria'nın (Rubiaceae) etnobotani , fitokimyası ve farmakolojisi . Bitki kimyası . 66 : 5–29. [ PubMed ] [ Google Akademik ]
                    • Hye MA, Taher MA, Ali MY, Ali MU, Zaman S. 2009. (+) - kateşinin Akasya catechu'dan ( kesme ağacı) uygun bir yöntemle izolasyonu . J Sci Res . 1 : 300–305. [ Google Scholar ]
                    • Ishida K, de Mello JCP, Cortez DAG, Dias Filho BP, Ueda-Nakamura T, Nakamura CV .. 2006. Stryphnodendron adstringens kaynaklı tanenlerin Candida albicans'ın büyüme ve virülans faktörleri üzerindeki etkisi . J Antimicrob Chemother . 58 : 942–949. [ PubMed ] [ Google Akademik ]
                    • Jun H, Kim J, Bang J, Kim H, Beuchat LR, Ryu JH .. 2013. Sulandırılmış bebek pirinç tahılında Bacillus cereus'un büyümesini engellemede bitki özlerinin kombine etkileri . Int J Food Microbiol . 160 : 260–266. [ PubMed ] [ Google Akademik ]
                    • Kaiser S, Verza SG, Moraes RC, Pittol V, Peñaloza EMC, Pavei C, Ortega GG .. 2013a. Kutu-behnken tasarımı ile kedi pençe kabuğundan polifenollerin, oksindol alkaloidlerinin ve kinovik asit glikozitlerinin ekstraksiyon optimizasyonu . Ind Crop Prod . 48 : 153–161. [ Google Scholar ]
                    • Kaiser S, Verza SG, Moraes RC, De Resende PE, Barreto F, Pavei C, Ortega GG .. 2013b. Yaygın ekstraksiyon yöntemleriyle indüklenen kedi pençesi oksindol alkaloid izomerizasyonu . Quim Nova . 36 : 808–814. [ Google Scholar ]
                    • Kaiser S, Carvalho AR, Pittol V, Dietrich F, Manica F, Machado MM, De Oliveira LFS, Battastini AMO, Ortega GG .. 2016. Uncaria tomentosa'dan (kedi pençesi) oksindol alkaloidlerin genotoksisitesi ve sitotoksisitesi: kemotip alaka düzeyi . J Ethnopharmacol . 189 : 90–98. [ PubMed ] [ Google Akademik ]
                    • Kloucek P, Svobodova B, Polesny Z, Langrova I, Smrcek S, Kokoska L .. 2007. Peru Amazonlarında kullanılan bazı tıbbi kabukların antimikrobiyal aktivitesi . J Ethnopharmacol . 111 : 427–429. [ PubMed ] [ Google Akademik ]
                    • Kontoyiannis DP, Lewis RE .. 2004. Daha etkili antifungal tedaviye doğru: kombinasyon tedavisinin beklentileri . Br J Haematol . 126 : 165–175. [ PubMed ] [ Google Akademik ]
                    • Kuminek G, Rauber GS, Riekes MK, Campos CEMD, Monti GA, Bortoluzzi AJ, Cardoso SG .. 2013. Tek kristal yapı, terbinafin hidroklorürün katı hal karakterizasyonu ve çözünme hızı . J Pharm Biomed Anal . 78 : 105–111. [ PubMed ] [ Google Akademik ]
                    • Lenzi RM, Campestrini LH, Okumura LM, Bertol G, Kaiser S, Ortega GG, Maurer JBB .. 2013. Uncaria tomentosa (Willd.) DC'nin sulu fraksiyonlarının makrofaj modülatör aktiviteleri üzerindeki etkileri . Gıda Res Int . 53 : 767–779. [ Google Scholar ]
                    • Lewis RE, Diekema DJ, Messer SA, Pfaller MA, Klepser ME .. 2002. Candida türlerine karşı test edilen antifungal ajanlar arasındaki sinerji veya antagonizmanın saptanması için Etest, karatahta seyreltme ve zaman öldürme çalışmalarının karşılaştırılması . J Antimicrob Chemoth . 49 : 345–351. [ PubMed ] [ Google Akademik ]
                    • Manrique GD, Lajolo FM .. 2002. Olgunlaşan papaya meyvesinden izole edilen pektinlerde metil esterleşme derecesini ölçmek için bir araç olarak FT-IR spektroskopisi . Postharvest Biol Tec . 25 : 99–107. [ Google Scholar ]
                    • Maurya IK, Pathak S, Sharma M, Sanwal H, Chaudhary P, Tupe S, Deshpande M, Chauhan VS, Prasad R .. 2011. Reaktif oksijen türlerinin (ROS) birikmesi ve hücre duvarının bozulmasıyla yeni sentetik peptitlerin antifungal aktivitesi Candida albicans'a karşı . Peptitler . 32 : 1732–1740. [ PubMed ] [ Google Akademik ]
                    • Méan M, Marchetti O, Calandra T .. 2008. Bench-to-bedside review: Yoğun bakım ünitesinde Candida enfeksiyonları . Crit Care . 12 : 204. [ PMC ücretsiz makale ] [ PubMed ] [ Google Akademik ]
                    • Montserrat-De La Paz S, De La Puerta R, Fernandez-Arche A, Quilez AM, Muriana FJ, Garcia-Gimenez MD, Bermudez B .. 2015. Birincil insan monositlerinde Uncaria tomentosa'dan mitrafilinin farmakolojik etkileri : M2 makrofajlarına doğru çarpıklık . J Ethnopharmacol . 170 : 128–135. [ PubMed ] [ Google Akademik ]
                    • Moraes RC, Dalla Lana AJ, Kaiser S, Carvalho AR, de Oliveira FS, Fuentefria AM, Ortega GG .. 2015. Dirençli non- albicans Candida izolatları üzerinde Uncaria tomentosa (Willd.) DC'nin antifungal aktivitesi . Ind Crop Prod . 69 : 7-14. [ Google Scholar ]
                    • Morais SA, Nascimento EA, Queiroz CR, Piló-Veloso D, Drumond MG .. 1999. Astronium urundeuva ağacının polifenolleri ve lignini üzerine çalışmalar . J Braz Chem Soc . 10 : 447–452. [ Google Scholar ]
                    • Morschhäuser J.2002. Candida albicans'ta flukonazole direnç gelişiminin genetik temeli . Biochim Biophys Açta . 1587 : 240–248. [ PubMed ] [ Google Akademik ]
                    • Mukherjee PK, Sheehan DJ, Hitchcock CA, Ghannoum MA .. 2005. İstilacı mantar enfeksiyonlarının kombinasyon tedavisi . Clin Microbial Rev. . 18 : 163–194. [ PMC ücretsiz makale ] [ PubMed ] [ Google Akademik ]
                    • Nakamura CV, Ishida K, Faccin LC, Cortez DAG, Rozental S, de Souza W, Ueda-Nakamura T. 2004. Ocimum gratissimum L.'den uçucu yağın dört Candida türüne karşı in vitro aktivitesi . Res Microbiol . 155 : 579–586. [ PubMed ] [ Google Akademik ]
                    • Pavei C, Kaiser S, Borré GL, Ortega GG .. 2010. Kedi pençesinde ( Uncaria tomentosa ) polifenoller deneyi için bir LC yönteminin doğrulanması . J Liq Chromatogr RT . 33 : 1551–1561. [ Google Scholar ]
                    • Pavei C, Kaiser S, Verza SG, Borré GL, Ortega GG .. 2012. UPLC / Q-TOF-MS analizi ile ilişkili Cat's pençesinde (Uncaria tomentosa) kinovik asit glikozitler deneyi için HPLC-PDA yöntemi . J Pharm Biomed Anal . 62 : 250–257. [ PubMed ] [ Google Akademik ]
                    • Pawar B, Joshi M, Srivastava S, Kanyalkar M .. 2012. Yeni bir antifungal ajan arayışı: NMR ve DSC teknikleriyle model membranlarla flukonazol ve analoglarının moleküler etkileşimlerinin araştırılması . J Pharm Pharmacol . 64 : 802–810. [ PubMed ] [ Google Akademik ]
                    • Pedersen M, Pedersen S, Sorensen AM .. 1993. İlaç ve p-siklodekstrinlerin katı sistemlerinin hazırlanması sırasında mikonazolün polimorfizmi . Pharmac Açta Helvetiae . 68 : 43–47. [ Google Scholar ]
                    • Pilarski R, Zielinski H, Ciesioka D, Gulewicz K .. 2006. Uncaria tomentosa ( willd .) DC'nin etanolik ve sulu özlerinin antioksidan aktivitesi . J Ethnopharmacol . 104 : 18–23. [ PubMed ] [ Google Akademik ]
                    • Prudêncio C, Sansonetty F, Sousa MJ, Côrte-Real M, Leão C .. 2000. Akış pompalarının hızlı tespiti ve bunların maya hücrelerinde ilaç direnci ile ilişkisi . Sitometri . 39 : 26–35. [ PubMed ] [ Google Akademik ]
                    • Ryder NS, Wagner S, Leitner I .. 1998. Candida albicans ve diğer patojenik mayaların kutanöz izolatlarına karşı terbinafinin in vitro aktiviteleri . Antimicrob Agents Chemother . 42 : 1057–1061. [ PMC ücretsiz makale ] [ PubMed ] [ Google Akademik ]
                    • Sanglard D. 2003. Mantar patojenlerinde antifungal ilaçlara direnç ve tolerans mekanizmaları . Mikolog . 17 : 74–78. [ Google Scholar ]
                    • Sanglard D, Odds FC .. 2002. Candida türlerinin antifungal ajanlara direnci : moleküler mekanizmalar ve klinik sonuçlar . Lancet Infect Dis . 2 : 73–85. [ PubMed ] [ Google Akademik ]
                    • Sanglard D, Ischer F, Monod M, Bille J. 1997. Azol antifungal ajanlara direnç kazandıran Candida albicans genlerinin klonlanması : yeni bir çoklu ilaç ABC taşıyıcı geni olan CDR2'nin karakterizasyonu . Mikrobiyoloji . 143 : 405–416. [ PubMed ] [ Google Akademik ]
                    • Segal R, Kritzman A, Cividalli L, Samra Z, David M .. 1996. Candida tırnak enfeksiyonunun terbinafin ile tedavisi . J Am Acad Dermatol . 35 : 958–961. [ PubMed ] [ Google Akademik ]
                    • Silva F, Ferreira S, Duarte A, Mendonça DI, Domingues FC .. 2011. Coriandrum sativum uçucu yağının antifungal aktivitesi, Candida türlerine karşı etki modu ve amfoterisin B ile potansiyel sinerjizm . Bitkisel Tıp . 19 : 42–47. [ PubMed ] [ Google Akademik ]
                    • Silverstein R, Bassler G, Morrill T .. 1991. Organik bileşiklerin spektrometrik tanımlanması . 5. baskı New York: John Wiley and Sons. [ Google Scholar ]
                    • Spencer CM, Cai Y, Martin R, Gaffney SH, Goulding PN, Magnolato D, Lilley TH, Haslam E .. 1988. Polifenol kompleksi - bazı düşünceler ve gözlemler . Bitki kimyası . 27 : 2397–2409. [ Google Scholar ]
                    • Sun B, Ricardo-da-Silva JM, Spranger I .. 1998. Kateşinler ve proantosiyanidinler için vanilin deneyinin kritik faktörleri . J Agric Food Chem . 46 : 4267–4274. [ Google Scholar ]
                    • Wagner H, Ulrich-Merzenich G .. 2009. Sinerji araştırması: yeni nesil fitofarmasötiklere yaklaşma . Bitkisel Tıp . 16 : 97–110. [ PubMed ] [ Google Akademik ]
                    • White RL, Burgess DS, Manduru M, Bosso JA .. 1996. Sinerjiyi tespit etmek için üç farklı in vitro yöntemin karşılaştırması : zaman öldürme, dama tahtası ve E testi . Antimicrob Agents Chemother . 40 : 1914–1918. [ PMC ücretsiz makale ] [ PubMed ] [ Google Akademik ]
                    • Yan Z, Hua H, Xu Y, Samaranayake LP .. 2012. Geleneksel Çin tıbbı ekstraktlarından elde edilen saf bileşiklerin altı oral Candida türüne karşı güçlü antifungal aktivitesi ve azole dirençli Candida albicans'a karşı flukonazol ile sinerji . Kanıta Dayalı Zorunlu Alt . 2012 : 106583. doi: 10.1155 / 2012/106583. [ PMC ücretsiz makale ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
                    • Zhang Q, Zhao JJ, Xu J, Feng F, Qu W .. 2015. Uncaria cinsinin tıbbi kullanımları, fitokimyası ve farmakolojisi . J Ethnopharmacol . 173 : 48–80. [ PubMed ] [ Google Akademik ]

                    Yorum yap

                    Hazırlanıyor...
                    X