Duyuru

Collapse

Devamını görüntüle
See less

Harnup, Epi Harnup, Keçiboynuzu

Collapse
X
  • Filtrele
  • Zaman
  • Göster
Hepsini Sil
new posts

  • Harnup, Epi Harnup, Keçiboynuzu

    KEÇİBOYNUZU



    Ağaç | 5-10m | 5-6 Aylar | Ça,Na | Meyvesi ve Tohumu

    Keçiboynuzu, Johannbrotbaum, Ceratonia siliqua
    Harnup
    Harnub

    Familyası: Sinamekigillerden, Sennagewaechse, Caselpiniaceae

    Drugları: Keçiboynuzu meyvesi: Ceratoniae fructus
    Keçiboynuzu tohumu: Ceratoniae semen
    Keçiboynuzunun meyvesi yenir, tohumları ise öğütülerek unu elde edilir ve bu un çay veya natürel ilaç yapımında kullanılır.

    Botanik: Vatanı doğu Akdeniz ülkeleri olup, buradan önce Hindistan, Brezilya, Arjantin, Avustralya, ABD, doğu ve güney Afrika ülkelerinde yetiştirilmeye başlanmıştır. Türkiye’nin ise Akdeniz ve Ege bölgesinin sahil şeridinde yabani olarak yetişir. Kanat yaprakları 3-5çift yapraktan meydana gelir ve her parça oval şekilde, kenarları düz, açık yeşil renkte, ortada ana damar ve ondan sağlı solu ayrılan yan damarlar mevcuttur. Yaprakları 4-5cm büyüklüğünde, parlak, alt yüzeyi kırmızımsı esmer renkte ve çok kısa saplıdır. Çiçekleri bir evli, yani erkek ve dişi çiçekleri bir ağaçta, erkek çiçekleri kırmızımsı, dişi çiçekleri yeşilimsi renkte ve topluca bir aradadır. Meyveleri 10-20cm uzunluğunda 2-4cm genişliğinde 1-2cm kalınlığında yastı uzun, önce yeşil sonra sarı ve nihayet olgunlaşınca koyu kahverengimsi veya siyahımsı esmer ve etlidir. Meyvenin içinde 10-20adet çok sert ve her biri 180-200mg ağırlığında tohumlar içer. Tohumları ile eskiden altın, pırlanta ve gümüş tartmak için kullanılmış ve bir tohum ’’kırat veya karat’’ ismi ile anılan 0,2 mg ağırlığa eşit olan bir tartı birimi olarak kullanılmıştır.

    Hasat zamanı: Sonbaharda olgunlaşan keçiboynuzları toplanarak kurutulur ve kaldırılır.

    Birleşimi: Meyvesinin birleşimindeki önemli maddeler;
    a) Karbonhidratlar %50-70 oranında olup Sakkaroz ve Glikozlardan meydana gelir.
    b) Ayrıca %1-2 Pektin, %2-3 Zamk, Sabit yağlar, alkaloitler ve Tanin içerir.
    Tohumlarının birleşimindeki maddeler; %90 oranında Galaktoman-noglykanlar içerir ve bu da Galaktomannanlar ve glikozlardan oluşur.

    Tesir şekli:
    a) Meyvesi hafif idrar artırıcı ve müshil yapıcıdır.
    b) Yaprak, dal ve kabukları; peklik yapıcı özelliklere sahiptir.
    c) Tohumları kusmayı önleyici, mikropları öldürücü, bağırsaklardaki kokuşmayı önleyici ve iltihapları önleyicidir.

    Kullanılması:
    a) Üniversite kliniklerinde tedavi denemekleri ve araştırmalar yapılma-mıştır. Bu nedenle bugünkü bilgilere göre 2. sınıf bir şifalı bitkidir. Keçiboynuzu yerine göre daha etkili olan başka bitkiler kullanılmalıdır. Örneğin gastritte karşı Kuşburnu, Elma, Çentiyan, ZYE, Lahana preparatları veya Gökçek İksiri daha etkilidir.
    b) Halk arasında öncelikle bebek ve çocuklardaki kusma ve ishale son-rada mide ve bağırsak iltihaplarına (gastrit ve gastroenterit) karşı kullanılır. Keçiboynuzu tohumu öğütülerek un haline getirilir ve bu un kullanılır.

    Yan tesirleri: Bilinen bir yan tesiri yoktur.

    https://www.youtube.com/embed/RRf8yigHV9g

    https://www.youtube.com/embed/x1Ox34Zip98

  • #2
    Keçiboynuzu (Ceratonia siliqua L.) meyve hidro-alkolik özü, erkek farelerde kurşunun üreme toksisitesini hafifletir: Sperm parametreleri, seks hormonları, oksidatif stres biyobelirteçleri ve Nrf2 ve iNOS ekspresyonuna ilişkin kanıtlar

    Ali Soleimanzadeh , 1, * Mehdi Kian , 1 Sajjad Moradi , 1 ve Soraya Mahmoudi 2
    Yazar bilgileri Makale notları Telif hakkı ve Lisans bilgileri Sorumluluk Reddi
    Bu makale, PMC'deki diğer makaleler tarafından alıntılanmıştır .
    Git: Soyut

    Amaç:

    Keçiboynuzu (Ceratonia siliqua L.) , güçlü antioksidan aktiviteye sahip meyveleri olan, yaprak dökmeyen bir ağaçtır. Bu çalışmanın amacı, erkek farelerde kurşunun (Pb) neden olduğu üreme toksisitesine karşı keçiboynuzu meyvesi hidro-alkolik ekstraktının (CFHAE) hafifletici etkilerini araştırmaktır. Malzemeler ve yöntemler:

    Kırk iki NMRI yetişkin erkek fare rastgele 7 gruba ayrıldı (N=6). Grup I kontrol grubuydu ve tedavi görmedi. Grup II sham grubuydu ve günde 0.2 ml distile su aldı. Grup III (Pb grubu) Pb asetat 1000 ppm/kg/gün aldı. Grup IV ve V, sırasıyla CFHAE 500 ve 1000 mg/kg/gün aldı. Grup VI ve VII, aynı anda sırasıyla 500 ve 1000 mg/kg/gün dozlarında hem Pb 1000 ppm/kg/gün hem de CFHAE aldı. Gruplara gavaj uygulandı. 35 gün sonra sperm parametreleri (sayı, hareketlilik, morfoloji, canlılık, DNA hasarı ve teratozoospermi indeksi), toplam antioksidan kapasite (TAC), azaltılmış glutatyon içeriği (GSH), antioksidan enzimler (SOD, CAT ve GPx) aktivitesi, MDA düzeyleri ve serumdaki cinsiyet hormonları (FSH, LH ve testosteron) konsantrasyonları, testis ekspresyonuNrf2 ve iNOS genleri ve histopatolojik değişiklikler değerlendirildi. Sonuçlar:

    Bulgularımız, CFHAE'nin Pb ile birlikte uygulanmasının, sperm parametrelerini, yüksek seks hormonlarını, TAC, GSH içeriğini ve serumun antioksidan enzim aktivitesini önemli ölçüde iyileştirdiğini, serum MDA düzeylerini düşürdüğünü ve aşağı regüle ettiğini ortaya koydu. Pb grubu ile karşılaştırıldığında Nrf2 ve iNOS genlerinin testis ekspresyonu . Ayrıca, CFHAE testis dokusunda Pb'nin neden olduğu histopatolojik değişiklikleri iyileştirdi. Çözüm:

    CFHAE, erkek farelerde Pb maruziyetinin ardından üreme toksisitesini hafifletebilir.

    Anahtar Kelimeler: Ceratonia siliqua, Pb zehirlenmesi, Oksidatif stres, Lipid peroksidasyonu, Nrf2, İndüklenebilir nitrik oksit sentaz, Erkek üreme sistemi
    Git: Tanıtım

    Kısırlık evli çiftlerin en önemli sorunlarından biri olarak kabul edilmektedir. Tüm infertilite vakalarının yaklaşık %50'sinde erkek faktörlü infertilitenin rol oynadığı tahmin edilmektedir (Sigman, 2007 ). Toksik maddelere çevresel maruziyet, erkek kısırlığı ile doğrudan ilişkilidir (Wong ve Cheng, 2011 ). Kurşun (Pb), çevrede bol miktarda toksik bir ağır metaldir (Bae ve diğerleri, 2001 ; Shotyk ve Le Roux, 2005 ). Bu ağır metal endüstrilerde yaygın olarak kullanılmaktadır ve birçok üründe ve bazı kozmetiklerde bulunmaktadır (Ayinde ve diğerleri, 2012 ; Chowdhury, 2009 ). Pb'ye insan maruziyeti hava, su, toprak, gıda ve tüketici ürünleri yoluyla gerçekleşebilir (Hammond, 1977 ).

    Kanıtlar, Pb'nin erkek üreme sistemi için toksik olduğunu aydınlattı. Pb'ye maruz kalma, reaktif oksijen türlerinin (ROS) oluşmasına, lipid peroksidasyonuna ve antioksidanların tükenmesine neden olarak testis dokusunda oksidatif stresin indüklenmesine neden olur (Moniem ve diğerleri, 2010 ; Reshma Anjum ve diğerleri, 2011 ; Ayinde ve diğerleri ., 2012 ; Reshma Anjum ve diğerleri, 2017 ; Elgawish ve Abdelrazek, 2014 ). Ayrıca Pb, sperm parametrelerini zayıflatır ve spermatozoanın aktivitesini azaltır (Chowdhury, 2009 ). Pb maruziyeti, sperm hücre içi siklik adenozin monofosfat ve kalsiyum düzeylerini azaltarak ve sperm proteinlerinin tirozin fosforilasyonunu azaltarak spermin normal işlevini bozar (He ve ark., 2016). ). Birçok çalışma, antioksidan bitkisel bitkilerin uygulanmasının deneysel modellerde Pb'nin neden olduğu oksidatif stresi hafifletebileceğini göstermiştir (El-Nekeety ve diğerleri, 2009 ; Dorostghoal ve diğerleri, 2014 ; Dkhil ve diğerleri, 2016 ; Soleimanzadeh ve diğerleri. , 2018 ).

    Fabaceae familyasına ait olan keçiboynuzu ( Ceratonia siliqua L. ) Akdeniz ülkelerinde yetiştirilen, yaprak dökmeyen bir ağaçtır (Dakia vd., 2007 ; Özcan vd., 2007 ). Bu bitki İran'ın Fars eyaletinde yaygın olarak yetişmektedir (Mokhtari ve diğerleri, 2012 ; Vafaei ve diğerleri, 2018 ). Keçiboynuzu meyvesi ağırlıkça %80-90 bakla ve %10-20 tohumdan oluşan 10-25 cm uzunluğunda kahverengi bir bakladır (Naghmouchi ve diğerleri, 2009 ; Tetik ve diğerleri, 2011 ). Keçiboynuzu meyvesi, flavonoidler ve polifenoller gibi yüksek miktarda antioksidan bileşiklere sahiptir ve güçlü radikal süpürücü aktiviteye sahiptir (Custódio ve diğerleri, 2009 ▶).; Kumazawa ve diğerleri, 2002 ; Owen ve diğerleri, 2003 ; Papagiannopoulos ve diğerleri, 2004 ). Daha önce yapılan çalışmalar, keçiboynuzunun farklı organlarda oksidatif strese karşı koruyucu etkilerini göstermiştir (Abdel-Rahman ve ark., 2018 ; Rahman ve ark., 2016 ; Rtibi ve ark., 2016a , 2016b, 2015; Suzek ve ark., 2017 ; Vafaei ve diğerleri, 2018 ).

    Fars geleneksel tıbbında keçiboynuzu meyvesi afrodizyak olarak ve erkek kısırlığını tedavi etmek için insan sperm hacmini artırmak için kullanılır. Son zamanlarda, keçiboynuzu kabuğunun sulu ekstraktının kısır farelerde erkek üreme parametreleri üzerinde faydalı bir etkiye sahip olduğu gösterilmiştir (Vafaei ve diğerleri, 2018 ). Mokhtari ve diğerleri tarafından yapılan bir başka çalışmada, keçiboynuzu tohumları hidro-alkolik özütünün uygulanması, seminifer tübüllerde seks hormonlarının seviyelerini ve sperm yoğunluğunu arttırmıştır (Mokhtari ve diğerleri, 2012 ). Ayrıca, keçiboynuzu baklası ekstraktının Pb toksisitesine karşı olası bir pozitif etkiye sahip olduğu ve Pb emilimini engelleyebileceği bildirilmiştir (Said ve ark., 2017 ). Bu nedenle bu çalışmada, keçiboynuzu meyvesi hidro-alkolik ekstraktının (CFHAE) Pb'nin neden olduğu oksidatif hasarlar üzerinde erkek üreme parametreleri üzerindeki olası hafifletici etkileri değerlendirilmiştir.

    Git: Malzemeler ve yöntemler

    Hayvanlar

    Kırk iki, 8-10 haftalık NMRI erkek faresi (30±6 g), İran'daki Urmia Tıp Üniversitesinin hayvan evinden satın alındı. Hayvanlar standart laboratuvar koşulları altında (25±2°C'de 12:12 saat aydınlık/karanlık döngüsü ile) tutuldu. Çalışmadan bir hafta önce iklime alıştırıldılar ve onlara musluk suyu ve ad libitum standart laboratuvar diyeti verildi . Deney protokolleri, Urmia Üniversitesi'ndeki Hayvanlar Etik Kurulu tarafından onaylandı (AECVU-170-2018).

    Bitki özü hazırlama

    Keçiboynuzu meyveleri bir İran bitki pazarından satın alındı ​​ve kimlikleri Doğal Kaynak Merkezi'nde (Herbaryum No. 7123) doğrulandı. Meyveler (tohumlar + baklalar) ince bir toz haline getirildi ve 72 saat boyunca %96 etanol (Merck, Darmstadt, Almanya) ve su (50:50 oranı) içinde ıslatıldı. Ekstraktı filtrelemek için Whatman filtresi No. 40 kullanıldı; bundan sonra öz, bir döner buharlaştırıcı (Heidolph Laborota 4000 verimli, Schwabach, Almanya) kullanılarak 50°C'de konsantre edildi. Kalan kahverengi macunsu ekstrakt, bir fırında 40°C'de kurutuldu (Mokhtari ve diğerleri, 2012 ). Sonunda, sonraki in vitro ve in vivo deneylerde kullanılmak üzere CFHEA -20°C'de tutuldu .

    Fenolik ve flavonoid bileşiklerini tanımlamak ve ölçmek için HPLC analizi

    Singleton'ın yönteminin Dewanto ve diğerleri tarafından değiştirilmiş bir versiyonuna dayanmaktadır. (Dewanto ve diğerleri, 2002 ), fenolik içerikleri analiz etmek için Folin-Ciocalteu reaktifi kullanıldı. Seyreltilmiş arzu edilen bir metanolik ekstrakttan bir kısım (0.125 mi), 0.125 ml Folin-Ciocalteu reaktifi içeren 0.5 ml deiyonize su içine döküldü. Daha sonra,% 7, Na, 1.25 ml 2 CO 3 karışıma ilave edildi ve çözelti, Na ilave edilmeden önce çalkalanır ve 6 dakika için bırakılmıştır 2 CO 3 . Çözeltinin son hacmini 3 ml'ye çıkarmak için deiyonize su ilave edildi. Daha sonra karışım tamamen karıştırıldı. Absorbans, 23°C'de 90 dakika inkübasyonun ardından hazırlanan köre karşı 760 nm'de okundu.

    Agilent Technologies 1100 serisi sıvı kromatografı (Ters fazlı HPLC), bir UV-çok dalga boyu dedektörü ile birleştirilmiş, fenolik bileşiği analiz etmek için benimsenmiştir. Ortam sıcaklığında 250x4.6 mm, 4 um Hypersil ODS C18 ters fazlı kolon ile ayırma gerçekleştirildi. Enjekte edilen hacim 20 ul idi ve enjeksiyondan önce numuneler 0.45 um'lik bir membran filtreden süzüldü ve tepe noktaları 280 nm'de izlendi. Fenolik bileşikler, alıkonma süreleri, piklerin standartlara göre spektral özellikleri ve numunenin standartlarla transfiksasyonu temelinde diğer bileşenlerden ayırt edildi. Analizler üç tekerrürlü olarak gerçekleştirilmiştir.

    Deneysel tasarım

    Hayvanlar 7 gruba ayrıldı ve her grupta 6 hayvan yer aldı. Grup I kontrol grubuydu ve tedavi görmedi. Grup II sham grubuydu ve gavaj yoluyla günde distile su aldı. Grup III (Pb grubu), gavaj yoluyla Pb asetat (Sigma-Aldrich, ABD; CAS Numarası 6080-56-4) 1000 ppm/kg/gün aldı. Grup IV ve V, gavaj yoluyla sırasıyla 500 ve 1000 mg/kg/gün CFHAE aldı. Grup VI ve VII, aynı anda gavaj yoluyla sırasıyla 500 ve 1000 mg/kg/gün dozlarında Pb 1000 ppm/kg/gün ve CFHAE aldı. Hayvanlar, ardışık 35 gün boyunca tedavi gördü. Pb dozu, Soleimanzadeh ve ark. (2018) .

    Plazma örneklemesi

    35 gün sonra hayvanlara, Kanter'e göre %2 ksilazin (10 mg/kg, Alfasan, Woerden, Hollanda) ve %5 ketamin hidroklorür (90 mg/kg, Rotexmedica, Trittau, Almanya) kombinasyonunun intraperitoneal uygulaması kullanılarak anestezi uygulandı ( 2010) yöntemi. Daha sonra hayvanlar boyunları kesilerek sakrifiye edildi, kan örnekleri laboratuvar tüplerine alındı ​​ve 3000 g'de 15 dakika santrifüj edildi. Ayrılan serum örnekleri, biyokimyasal ve hormonal değerlendirmeler için kullanılıncaya kadar -20°C'de mikrotüplerde saklandı (Soleimanzadeh ve ark., 2018 ).

    Epididimal spermlerin toplanması

    Her farenin testislerinin kauda epididiminden sperm örnekleri alındı. Kauda epididimi küçük parçalar halinde kesildi ve 1 ml İnsan Tüp Sıvısı (HTF) ortamı içeren Petri kaplarına 37°C'de 30 dakika süreyle yerleştirildi.

    Sperm hareketliliği

    Sperm hareketliliğinin değerlendirilmesi, insan sperminin incelenmesi için WHO laboratuvar el kitabı protokolüne (2010) göre yapıldı. Kısaca, 10 µl sperm süspansiyonu bir semen analiz odasına yerleştirildi. Her hayvan için en az 200 sperm üzerinde sperm motilitesi açısından en az beş mikroskobik alan değerlendirildi.

    sperm canlılığı

    Eosin-Nigrosine boyaması, WHO protokolüne göre sperm canlılığını değerlendirmek için kullanıldı (Dünya Sağlık Örgütü, 2010 ). Kısaca Eosin (Merck, Darmstadt, Almanya) ve Nigrosine (Merck, Darmstadt, Almanya) distile suda hazırlandı. Bir hacim sperm süspansiyonu, iki hacim %1 eozin ile karıştırıldı. 30 saniye sonra bu karışıma eşit hacimde nigrosin ilave edildi. Daha sonra ince lekeler hazırlandı ve bir ışık mikroskobu (Model CHT, Olympus optik Co. Ltd., Tokyo, Japonya) altında 1000X büyütmede gözlemlendi. Canlı sperm renksiz kalırken, cansız sperm kırmızıya boyandı.

    Teratozoospermi i nDex (TZI)

    TZI veya çoklu anomali indeksi, anormal spermatozoon başına defekt sayısıdır. Her anormal spermatozoonun baş, boyun/orta parça ve kuyruk kusurları veya sitoplazmik kalıntıların varlığı dahil olmak üzere bir ila dört anormalliği olabilir. TZI değerleri Krassas ve ark. tarafından tarif edildiği gibi 1.00 (her anormal spermde sadece bir kusur vardır) ile 3.00 (her anormal spermde bir baş, orta parça ve kuyruk kusuru vardır) arasında okunmuştur. (Krassas ve diğerleri, 2008 ).

    DNA hasarının değerlendirilmesi

    Sperm süspansiyonları 3 kez 5 ml fosfat tamponlu solüsyon (PBS) ile yıkandı ve 3000 rpm'de 5 dakika santrifüjlendi. Sperm solüsyonundan ince yaymalar hazırlandı ve havada kurumaya bırakıldı. Sperm DNA bütünlüğünü test etmek için, yaymalar Akridin-Orange (AO) ile boyandı. AO boyaması, Tejada ve diğerleri tarafından açıklanan bir protokole göre yapıldı. (Tejada ve diğerleri, 1984 ). Kısaca, yaymalar 24 saat boyunca metanol/asetik asit (3:1) içinde 4°C'de sabitlendi ve 10 dakika boyunca AO solüsyonu (fosfat-sitrat tamponunda %0.19, pH 2.5) ile boyandı. Slaytlar 5 dakika distile su ile nazikçe yıkandı ve hava ile kurutuldu. Lekeli lekeler daha sonra 1000X büyütmede bir floresan mikroskobu (Model GS7, Nikon Co., Tokyo, Japonya) altında gözlendi. Sperm başında üç tip boyanma paterni değerlendirildi; yeşil spermatozoa (çift iplikli DNA) ve sarı ve kırmızı spermatozoa (tek iplikli DNA). Spermatozoadaki çift sarmallı DNA yüzdesini değerlendirmek için slayt başına en az 100 spermatozoa sayıldı (Tejada ve diğerleri, 1984 ).

    Toplam antioksidan kapasitesinin (TAC) tahmini

    Serumun TAC'si, ferrik indirgeme antioksidan gücü (FRAP) testi ile tahmin edildi (Benzie ve Strain, 1999 ). Burada, 1 ml taze ferrik indirgeyici antioksidan güç reaktifine (FRAP; Tripiridiltriazin; Merck) 100 ul hücresel süpernatan ilave edildi ve karanlıkta 10 dakika boyunca 37°C'de inkübe edildi. Mavi renkli reaktifin okunması, 10 dakika boyunca her 20 saniyede bir 595 nm'de yapıldı. OIdum sulu bir çözeltisi (FeSO 4 .7H 2 O) ve taze hazırlanmış askorbik asidin uygun konsantrasyonları, boş ve standart çözelti olarak kullanılmıştır, sırasıyla. Sonuçlar, L serum başına µmol TAC olarak ifade edildi.

    İndirgenmiş glutatyon (GSH) tahmini

    Glutatyon (GSH), Beutler ve ark. (1963) . Kısaca 0,9 ml distile su ve 1,5 ml çökeltici reaktif (3,34 gr metafosforik asit, 0,4 gr EDTA ve 60,0 gr sodyum klorür) 0,1 ml numuneye eklenmiştir. Tüpler vortekslendi ve 5 dakika oda sıcaklığında bırakıldı. Çözelti, 4°C'de 4000 rpm'de 15 dakika santrifüjlendi. Daha sonra 4.0 ml fosfat solüsyonu (0.3 M disodyum hidrojen fosfat) ve 0.5 ml 5-50-ditiyobis-(2-nitrobenzoik asit) (DTNB) (%1 sodyum sitrat içinde 80 mg) 1.0 ml süpernatan ile karıştırıldı. Sarı renk kompleksi içeren karışımın absorbansı hemen 412 nm'de spektrofotometrik olarak okunmuştur. GSH için standart bir eğri hazırlandı ve deneysel numunelerdeki GSH konsantrasyonu, standart eğriden tahmin edildi. Sonuçlar U/L serum olarak ifade edildi.

    Ölçümü enzimatik antioksidan ts aktivitesi

    Süperoksit dismutazın (SOD) aktivitesi, Nishikimi et al. (1972) yöntem. H varlığında ısıtıldığı zaman katalaz (CAT) aktivitesi kromik asetat asetik asit içinde dikromat azalma göre belirlenmiştir 2 O 2 Sinha (1972) 'e göre . Glütation peroksidaz aktivitesi (GPx) Paglia ve Valentine (1967) tarafından tarif edilen yönteme göre hesaplanmıştır GPx kümen hidroperoksit tarafından glutation oksidasyonunu katalize gerçeğine dayanmaktadır. Sonuçlar U/L serum olarak sunuldu.

    Lipid peroksidasyon ölçümü

    Serum numunelerindeki lipid peroksidasyon hızı, tiyobarbitürik asit reaktif maddeler (TBARS) testi kullanılarak malondialdehitin (MDA) belirlenmesiyle tahmin edildi (Placer ve diğerleri, 1966 ). Sonuçlar µmol/L olarak sunuldu.

    Hormonal değerlendirmeler

    Testosteronun serum konsantrasyonu, üretici kitinin (Demeditec Diagnostics GmbH, Almanya) talimatlarında tarif edildiği gibi enzime bağlı immünosorbent tahlili (ELISA) ile ölçüldü. Sonuçlar µmol/L serum olarak sunuldu.

    LH ve FSH serum seviyeleri, Loraine ve Bell, 1971 yöntemlerine göre spesifik ticari kitler (Amersham, Buckinghamshire, UK) kullanılarak ELISA ile belirlendi. Sonuçlar mIU/ml serum olarak sunuldu.

    Histopatolojik değerlendirmeler

    Hayvanların sağ testisleri %10 formalin solüsyonunda tespit edildi. Daha sonra numuneler dereceli bir dizi etanol ile dehidre edildi ve parafine gömüldü. İnce kesitler mikrotom ile 7 µm kalınlığında kesildi. Daha sonra hazırlanan kesitler, Suvarna ve ark. (2018) . Boyanan kesitler bir ışık mikroskobu (Olympus Model BH-2, Tokyo, Japonya) kullanılarak histopatolojik değişiklikler açısından değerlendirildi.

    RNA ekstraksiyonu

    Cinna Pure-RNA kiti (CinnaGen, Cat. No. PR891620, Iran) kullanılarak farelerin sol testislerinin toplam RNA'sı çıkarıldı. Toplam RNA'nın konsantrasyonunu ve saflığını belirlemek için ND-2000 spektrofotometresi (Nanodrop Technologies, Thermo Fisher Scientific, ABD) kullanıldı ve ardından toplam RNA, cDNA sentezine kadar -70°C'de saklandı.

    cDNA sentezi

    Rastgele heksamer primerleri (Primer+dNTP Mix+Nükleaz içermeyen su) kullanılarak, 10 µg toplam RNA ve cDNA Sentez Karışımından (M-MLV Ters Transkriptaz+10X Tampon M-MuLV+Nükleazsız Su) birinci sarmal cDNA sentezlendi ( Vivantis Technologies, Kat. No. RTPL12 100 uygulaması, Malezya) 42°C'de 60 dakika inkübe edildi ve reaksiyon, 85°C'de 5 dakika inkübe edildikten sonra 4°C'de soğutularak sonlandırıldı. Sentezlenen cDNA, işlenene kadar -20°C'de saklandı. Primer özgüllüğünü doğrulamak için PCR ürünleri ile elektroforez yapıldı (Şekil 1).
    Resim, çizim vb. içeren harici bir dosya. Nesne adı AJP-10-035-g001.jpg'dir.
    Şekil 1
    Primer özgüllüğü ve cDNA sentez ürünleri. A) Nrf2 (263 bp), B) ve iNOS (170 bp) gen primeri; Şerit M: 100 bp DNA merdiveni, Şerit 1, Kontrol grubu; Şerit 2, Pb grubu; Şerit 3, Sham grubu; Şerit 4, CFHAE 500 grubu; Şerit 5, CFHAE 1000 grubu; Şerit 6, Pb+CFHAE 500 grubu; Şerit 7, Pb+CFHAE 1000 grubu

    Kantitatif r eal- t ime PCR analizi

    SinaSyber Blue HF- qPCR Mix'in (CinnaGen, Kat. No. MM2171, İran) StepOne™ gerçek zamanlı PCR sisteminde (Applied Biosystems, ABD) kullanılması, kantitatif gerçek zamanlı polimeraz zincir reaksiyonu (qRT-PCR), mRNA ifadesi Nrf2 , iNOS ve 18SrRNA seviyeleri ölçüldü. Bu çalışmada kullanılan primer çiftlerinin özellikleri aşağıda sunulmuştur.tablo 1. Reaksiyonlar, 12.5 µl SinaSyber Blue HF- qPCR Mix (CinnaGen, Kat. No. MM2171, İran), her primerden 0.25 µl (2 µM), 2 µl cDNA, 95°C'de 95°C'de 9.5 µl nükleaz içermeyen su içermiştir. 10 s, ardından 10 s için 95°C ve 30 s için 60°C'lik 40 döngü. tablo 1

    Bu çalışmada kullanılan primer çiftlerinin özellikleri
    iNOS F: 5′ CACCTTGGAGTTCACCCAGT 3′
    R: 5′ ACCACTCGTACTTGGGATGC 3′
    NM_010927 170 bp
    Nrf2 F: 5′ CACCTTGGAGTTCACCCAGT 3′
    R: 5′ ACCACTCGTACTTGGGATGC 3′
    NM172086 263 puan
    18SrRNA F: 5΄GCAATTATCCCCATGAACG 3′
    R: 5′ GGCCTCACTAAACCATCCAA 3′
    NR_003278 123 bp
    iNOS: İndüklenebilir Nitrik Oksit Sentaz; Nrf2: nükleer faktör eritroid 2 ile ilgili faktör 2

    PCR verimliliklerini saptamak için cDNA reaksiyon karışımından standart bir eğri kullanıldı. PCR'nin verimliliği yüzde 90 ila 110 arasındaydı. Tüm eğriler için R2 miktarları 0,997 ila 0,999 arasında gözlendi. CT miktarları ve hedef genin nispi ekspresyon seviyesinin 2-CT olarak ifadesi, PCR ürününün nicelleştirilmesi için kullanıldı. Ardından, CT, hedef genin CT'sinden temizlik geninin ( 18SrRNA ) CT'sinin çıkarılmasından sonra ΔCT ölçüldü .

    istatistiksel analiz

    İstatistiksel analiz SPSS sürüm 21 (IBM Co., Chicago, ABD) kullanılarak yapıldı. Veriler tek yönlü ANOVA ile analiz edildi ve post hoc olarak Tukey testi kullanıldı . 0.05'ten küçük bir p değeri anlamlı kabul edildi.

    Git: Sonuçlar

    fitokimyasal analiz

    RP-HPLC yöntemini kullanan fitokimyasal araştırma, CFHAE'de gösterildiği gibi çeşitli fenolik ve flavonoid bileşikleri ortaya çıkardı. Tablo 2. Bileşikler arasında gallik asit, kafeik asit, klorojenik asit, rutin, kumarik asit kuersetin, sinnamik asit ve apigenin bulunur. Tablo 2

    HPLC analizi ile belirlenen CFHAE'deki toplam fenolik ve flavonoid bileşik miktarları
    gallik asit 408,37
    kafeik asit 100.58
    Klorojenik asit 123.58
    Rutin 89.25
    kumarik asit 121.81
    kuersetin 88.68
    sinnamik asit 20.80
    Apigenin 62.38
    s perm parametreleri üzerindeki etkiler

    Özetlenen veriler Tablo 3 Pb'ye maruz kalmanın (tüm vakalar için p<0.01), kontrol grubuna kıyasla sperm parametrelerini önemli ölçüde azalttığını, ancak CFHAE ve Pb'nin birlikte uygulanmasının (p<0.05 ila p<0.01) Pb grubu ile karşılaştırıldığında bu parametreleri önemli ölçüde geliştirdiğini göstermektedir (Şekil 2-​-4).4).
    Resim, illüstrasyon vb. içeren harici bir dosya. Nesne adı AJP-10-035-g002.jpg
    şekil 2
    Gruplar halinde sperm canlılığı; A) Canlı sperm (renksiz), B) Ölü sperm (kırmızı); (eozin/nigrosin, 1000X)

    Resim, çizim vb. içeren harici bir dosya. Nesne adı AJP-10-035-g004.jpg
    Şekil 4
    gruplarda DNA hasarı; A) Normal sperm (yeşil), B) Hasarlı DNA (sarı); (AO, 400X) Tablo 3

    Farklı gruplarda sperm parametrelerinin karşılaştırılması
    20,42±1,02 ## 19.17±1.44 ## 27.15±1.09 28,13±1,63 11,77±0,81 ** 26,35±1,20 27,11±1,36 Sperm sayısı (10 6 )
    75,94±1,49 ## 70,03±1,27 ## 83,71±1,50 82,28±0,77 57,84±1,16 ** 81,10±1,82 81,08±0,95 Sperm canlılığı (%)
    60,71±1,05 ## 63.50±1.38 ## 78,65±0,61 80,34±0,90 * 51,49±0,78 ** 75,28±1,21 76.24±1.33 Sperm hareketliliği (%)
    85,97±1,22 ## 86,34±0,68 ## 91,20±1,01 89,47±1,40 76,48±1,29 ** 88,23±0,58 90,37±1,71 Sperm morfolojisi (%)
    9,14±1,23 ## 13,59±0,96 # 3,04±1,15 3,08±0,71 18,79±0,48 ** 3,24±0,41 3,08±0,61 DNA hasarı (%)
    1,35±0,35 ## 1.60±0.41 # 1,13±0,74 1,11±0,30 1,89±0,59 ** 1,14±0,37 1,12±0,32 TZI (%)
    TZI: Teratozoospermi indeksi. Değerler ortalama±SEM'i temsil eder. *p<0.05, **p<0.01 ve kontrol; #p<0.05, ##p<0.01 ve Pb.

    Serumda TAC, GSH içeriği ve antioksidan enzim aktivitesi üzerine etkileri

    Pb'ye maruz kalma (tüm vakalar için p<0.01) serumda TAC, GSH içeriği ve enzimatik antioksidanların (SOD, CAT ve GPx) aktivitelerini kontrol ve sham gruplarına kıyasla önemli ölçüde azaltırken, CFHAE ve Pb'nin birlikte uygulanması önemli ölçüde (p< 0.05 ila p<0.01) ve doza bağlı olarak Pb grubu ile karşılaştırıldığında onları arttırdı (Tablo 4). Tablo 4

    Farklı gruplarda ortalama antioksidan aktivite ve lipid peroksidasyon miktarları
    TAC (μmol/L) 3,21±0,81 3,18±0,70 0,41±0,29 ** 3,32±0,43 3,45±0,38 * 0,97±0,41 ## 1,61±0,37 ##
    GSH (U/L) 81,19±1,48 80,37±0,56 44,25±1,17 ** 81,08±1,79 81,75±1,22 54,69±0,44 ## 62,95±1,62 ##
    SOD (U/L) 1637±1.39 1620±1,81 1124±1.72 * * 1652±1,05 1681±1.19 1318±1.30 ## 1394±0.93 ##
    KEDİ (U/L) 1,29±0,39 1,28±0,33 0,64±0,41 ** 1,30±0,61 1,37±0,56 0,85±0,42 # 1,04±0,33 ##
    GPx (U/L) 7,45±1,12 7,41±1,75 2,37±1,02 ** 7,42±1,34 7,63±1,60 4,85±0,37 ## 5,30±0,51 ##
    TAC: Toplam antioksidan kapasitesi, GSH: Glutatyon SOD: Süperoksit dismutaz, CAT: Katalaz, GPx: Glutatyon peroksidaz. Değerler ortalama±SEM'i temsil eder. *p<0.05, **p<0.01 ve kontrol; #p<0.05, ##p<0.01 ve Pb.

    Resim, illüstrasyon vb. içeren harici bir dosya. Nesne adı AJP-10-035-g003.jpg
    Figür 3
    Gruplar halinde morfolojik olarak normal ve anormal spermler; normal (siyah oklar) ve anormal (beyaz oklar); (eozin/nigrosin, 1000X)

    Serum lipid peroksidasyonu üzerindeki etkiler

    Sadece Pb ile tedavi edilen hayvanlar, kontrol grubuna kıyasla serum MDA seviyesinde önemli (p<0.01) bir azalmaya sahipti. Ancak, CFHAE ve Pb'nin birlikte uygulanması, MDA düzeylerini önemli ölçüde (p<0.05) artırdı (Şekil 5).
    Resim, çizim vb. içeren harici bir dosya. Nesne adı AJP-10-035-g005.jpg
    Şekil 5
    Farklı gruplarda serum ortalama seviyeleri MDA. Değerler ortalama±SEM'i temsil eder. **p<0.01 ve kontrol; # p<0.05 ve Pb

    Seks hormonları üzerindeki etkiler

    Hormonal değerlendirmeler, kontrol ve sham gruplarına kıyasla Pb grubunda seks hormonlarının konsantrasyonlarında anlamlı bir azalma (tüm vakalar için p<0.01) gösterirken, CFHAE'nin Pb ile birlikte uygulanması, Pb grubuna kıyasla seks hormonu düzeylerini önemli ölçüde artırdı (p<0.05). p<0.01'e kadar) (Tablo 5). Tablo 5

    Serum, farklı gruplardaki cinsel hormonların ortalama konsantrasyonları
    FSH (mIU/ml) 4,40±0,18 4,38±0,18 1,52±0,18 ** 4,49±0,18 4,45±0,18 2,95±0,18 ## 3,12±0,18 ##
    LH (mIU/ml) 3.20±0.66 3,21±0,66 1.64±0.66 ** 3,29±0,66 3,41±0,66 2.35±0.66 # 2,70±0,66 ##
    Testosteron (μmol/L) 6,07±1,49 5,89±1,49 3,19±1,49 ** 6,11±1,49 6,28±1,49 4,79±1,49 ## 5,10±1,49 ##
    Değerler ortalama±SEM'i temsil eder. **p<0.01 ve kontrol; #p<0.05, ##p<0.01 ve Pb.

    histopatolojik bulgular

    Kontrol grubunda ise seminifer tübüller, interstisyum, Leydig hücreleri ve stromal elemanlar normal yapılara sahiptir. Çok katmanlı epitel ile döşeli seminifer tübüller, Sertoli hücreleri, spermatogonia (tip A ve B), primer spermatositler, sekonder spermatositler, spermatitler ve spermatozoa içerir.Şekil 6A). Sham grubu kontrol grubuna benzerdi ve normal bir yapıya sahipti (Şekil 6B). Pb grubunda seminifer tübüller ince, genişlemiş lümen ve spesifik dejeneratif değişikliklerle birlikteydi. Bazal membran düzensiz ve bozuktu. Leydig hücreleri interstisyel dokuda azalmıştır. Spermatogonium, spermatosit ve spermatidleri içeren spermatojenik hücreler azalmış, kalan hücrelerde piknotik çekirdekler mevcuttu ve Sertoli hücreleri gözlenmedi. Lümende spermatogenezin baskılandığını gösteren spermatozoa yoktu. Lümende pul pul dökülmüş hücreler belirgindi (Şekil 6C). CFHAE 500 ve 1000 mg/kg ile tedavi edilen gruplarda, normal farklı tipte germ hücreli seminifer tübüller görüldü (Şekiller 6D ve E). Pb ve CFHAE 500 mg/kg/gün ile tedavi edilen grupta, CFHAE ile tedaviden sonra Pb'nin neden olduğu dejeneratif değişiklikler azaldı. Ayrıca seminifer tübüllerde spermatogonia hücrelerinin artışı da aşikardır.Şekil 6F). Pb ve CFHAE 1000 mg/kg ile tedavi edilen grupta tüm tübüllerdeki germinal hücreler arttı. Bazal membran yapısı normalleştirildi ve lümendeki spermatozoada belirgin artışlar görülebilir (Şekil 6G).
    Resim, çizim vb. içeren harici bir dosya. Nesne adı AJP-10-035-g006.jpg
    Şekil 6
    Testiste Pb toksisitesine karşı CFHAE'nin birlikte uygulanmasının koruyucu etkilerini sergileyen testis dokusunun hafif mikrografları. (A): Kontrol, (B): Sham. (C): Pb, (D): CFHAE 500, (E): CFHAE 1000, (F): Pb+CFHAE 500 ve (G): Pb+CFHAE 1000. H&E boyama (×400)

    Testiste Nrf2 ve iNOS genlerinin ekspresyonuna etkileri

    sonuçlar Şekil 7Pb'nin kontrol grubu ile karşılaştırıldığında Nrf2 ekspresyonunu önemli ölçüde (p<0.01) arttırdığını göstermektedir . Ayrıca, CFHAE'nin Pb ile birlikte uygulanması (CHFAE 500 mg/kg'da p<0.05 ve CHFAE 1000 mg/kg'da p<0.01) ifadesini Pb grubu ile karşılaştırıldığında azalttı.
    Resim, çizim vb. içeren harici bir dosya. Nesne adı AJP-10-035-g007.jpg
    Şekil 7
    Normalize edilen Nrf2'nin dansitometri analizleri, 18srRNA'nın ifade düzeyine göre yapılmıştır. **p<0.01 ve kontrol; #p<0.05, ##p<0.01 ve Pb

    Veri girişi Şekil 8Pb grubunun , kontrol ve sham gruplarıyla karşılaştırıldığında iNOS ekspresyonunda önemli (p<0.01) bir artış sergilediğini göstermektedir . Ancak, CFHAE'nin Pb ile birlikte uygulanması (CHFAE 500 mg/kg'da p<0.05 ve CHFAE 1000 mg/kg'da p<0.01) , Pb grubuna kıyasla iNOS ekspresyonunu azalttı .
    Resim, illüstrasyon vb. içeren harici bir dosya. Nesne adı AJP-10-035-g008.jpg
    Şekil 8
    18srRNA'nın ekspresyon seviyesine göre normalize edilen iNOS'un dansitometri analizleri. **p<0.01 ve kontrol; #p<0.05, ##p<0.01 ve Pb

    Git: Tartışma

    Bu çalışmada, bulgularımız, CFHAE uygulamasının sperm parametrelerini iyileştirdiğini, seks hormonlarını yükselttiğini, serumun TAC, GSH içeriğini ve antioksidan enzim aktivitesini yükselttiğini, serum MDA düzeylerini düşürdüğünü, Nrf2 ve iNOS genlerinin testiküler ekspresyonunu aşağı regüle ettiğini ve ayrıca iyileştirdiğini göstermiştir. Pb'nin neden olduğu testis dokusunda histopatolojik değişiklikler.

    Daha önceki çalışmalara benzer şekilde (Dorostghoal ve diğerleri, 2014 ; Mabrouk ve Ben Cheikh, 2014 ; Reshma Anjum ve diğerleri, 2017 , 2011), sonuçlarımız Pb'nin sperm parametrelerini azalttığını gösterdi. Bu bulgular, Pb'nin kan-testis bariyerini geçebilmesi (Creasy, 2001 ), oksidatif stresi indüklemesi ve lipid peroksidasyonuna ve DNA hasarlarına neden olması (Zhang ve ark., 2014) sonucu spermatogenezde bozulmaya neden olabilir. Testis dokusu, hücre zarında yüksek oranda çoklu doymamış lipid içeriğine sahip olduğundan, oksidatif strese karşı hassastır (Mishra ve Acharya, 2004 ▶).). Lipid peroksidasyon ürünleri, spermlerin zar fonksiyonunu ve hareketliliğini olumsuz yönde etkiler ve bu da doğurganlık potansiyellerinin azalmasına yol açar (Choudhary ve diğerleri, 2010 ).

    Pb uygulaması serum TAC, GSH içeriği ve antioksidan enzimlerin aktivitesini azalttı. Pb'nin antioksidan enzimlerin aktivitesini değiştirdiği mekanizma, antioksidan enzimlerdeki fonksiyonel SH gruplarının doğrudan inhibisyonu ve/veya bu enzimlerin Cu, Zn ve Mn gibi metal kofaktörlerine bağlanması aracılık eder (Patra ve diğerleri, 2011 ). Ayrıca Pb grubunda MDA düzeyi yükseldi. Bu sonuçlar önceki raporlarla uyumludur (Dkhil ve diğerleri, 2016 ; Dorostghoal ve diğerleri, 2014 ; Patra ve diğerleri, 2011 ; Reshma Anjum ve diğerleri, 2017 ).

    Pb'nin LH ve FSH üzerindeki etkileri çelişkilidir. Bazı araştırmalar, mevcut araştırma ile uyumlu olarak, Pb'ye maruz kalmanın ardından bu hormonlarda bir azalma bildirdiğinden (Ayinde ve diğerleri, 2012 ; Dorostghoal ve diğerleri, 2014 ), diğer çalışmalarda bu hormonlarda artışlar rapor edilmiştir (Anjum ve Reddy, 2015 ). Çeşitli raporlardaki fark, Pb konsantrasyonu, maruz kalma aralığı ve testis ve üreme ekseninin fizyolojik durumu gibi faktörlere atfedilir (Gandhi ve ark., 2017 ).

    Mevcut araştırmadaki serum testosteron konsantrasyonundaki azalma, önceki çalışmalarla uyumludur (Anjum ve Reddy, 2015 ; Dkhil ve diğerleri, 2016 ; Mabrouk ve Ben Cheikh, 2014 ; Reshma Anjum ve diğerleri, 2017 ). Muhtemelen, Pb maruziyeti hipotalamik-hipofiz-gonadal ekseni olumsuz etkilemiştir (Gandhi ve ark., 2017 ). Araştırmacılar, Pb'ye maruz kalmanın hipofiz bezinin gonadotropik hücrelerini dejenere ettiğini ortaya çıkardı (Hamadouche ve diğerleri, 2013 ). Ayrıca, Pb, Leydig hücrelerinde dışsal apoptoz sinyal yolunu indükler (He ve diğerleri, 2017 ). Oksidatif hasarlar, Leydig hücrelerini testosteron sentezini etkileyebilecek LH'ye daha az duyarlı hale getirir (Glade ve Smith, 2015 ). Pb, Leydig hücrelerinde steroidojenik enzimlerin aktivitesini baskılar. Dolayısıyla, testosteron azalmasının bir başka nedeni de androjen sentezinin Pb tarafından inhibisyonu olabilir (Huang ve Liu, 2004 ; Liu ve diğerleri, 2001 ).

    Testis dokusunda Pb ile indüklenen iNOS geni ekspresyonuna maruz kalma . iNOS, L-argininden nitrik oksit (NO) sentezini katalize etti (Aktan, 2004 ). NO, membran lipid peroksidasyonuna neden olabilen güçlü bir ROS olan peroksinitrit anyonu (ONOO ) oluşumunda süperoksit anyonu ile birleşir (Moneim, 2015 ). Dkhil et al. (2016) Pb maruziyetinin sıçanlarda NO oluşumunu artırdığını bildirmiştir, bu da bizim sonuçlarımızla uyumludur.

    Nrf2, antioksidan tepkinin birincil düzenleyicisidir ve oksidatif strese karşı korunmaya katılır (Lindl ve Jordan-Sciutto, 2008 ). Nrf2, çekirdekte faz II antioksidan enzimlerin ekspresyonunu indükler (Jung ve Kwak, 2010 ). Kusurlu Nrf2 sinyalinin spermatogenez kusurlarına neden olduğu bulunmuştur (Yu ve diğerleri, 2012 ). Ağır metallere maruz kalma, Nrf2 yolunun aktivasyonu ile sonuçlanır (Simmons ve diğerleri, 2011 ). Çalışmamız Pb up'ın Nrf2 gen ekspresyonunu düzenlediğini gösterdi . Wang et al. (2012) Pb'ye maruz kalmanın, bizim sonuçlarımızla uyumlu olarak, testisteki Nrf2 ifadesini yukarı düzenlediğini gösterdi.

    Yazarların bildiği kadarıyla, bu araştırma, CFHAE'nin Pb kaynaklı üreme toksisitesine karşı iyileştirici etkileri üzerine ilk çalışmadır. Mevcut araştırma, CFHAE'nin birlikte uygulanmasının, Pb ile tedavi edilen hayvanlarda sperm parametrelerini iyileştirdiğini göstermiştir. Bulgularımıza benzer şekilde, önceki çalışmalar keçiboynuzu sulu ekstraktının deney hayvanlarında sperm parametreleri üzerinde faydalı etkileri olduğunu göstermiştir (Ata ve ark., 2018 ; Vafaei ve ark., 2018 ). Bu etkiler, keçiboynuzu meyvesinin antioksidan özelliklerinden kaynaklanıyor olabilir. CFHAE, serumun antioksidan aktivitesini arttırdı ve bu, Rtibi ve ark. (Pedersen, 2001 ). Ayrıca birçok çalışma, keçiboynuzu uygulamasının farklı organlarda antioksidan enzimleri artırdığını göstermiştir (Abdel-Rahman ve ark., 2018). ; Rtibi ve diğerleri, 2016a , 2016b , 2015; Suzek ve diğerleri, 2017 ).

    CFHAE'nin antioksidan yeteneği, yüksek fenolik ve flavonoid içerikleri ile ilişkili olabilir. Bu çalışmada yapılan fitokimyasal tarama, CFHAE'nin antioksidan aktiviteye sahip gallik asit, kafeik asit, klorojenik asit, rutin, kumarik asit kersetin, sinnamik asit ve apigenin içerdiğini göstermiştir.

    Ayrıca keçiboynuzu meyvesi antioksidan enzimlerin kofaktörü olan Fe, Cu, Mn ve Zn gibi (Özcan vd., 2007 ; Oziyci vd., 2014 ) eser elementler içerir (Harris, 1992 ). Pb maruziyetinde sistem. Serumdaki MDA seviyeleri Pb + CFHAE gruplarında Pb grubuna göre azalmıştır, bu da CFHAE uygulamasının lipid peroksidasyonunu azalttığını göstermektedir. CFHAE'nin antioksidan bileşikleri tarafından serbest radikallerin nötralizasyonu nedeniyle hücre hasarlarının azalmasının bir sonucu olabilir. Bu araştırmaya benzer şekilde, birkaç çalışma, keçiboynuzu sulu ekstraktının uygulanmasının MDA seviyelerini azalttığını göstermiştir (Rtibi ve diğerleri, 2016a ; Vafaei ve diğerleri, 2018 ).

    Gerçek zamanlı PCR'den elde edilen veriler, Nrf2 ekspresyonunun Pb + CFHAE gruplarında aşağı regüle edildiğini ortaya koydu, bu da CFHAE'nin birlikte uygulanmasının Pb'ye maruz kalan hayvanlarda oksidatif stresi azalttığını gösterdi. Bu, CFHAE'nin Nrf2 ekspresyonunu azalttığını gösteren ilk çalışmadır . Ayrıca, CFHAE'nin şimdiye kadar bildirilmeyen ve CFHAE'nin NO üretimini azalttığını gösteren Pb aşağı regüleli iNOS ile birlikte uygulanması . Mevcut sonuçlar doğrultusunda Al-Olayan ve ark. (2016) deneysel olarak Schistosoma mansoni ile enfekte olmuş farelerin karaciğerindeki keçiboynuzu kabuğu ekstresinin NO seviyesini azalttığını gösterdi . Abdel-Rahman et al. (2018) su borusu dumanına maruz kalan sıçanların keçiboynuzu sulu özü ile tedavisinin, akciğer dokusunda NO seviyelerini azalttığını gösterdi.

    Diğer araştırmacılar, bizim bulgularımıza benzer şekilde keçiboynuzu kabuklarının oksidatif strese karşı koruyucu potansiyeli olduğunu bildirmiştir (Abdel-Rahman ve diğerleri, 2018 ; Rtibi ve diğerleri., 2016a , 2016b , 2015; Suzek ve diğerleri, 2017 ; Vafaei et al., 2018 ).

    CFHAE'nin birlikte uygulanması, aynı anda Pb'ye maruz kalan gruplarda seks hormonlarını yükseltti. LH ve FSH düzeylerindeki artışlar, Pb antioksidan enzimleri zayıflattığı ve bu hücrelerde dejeneratif değişikliklere neden olduğu için CFHAE'nin hipofiz bezinin endokrin hücreleri üzerindeki koruyucu etkilerinden kaynaklanabilir (Hamadouche ve ark., 2013 ). Sonuçlarımızla uyumlu olarak, önceki araştırmalar keçiboynuzu özü uygulamasının serum LH ve testosteron konsantrasyonlarını arttırdığını ortaya koymuştur (Mokhtari ve diğerleri, 2012 ; Vafaei ve diğerleri, 2018 ). Oksidatif stres, antioksidan aktiviteyi azaltır ve Leydig hücrelerinde lipid peroksidasyonunu arttırır, bu da testosteron sentezinin bozulmasına neden olur (Glade ve Smith, 2015 ). Ayrıca, CFHAE'nin Leydig hücrelerinde Pb'nin neden olduğu oksidatif stresi azalttığı için Pb + CFHAE gruplarında testosteron seviyelerinde artış meydana geldi.

    Bu çalışma, CFHAE'nin oksidatif stres gelişimini azaltarak üreme sistemindeki Pb toksisitesini azalttığını göstermiştir. Bu nedenle, infertil erkek hastaların ve Pb gibi ağır metallere ve oksidatif stresi indükleyen diğer ajanlara mesleki ve çevresel maruz kalma şansı olan kişilerin diyetinde bir antioksidan ajan olarak kullanılabilir.

    Git: teşekkür

    Yazarlar, bu çalışmayı finanse ettikleri için Veteriner Fakültesi'ne ve Urmiye Üniversitesi Araştırma Konseyi'ne teşekkürlerini sunarlar.

    Git: Çıkar çatışması

    Yazarlar herhangi bir çıkar çatışması olmadığını beyan eder.

    Git: Referanslar

    • Abdel-Rahman M, Bauomy AA, Salem FEH, Ahmed Khalifa M. Keçiboynuzu özü, nargile dumanına maruz kalan sıçanlarda beyin ve akciğer hasarını hafifletir. Mısır J Temel Uygulama Sci. 2018; 5 :31-40. [ Google Akademik ]
    • Aktan F. iNOS aracılı nitrik oksit üretimi ve düzenlenmesi. Hayat Bilimi. 2004; 75 :639-653. [ PubMed ] [ Google Akademik ]
    • Al-Olayan EM, El-Khadragy MF, Alajmi RA, Othman MS, Bauomy AA, İbrahim SR, Moneim AE. Ceratonia siliqua pod özü, Schistosoma mansoni kaynaklı karaciğer fibrozisini ve oksidatif stresi iyileştirir. BMC Tamamlayıcı Alter Med. 2016; 16 sayfalama yok. [ PMC ücretsiz makale ] [ PubMed ] [ Google Akademik ]
    • Anjum MR, Reddy PS. Erkek sıçanlarda kurşun kaynaklı baskılanmış üremenin testosteron tarafından kurtarılması. androloji. 2015; 47 :560–567. [ PubMed ] [ Google Akademik ]
    • Ata A, Yıldız-Gülay Ö, Güngör S, Baliç A, Gülay MS. Keçiboynuzu (Ceratonia siliqua) fasulyesi ekstresinin Erkek Yeni Zelanda beyaz tavşan sperması üzerindeki etkisi. Dünya Tavşan Bilimi. 2018; 26 :209–215. [ Google Akademik ]
    • Ayinde OC, Ogunnowo S, Ögedegbe RA. Kurşuna maruz kalan albino sıçanlarda C vitamini ve E vitamininin testis çinko içeriği ve testis toksisitesi üzerindeki etkisi. BMC Pharmacol Toksikol. 2012; 13 :1–8. [ PMC ücretsiz makale ] [ PubMed ] [ Google Akademik ]
    • Bae DS, Gennings C, Carter Jr WH, Yang RSH, Campain JA. İnsan keratinositlerinde arsenik, kadmiyum, krom ve kurşun arasındaki toksikolojik etkileşimler. Toksikol Bilimi. 2001; 63 :132–142. [ PubMed ] [ Google Akademik ]
    • Benzie I, Strain J. Biyolojik sıvıların toplam antioksidan aktivitesinin doğrudan ölçümü ve toplam antioksidan gücün ve askorbikin eşzamanlı ölçümü için değiştirilmiş versiyon. Yöntemler Enzimol. 1999; 299 :15-27. [ PubMed ] [ Google Akademik ]
    • Beutler E, Duron O, Kelly BM. Kan glutatyonunun belirlenmesi için geliştirilmiş yöntem. J Lab Clin Med. 1963; 61 :882-888. [ PubMed ] [ Google Akademik ]
    • Choudhary R, ​​Chawala VK, Soni ND, Kumar J, Vyas RK. Erkek kısırlığında oksidatif stres ve antioksidanların rolü. Pakistan J Physiol. 2010; 6 :54-59. [ Google Akademik ]
    • Chowdhury AR. Ağır metallerdeki son gelişmeler, erkek üreme fonksiyonu üzerinde etki yarattı-Bir retrospektif. Al Ameen J Med Sci. 2009; 2 :37-42. [ Google Akademik ]
    • Creasy DM. Erkek Üreme Toksisitesinin Patogenezi. Toksikol Patol. 2001; 29 :64-76. [ PubMed ] [ Google Akademik ]
    • Custódio L, Fernandes E, Escapa AL, López-Avilés S, Fajardo A, Aligué R, Alberício F, Romano A. Antioksidan aktivite ve keçiboynuzu ağacından (Ceratonia siliqua) yaprak ekstreleri ile tümör hücresi büyümesinin in vitro inhibisyonu Pharm Biol. 2009; 47 :721–728. [ Google Akademik ]
    • Dakia PA, Wathelet B, Paquot M. Keçiboynuzu (Ceratonia siliqua L) tohum tohumunun izolasyonu ve kimyasal değerlendirmesi. Gıda Kimyası 2007; 102 :1368-1374. [ Google Akademik ]
    • Dewanto V, Wu X, Adom KK, Liu RH. Isıl işlem, toplam antioksidan aktiviteyi artırarak domateslerin besin değerini artırır. Isıl işlem, toplam antioksidan aktiviteyi artırarak domateslerin besin değerini artırır. J Tarım Gıda Kimya. 2002; 50 :3010–3014. [ PubMed ] [ Google Akademik ]
    • Dkhil MA, Moneim AEA, Al-Quraishy S. Indigofera oblongifolia, bir sıçan modelinde kurşun asetatın neden olduğu testis oksidatif hasarını ve apoptozu iyileştirir. Biol İz Elem Arş. 2016; 173 :354-361. [ PubMed ] [ Google Akademik ]
    • Dorostghoal M, Seyyednejad SM, Jabari A. Fumaria parviflora L'nin erkek sıçanlarda kurşun kaynaklı testis toksisitesi üzerindeki koruyucu etkileri. androloji. 2014; 46 :437–446. [ PubMed ] [ Google Akademik ]
    • Elgawish RAR Abdelrazek HMA. Albino sıçanlarda tarçının koruyucu etkisine göre kurşun asetatın testis fonksiyonu ve kaspaz-3 ekspresyonu üzerindeki etkileri. Toksikol Raporları. 2014; 1 :795-801. [ PMC ücretsiz makale ] [ PubMed ] [ Google Akademik ]
    • El-Nekeety AA, El-Kady AA, Soliman MS, Hassan NS, Abdel-Wahhab MA. Aquilegia vulgaris'in (L) sıçanlarda kurşun asetatın neden olduğu oksidatif strese karşı koruyucu etkisi. Gıda Kimyasal Toksikol. 2009; 47 :2209-2215. [ PubMed ] [ Google Akademik ]
    • Gandhi J, Hernandez RJ, Chen A, Smith NL, Sheynkin YR, Joshi G, Khan SA. Bozulmuş hipotalamik-hipofiz-testis ekseni aktivitesi, spermatogenez ve sperm fonksiyonu, kurşun zehirlenmesi olan erkeklerde kısırlığa neden olur. Zigot. 2017; 25 :103–110. [ PubMed ] [ Google Akademik ]
    • Glade MJ, Smith K. Oksidatif stres, beslenme antioksidanları ve erkeklerde testosteron salgılanması. Ann Nutr Bozukluğu Ther. 2015; 2 :1019. [ Google Akademik ]
    • Hamadouche NA, Nesrine S, Abdelkeder A. Kurşun toksisitesi ve hipotalamik-hipofiz-testis ekseni. Sci Biol değil. 2013; 5 :1–6. [ Google Akademik ]
    • Hammond PB. İnsanların kurşuna maruz kalması. Annu Rev Pharmacol Toksikol. 1977; 17 :197–214. [ PubMed ] [ Google Akademik ]
    • Harris ED. Antioksidan enzimlerin düzenlenmesi. FASEB J. 1992; 6 :2675–2683. [ PubMed ] [ Google Akademik ]
    • He X, Wu J, Yuan L, Lin F, Yi J, Li J, Yuan H, Shi J, Yuan T, Zhang S, Fan Y. Kurşun, Fas/FasL ölüm reseptörü yolu yoluyla fare TM3 Leydig hücrelerinde apoptozu indükler. Çevre Toksikol İlaç. 2017; 56 :99–105. [ PubMed ] [ Google Akademik ]
    • He Y, Zou Q, Chen H, Weng S, Luo T. Kurşun, hücre içi kalsiyum, cAMP ve tirozin fosforilasyon seviyelerini azaltarak insan sperm fonksiyonlarını engeller. Tohoku J Exp Med. 2016; 238 :295–303. [ PubMed ] [ Google Akademik ]
    • Huang BM, Liu MY. MA-10 fare Leydig tümör hücrelerinde kurşunun steroidogenez üzerindeki inhibe edici etkileri. Syst Biol Reprod Med. 2004; 50 :5–9. [ PubMed ] [ Google Akademik ]
    • Jung KA, Kwak MK. Dolaylı antioksidanların gelişimi için potansiyel bir hedef olarak Nrf2 sistemi. Moleküller. 2010; 15 :7266–7291. [ PMC ücretsiz makale ] [ PubMed ] [ Google Akademik ]
    • Kanter M. Sıçanlarda melatoninin testis torsiyonu/detorsiyona bağlı iskemi-reperfüzyon hasarı üzerindeki koruyucu etkileri. Exp Mol Pathol. 2010; 89 :314–320. [ PubMed ] [ Google Akademik ]
    • Krassas E, Papadopoulou F, Tziomalos K, Zeginiadou T, Pontikides N. Hipotiroidizmin insan spermatogenezi üzerinde olumsuz bir etkisi vardır: ileriye dönük, kontrollü bir çalışma. Tiroid. 2008; 18 :1255. [ PubMed ] [ Google Akademik ]
    • Kumazawa S, Taniguchi M, Suzuki Y, Shimura M, Kwon MS, Nakayama T. Keçiboynuzu baklalarında polifenollerin antioksidan aktivitesi. J Tarım Gıda Kimya. 2002; 50 :373–377. [ PubMed ] [ Google Akademik ]
    • Lindl KA, Jordan-Sciutto KL. Dokudaki Nrf2'nin immünofloresan analizi yoluyla endojen antioksidan tepkisinin incelenmesi. Yöntemler Mol Biol. 2008; 477 :229–243. [ PMC ücretsiz makale ] [ PubMed ] [ Google Akademik ]
    • Liu MY, Lai HY, Yang BC, Tsai ML, Yang HY, Huang BM. MA-10 fare Leydig tümör hücrelerinde kurşunun steroidogenez üzerindeki inhibitör etkileri. Hayat Bilimi. 2001; 68 :849-859. [ PubMed ] [ Google Akademik ]
    • Loraine JA, Bell ET. Hormon tahlilleri ve klinik uygulamaları. Edinburgh, Birleşik Krallık: E. & S. Livingstone; 1971. [ Google Akademik ]
    • Mabrouk A, Ben Cheikh H. Timokinon takviyesi, yetişkin sıçanlarda kurşun kaynaklı testis fonksiyon bozukluğunu iyileştirir. Toksikol Ind Sağlık. 2014; 32 :1114–1121. [ PubMed ] [ Google Akademik ]
    • Mishra M, Acharya UR. Kurşunla tedavi edilen İsviçre farelerinde vitaminlerin spermatogenez üzerindeki koruyucu etkisi. J İz Elem Med Biol. 2004; 18 :173–178. [ PubMed ] [ Google Akademik ]
    • Mokhtari M, Sharifi E, Azadian S. Ceratonia siliqua L tohumlarının hidro alkolik ekstraktının hipofiz üzerindeki etkileri - Sıçanlarda testis hormonları ve spermatogenez. Adv Environ Biol. 2012; 6 :2778–2783. [ Google Akademik ]
    • Moneim AEA. Sıçanlarda cıva kaynaklı nörotoksisitede berberinin nöroprotektif etkisi. Metab Beyin Dis. 2015; 30 :935–942. [ PubMed ] [ Google Akademik ]
    • Moniem AEA, Dkhil MA, Al-quraishy S. Yetişkin sıçanların testislerinde keten tohumu yağının kurşun asetat kaynaklı oksidatif strese karşı koruyucu rolü. Afr J Biyoteknoloji. 2010; 9 :7216–7223. [ Google Akademik ]
    • Naghmouchi S, Khouja ML, Romero A, Tous J, Boussaid M. Tunus keçiboynuzu (Ceratonia siliqua L) popülasyonları: Bakla ve çekirdeğin morfolojik değişkenliği. Bilim Hortic. 2009; 121 :125-130. [ Google Akademik ]
    • Nishikimi M, Rao NA, Yagi K. İndirgenmiş fenazin metosufat ve moleküler oksijen reaksiyonunda süperoksit anyon oluşumu. Biochem Biophys Res Komün. 1972; 2 :849-854. [ PubMed ] [ Google Akademik ]
    • Owen RW, Haubner R, Hull WE, Erben G, Spiegelhalder B, Bartsch H, Haber B. Keçiboynuzu lifindeki ana bireysel polifenollerin izolasyonu ve yapı açıklamaları. Gıda Kimyasal Toksikol. 2003; 41 :1727–1738. [ PubMed ] [ Google Akademik ]
    • Özcan MM, Arslan D, Gökçalık H. Keçiboynuzu (Ceratonia siliqua) meyvesi, un ve şurubunun bazı bileşim özellikleri ve mineral içerikleri. Int J Gıda Bilimi Nutr. 2007; 58 :652–658. [ PubMed ] [ Google Akademik ]
    • Oziyci HR, Tetik N, Turhan I, Yatmaz E, Üçgün K, Akgül H, Gubbuk H, Karhan M. Yabani ve aşılı keçiboynuzu (Ceratonia siliqua L) meyvelerinin bakla ve tohumlarının mineral bileşimi. Bilim Hortic. 2014; 167 :149–152. [ Google Akademik ]
    • Paglia DE, Valentine WN. Eritrosit glutatyon peroksidazın nicel ve nitel karakterizasyonu üzerine çalışmalar. J Lab Clin Med. 1967; 70 :158–169. [ PubMed ] [ Google Akademik ]
    • Papagiannopoulos M, Wollseifen HR, Mellenthin A, Haber B, Galensa R. HPLC-UV-ESI/MSn ile keçiboynuzu meyvelerinde (Ceratonia siliqua L) ve türetilmiş ürünlerde polifenollerin tanımlanması ve miktar tayini. J Tarım Gıda Kimya. 2004; 52 :3784–3791. [ PubMed ] [ Google Akademik ]
    • Patra RC, Rautray AK, Swarup D. Kurşun ve kadmiyum toksisitesinde oksidatif stres ve iyileştirilmesi. Veteriner Med Int. 2011 [ PMC ücretsiz makale ] [ PubMed ] [ Google Akademik ]
    • Pedersen H. Dactylorhiza incarnata'nın (Orchidaceae) geç çiçek açan kumul popülasyonları: Varyasyon kalıpları ve taksonomik çıkarımlar. Kuzey J Bot. 2001; 21 :177–186. [ Google Akademik ]
    • Yerleştirici ZA, Cushman LL, Johnson BC. Biyokimyasal sistemlerde lipid peroksidasyonu (malonil dialdehit) ürününün tahmini. Anal Biyokimya. 1996; 16 :359–364. [ PubMed ] [ Google Akademik ]
    • Rahman MA H, Salem FE, Bauomy AA, Khalifa MA. Erişkin erkek albino sıçanlarda keçiboynuzu sulu ekstraktının nargile dumanının neden olduğu toksisite üzerindeki iyileştirici etkisi. Uluslararası J Ecz Eczacılık Sci. 2016; 9 :246. [ Google Akademik ]
    • Reshma Anjum M, Madhu P, Pratap Reddy K, Sreenivasula Reddy P. Wistar sıçanlarında çinkonun kurşun kaynaklı testis ve epididim toksisitesinde koruyucu etkileri. Toksikol Ind Sağlık. 2017; 33 :265–276. [ PubMed ] [ Google Akademik ]
    • Reshma Anjum M, Sainath SB, Suneetha Y, Sreenivasula Reddy P. Kurşun asetat sıçanlarda üreme ve baba aracılı gelişimsel toksisiteye neden oldu. Ekotoksikol Çevre Saf. 2011; 74 :793–799. [ PubMed ] [ Google Akademik ]
    • Rtibi K, Jabri MA, Selmi S, Souli A, Sebai H, El-Benna J, Amri M, Marzouki L. Sıçanlarda etanol kaynaklı oksidatif strese karşı keçiboynuzunun (Ceratonia siliqua L) gastroprotektif etkisi. BMC Tamamlayıcı Alter Med. 2015; 15 :1–8. [ PMC ücretsiz makale ] [ PubMed ] [ Google Akademik ]
    • Rtibi K, Selmi S, Jabri MA, El-Benna J, Amri M, Marzouki L, Sebai H. Ceratonia siliqua L'nin sıçanda karaciğer ve böbrekte dekstran sülfat sodyum kaynaklı değişikliklere karşı koruyucu etkisi. J Med Gıda. 2016a; 19 :882-889. [ PubMed ] [ Google Akademik ]
    • Rtibi K, Selmi S, Jabri MA, Mamadou G, Limas-Nzouzi N, Sebai H, El-Benna J, Marzouki L, Eto B, Amri M. Sulu ekstraktların etkileri: Ceratonia siliqua L pods sıçanlarda ince bağırsak hareketliliği ve farelerde jejunal geçirgenlik. RSC Adv. 2016b; 6 :44345–44353. [ Google Akademik ]
    • Said AA, Kairy MH, Shalaby AME, İsmail HT. Oreochromis niloticus'ta kurşun kaynaklı hematolojik ve biyokimyasal değişikliklere karşı keçiboynuzu kabuğu ve incir meyvesi eter ekstraktlarının etkisi. Zagazig Vet J. 2017; 45 :19–28. [ Google Akademik ]
    • Shotyk W, Le Roux G. Biyojeokimya ve kurşun döngüsü. Met Ions Biol Syst. 2005; 43 :239-275. [ PubMed ] [ Google Akademik ]
    • Sigman M. Erkek doğurganlığını bozan ilaçlar. SRM. 2007:11–15. [ Google Akademik ]
    • Simmons SO, Fan CY, Yeoman K, Wakefield J, Ramabhadran R. NRF2 Ağır Metallerin İndüklediği Oksidatif Stres Hücre Tipine Bağlıdır. Curr Kimya Genomik. 2011; 5 :1–12. [ PMC ücretsiz makale ] [ PubMed ] [ Google Akademik ]
    • Sinha AK. Katalazın kolorimetrik tahlili. Anal Biyokimya. 1972; 47 :389-394. [ PubMed ] [ Google Akademik ]
    • Soleimanzadeh A, Kian M, Moradi S, Malekifard F. Quercus brantii'nin hidro-alkollü ekstraktının erkek farelerin üreme sisteminde kurşun kaynaklı oksidatif strese karşı koruyucu etkileri. Avicenna J Bitki Tıbbı. 2018; 8 :448–456. [ PMC ücretsiz makale ] [ PubMed ] [ Google Akademik ]
    • Suvarna KS, Layton C, Bancroft JD. Bancroft'un Histolojik Teknikler Teorisi ve Uygulaması E-Kitabı. Elsevier Sağlık Bilimleri; 2018. s. 40–139. [ Google Akademik ]
    • Suzek H, Çelik I, Doğan A. Sıçanlarda karbon tetraklorür kaynaklı toksisiteye karşı keçiboynuzu kabuklarının (Cerotonia siliqua L) nefroprotektif hepatoprotektif potansiyeli ve antioksidan rolü. Hint J Pharm Educ Arş. 2017; 51 :312–320. [ Google Akademik ]
    • Tejada RI, Mitchell JC, Norman A, Marik JJ, Friedman S. Erkek doğurganlığının akridin portakalı (AO) floresansıyla pratik değerlendirmesi için bir test. Fertil Steril. 1984; 42 :87-91. [ PubMed ] [ Google Akademik ]
    • Tetik N, Turhan I, Öziyci HR, Gubbuk H, Karhan M, Ercişli S. Türkiye'de Ceratonia siliqua L germplazmının fiziksel ve kimyasal karakterizasyonu. Bilim Hortic. 2011; 129 :583–589. [ Google Akademik ]
    • Vafaei A, Mohammadi S, Fazel A, Soukhtanloo M, Pour AM, Beheshti F. Busulfan kaynaklı kısır farelerde keçiboynuzu (Ceratonia siliqua)'nın sperm kalitesi, testis yapısı, testosteron seviyesi ve oksidatif stres üzerindeki etkileri. Eczacılık Bilimi. 2018; 24 :104–111. [ Google Akademik ]
    • Wang Y, Fang J, Huang S, Chen L, Fan G, Wang C. Düşük kurşun seviyesinin sıçanlarda testislerin Nrf2 ve Mrp1 ifadeleri üzerindeki kronik etkileri. Çevre Toksikol İlaç. 2012; 35 :109-116. [ PubMed ] [ Google Akademik ]
    • Wong EWP, Cheng CY. Çevresel toksik maddelerin erkek üreme işlev bozukluğu üzerindeki etkileri. Trendler Pharmacol Sci. 2011; 32 :290–299. [ PMC ücretsiz makale ] [ PubMed ] [ Google Akademik ]
    • Dünya Sağlık Organizasyonu. İnsan sperminin incelenmesi ve işlenmesi için WHO laboratuvar kılavuzu. Dünya Sağlık Örgütü; 2010. [ Google Akademik ]
    • Yu B, Lin H, Yang L, Chen K, Luo H, Liu J, Gao X, Xia X, Huang Z. Nrf2 promotöründeki genetik varyasyon, insanlarda kusurlu spermatogenez ile ilişkilidir. J Mol Med. 2012; 90 :1333–1342. [ PubMed ] [ Google Akademik ]
    • Zhang H, Wei K, Zhang M, Liu R, Chen Y. Doğrudan ve dolaylı etkileşimler yoluyla kurşunun neden olduğu DNA hasarının mekanizmasının değerlendirilmesi. J Photochem Photobiol B Biol. 2014; 136 :46-53. [ PubMed ] [ Google Akademik ]

    Yorum yap


    • #3
      Etkisi keçiboynuzu kısır erkeklerde sperm parametreleri, oksidatif stres indeksi ve cinsiyet hormonları üzerinde (Keçiboynuzu) şurup ve vitamin E: Protokol randomize kontrollü deneme için

      Mir Mohammad Reza Aghajani , MD, 1 Neda Mahdinezhad Gorji , MSc, 1 Parvaneh Mirabi , PhD, 1 ve Faraz Mojab 2
      Yazar bilgileri Makale notları Telif hakkı ve Lisans bilgileri Sorumluluk Reddi
      Git: Soyut

      Arka plan:

      Spermatogenez, insanların doğurganlık ve üreme kapasitesinde gerekli bir süreçtir. Erkeklerde spermatogenez bozukluklarının göreceli olarak yüksek prevalansı ve geleneksel tıpta sağlanan tedavilerin başarısızlığı göz önüne alındığında, yeni terapötik yaklaşımlar düşünülmektedir. Bu çalışma, kısır erkeklerde Ceratonia siliqua (Keçiboynuzu) şurubu ve E vitamininin sperm parametreleri, oksidatif stres indeksi ve üreme hormonları üzerine etkisini araştırmak için planlanacaktır. yöntemler:

      Bu randomize kontrollü deneme protokolü, Babol Tıp Bilimleri Üniversitesi'nde belirlenecektir. Önerilen örneklem büyüklüğü, keçiboynuzu şurubu alan deney grubunda 30 erkek ve E vitamini alan karşılaştırma grubunda 30 erkek ile oligozoospermili ve teratospermili 60 erkektir. Birincil sonuç ölçütü, semen parametrelerindeki değişiklik ve endokrin değişikliği de dahil olmak üzere ikincil sonuç ölçütleridir. parametreler ve stres oksidatif belirteçler. Bu araştırma, Iran Registry of Clinical Trials web sitesinde IRCT20171209037794N1 kimlik numarası olarak kaydedilmiştir. Çözüm:

      Bu bitkinin faydalı etkisi doğrulanabilirse, kısır erkeklere yardımcı olmak için uygun maliyetli bir yöntem sağlayacak ve gelecekte erkek kısırlığının tedavisi için kanıta dayalı referanslar sağlayacaktır.

      Anahtar Kelimeler: Erkek kısırlığı, Ceratonia siliqua, Sperm parametreleri, Oksidatif stres, Cinsiyet hormonları R Spermatogenez sürecinde sperm üretim bozuklukları erkek kısırlığının en yaygın nedenlerinden biridir. Spermatogenez bozukluklarının göreceli olarak yüksek prevalansı ve geleneksel tıpta sağlanan tedavilerin başarısızlığı göz önüne alındığında, yeni terapötik yaklaşımlar düşünülmektedir ( 1 ). Son yıllarda şifalı bitkilerin kullanımının artması, bitkisel ilaçlar konusunda kapsamlı araştırmaların yapılmasına neden olmuştur. İdiyopatik infertilitedeki birçok sperm değişikliği, yüksek seviyelerde reaktif oksijen türleri (ROS) ile ilişkilidir. Artan ROS üretimi, lipidler, proteinler ve hücresel DNA'da oksidatif hasara yol açar. Sperm DNA'sındaki hasar, sperm motilitesinin azalmasına, akrozom zarı hasarına ve oositin döllenmesinde sperm sakatlığına neden olur ( 2 , 3) Böylece antioksidan kapasiteye sahip bitkiler üretilen serbest radikallerin yıkıcı etkileriyle baş edebilir ve içindeki oksidatif stres kısır erkekte hücreyi en aza indirir. Öte yandan iltihaplanma, antioksidanın savunma gücünü de azaltır ( 3 ). Çeşitli çalışmalar, antioksidanlarla takviyenin inflamatuar faktörleri azalttığını bildirmiştir ( 4 - 7 ). Bu şifalı bitkilerden biri de Legominasae familyasından 7-12 metre yüksekliğe sahip Ceratonia siliqua (Keçiboynuzu) ağacıdır.

      Akdeniz bölgesi, güney Suriye ve Hindistan'ın yanı sıra Kaliforniya'ya özgüdür ve İran'da, özellikle Shapur, Fars ve Kazeroun'da yaygın olarak yetişir. Bu bitki birçok lif, karbonhidrat, polifenolik bileşik, lignin, protein, kalsiyum, potasyum fosfor, glutamik asit, linolenik asit, Linoleik asit, E, D, C, B6 vitaminleri, folik asit, demir ve magnezyum içerir. Aynı zamanda, antioksidan aktivitesi tanen ve fenol bileşikleri ile ilişkili olan doğal bir antioksidan kaynağıdır ( 8 - 11 ).

      Geleneksel olarak sperm sayısını artırmak için kullanılır ( 8 , 12 ). Hayvan çalışmaları, bu bitkinin özünün kullanılmasının, cAMP üretimi ve sıçanın testis steroidogenezinde yer alan enzimlerin aktivitesi üzerinde etkileri olduğunu göstermiştir. Bu araştırmalarda keçiboynuzu ekstraktının kullanımı, leydig hücrelerini ve testosteron biyosentezini etkileyerek sperm kalitesini iyileştirmiş, testosteron düzeylerini ve biyokimyasal parametreleri artırmıştır, dolayısıyla seks hormonları, sperm üretimi ve spermatogenez süreci üzerinde etkilidir ( 8 , 11 ). Bu etkilerin arkasındaki ana mekanizmalar bilinmemektedir. Ceratonia silique'in etkilerini değerlendirmek için kontrollü insan klinik çalışmaları yapılmamıştır.İnfertil erkeklerde spermatogenez üzerine. Ancak birçok ülkede lokal olarak kullanılmaktadır . Bu bitkinin (meyve, kapsül veya ekstrakt) kullanımı için hiçbir yan etki rapor edilmemiştir.Araştırmacılar belirli bir komplikasyon bildirmemiş ve insanlarda tüketimine izin verildiğini bildirmişlerdir ( 12 , 13). Bildiğimiz kadarıyla, insan çalışmaları bu bitki ekstraktının sperm parametreleri, oksidatif stres indeksleri ve üreme hormonlarının seviyesi üzerindeki etkilerini araştırmadı veya sonuçlar henüz yayınlanmadı. Yeni tıpta erkek infertilitesinin tedavisinde hala problemlerin olduğu ve son yıllarda bitkisel tıbbın tamamlayıcı tıp olarak yaygın olarak kullanıldığı göz önüne alındığında, bu çalışma Ceratonia siliqua şurubu ve vitaminin etkisini araştırmak için tasarlanmıştır. İnfertil erkeklerde sperm parametreleri, oksidatif stres indeksi ve üreme hormonları üzerine E.

      Git: yöntemler

      Çalışma tasarımı: Bu randomize kontrollü araştırma çalışmasının protokolü, Babol Tıp Bilimleri Üniversitesi Kurumsal İnceleme Kurulu (IR.MUBABOL.HRI.REC.1396.179) tarafından onaylanmıştır.

      Çalışma ortamı: Bu çalışma Babol Tıp Bilimleri Üniversitesi'ne bağlı Kısırlık ve Üreme Sağlığı Merkezi'nde ve üroloji kliniğinde yapılacaktır.

      Örnek boyutu: Deneme, koşul başına N=26 ile α=0.05 ve gücü 0.80 olan iki kuyruklu bir testte istatistiksel olarak anlamlı olarak d ≥0,70'lik bir etki boyutunu saptamak üzere güçlendirilmiştir. Bazı hastaların çalışmayı tamamlamama ihtimali olduğu için Keçiboynuzu ve E vitamini gruplarına 30 hastayı dahil edeceğiz.

      Katılımcılar: Babol Tıp Bilimleri Üniversitesi kısırlık merkezine başvuran çiftlerin erkek partnerleri çalışmaya dahil edilecektir. Önerilen örneklem büyüklüğü, keçiboynuzu şurubu alan deney grubunda 30 erkek ve karşılaştırma grubunda E vitamini alan 30 erkek ile teratospermi ve oligozoospermili 60 erkektir.

      Uygunluk kriterleri: Dahil edilen her konunun uygunluğu ürolog tarafından onaylanacaktır. Araştırma için uygun olan hastalar, randomizasyon sırasında aşağıdakilerin tümüne uymalıdır:
      • 20-45 yaş arası, en az 12 aydır infertilite şikayeti olan ve infertiliteye yönelik cerrahi veya medikal tedavi öyküsü olmayan.
      • 30'dan az bir BMI'ye sahip olmak.
      • WHO kriterlerine göre belirsiz oligo-spermatozoa (sperm konsantrasyonu ml başına 15 milyondan az, A tipi hareketlilik %25'ten az ve B tipi hareketlilik %50'den az, normal morfoloji %15'ten az).
      • Sigara, alkol ve madde bağımlılığı olmaması.
      • Diyabet ve tiroid hastalığı gibi sistemik hastalık hastalıklarının olmaması, serebrovasküler hastalık ve kemoterapi öyküsü yoktu.
      • Doğal olarak oluşan gonadotropinler, testosteron ve prolaktin
      • Vazektomi veya obstrüktif azospermi öyküsünün olmaması.
      • Tekrarlayan veya rezidüel varikoseli olan ve kriptorşidizm veya Azospermi öyküsü olan ve kleinfelter Sendromu gibi kromozomal anormallikleri olan hastalar çalışmaya dahil edilmemiştir.

      Dışlama Kriterleri:
      • Genital sistem enfeksiyonu.
      • Son üç ayda ve çalışma sırasında antioksidan takviyesi kullanımı.
      • Çalışma sırasında kimyasal ilaçların kullanımı.
      • Şiddetli fiziksel aktiviteye sahip olmak.
      • Hipogonadizm veya hipofiz anormallikleri.

      İşe Alım: Çalışmanın alıştırma aşamasında haftada 3 gün Fatemezahra Kısırlık Kliniği'nde araştırma ekibinden bir üye (üreme sağlığı araştırmacısı) ve ürolog bulunur. Araştırmacılar, katılımcıları çalışmaya katılımla ilgili tüm yönlerden bilgilendirecek ve tüm hastaları başvuru sırasında uygunluk kriterleri için tarayacaktır. Hedef popülasyona ulaşılana kadar deneklerin taranması devam edecektir. Katılımcılar çalışma sırasında istedikleri zaman çalışmadan ayrılmakta özgür olacaklardır ve bu onların klinik tedavilerini etkilemeyecektir.

      Randomizasyon öncesi veriler: İlk ziyarette, yaş, meslek, vücut kitle indeksi, sigara kullanımı, alkol alımı, tıbbi geçmiş, ilaç geçmişi ve çalışan bir klinik dahil olmak üzere klinik bir görüşme yoluyla temel klinik demografik bilgiler ve eksiksiz bir tıbbi geçmiş alınacaktır. Teşhis. Çalışma için potansiyel olarak uygun infertil erkekleri belirlemek için sperm sayısında, motilitesinde veya morfolojisinde bir bozukluğu olan herkeste bir fizik muayene yapılacaktır. Sperm sayısı (oligospermi) anormal morfolojisi (teratospermi) ve azalmış sperm motilitesi (astenospermi) açısından bozukluğu olan hastaları seçme kriterleri ve semen analizinin istatistiksel sonuçları WHO kriterlerine dayanmaktadır ( 14). Ürolog hastanın çalışmaya alınmaya uygun olduğunu belirledikten sonra, uygun tüm katılımcılardan çalışmaya katılmadan önce yazılı bir onam formu imzalamaları istenecektir.

      Körleme: Semen numunelerinden, endokrin testlerinden ve biyobelirteç analizinden (sonuç değerlendiricisi) elde edilen verileri uygulayan ve analiz eden araştırmacılar, katılımcı gruplamasına karşı kör olacaktır.

      Tahsis (yöntem ve tahsis gizleme mekanizması): Blok randomizasyon yöntemi, zaman içinde gruplar arasında bir denge sağlamak için hastaları eşit örneklem büyüklükleriyle sonuçlanan gruplara randomize etmek için kullanılacaktır.

      Çalışmanın alıştırma aşamasına başlamadan önce, işe alımda yer almayan araştırma ekibinin bir üyesi tarafından iki adet 60'lık rasgele sayı oluşturulacaktır. Keçiboynuzu için A, E vitamini grubu için B kombinasyonu 4'lü 15 blok hazırlanacaktır.

      Tahsis sırası parola korumalı olacak ve yalnızca üreme sağlığı araştırmacısı tarafından erişilebilir olacaktır. 4 boyutlu blokların bulunduğu kağıdı iki kat katlıyor, standart kalın zarflara koyuyor ve üzerlerine seri numaralarını yazıyor. Zarfın tamamı işe alım merkezinde tutulacaktır. Böylece, her uygun hasta için araştırmacı, karıştırdıktan sonra zarflardan birini rastgele seçer ve denekleri müdahale ve karşılaştırma grubuna atar.

      Veri toplama: Fizik muayeneden ve temel karakteristik verileri ve uygunluk kriterlerini kontrol ettikten sonra, semen analizi ve serum folikül uyarıcı hormon (FSH), prolaktin, luteinize edici hormon (LH), toplam testosteron ve toplam antioksidan kapasite (TAC) ve malondialdehit dahil hormonal durum (MDA) başlangıçta ve kayıttan 3 ay sonra yapılacaktır.

      Semen örnekleri, üç günlük cinsel perhizin ardından laboratuvarın yakınındaki bir odanın mahremiyetinde toplanacak ve 37°C'de saklanacaktır. Semenin toplanması ve analizleri için valide edilmiş ve standart bir laboratuvar (Fatemezahra İnfertilite Merkezi) kullanılacaktır. Sperm özellikleri, toplandıktan hemen sonra taze numuneler üzerinde çalışılacaktır. Oda sıcaklığında sıvılaştırılan seminal sıvıdan sonra, semen hacmi, konsantrasyonu, sperm motilitesi ve morfolojisi dahil olmak üzere rutin semen analizleri WHO tavsiyesine göre yapılacaktır ( 14 ).

      Kan örnekleri santrifüjlenecek ve serum, oksidatif stres indeksi ve seks hormonlarını içeren metabolomik biyobelirteçler için -50°C'de saklanacaktır. Cinsiyet hormonlarının ölçümü ELISA yöntemiyle ve ilgili kitin talimatına göre yapılır.

      Katılımcı zaman çizelgesi: SPIRIT 2013 şablonuna ( 15 ) dayalı kayıt, müdahaleler ve değerlendirmelerin zaman çizelgesi aşağıda gösterilmiştir.tablo 1. tablo 1

      SPIRIT 2013 kayıt programı, müdahaleler ve değerlendirmeler
      zaman noktası -t 1 0 t 1 t 2 t 3 t x
      kayıt x
      Uygunluk ekranı x
      bilgilendirilmiş onay x
      Tıbbi geçmiş x
      Güvenlik endeksi x
      FSH, LH, Prolaktin, MDA Testosteron, TAC seviyesi x
      Semen analizleri
      Tahsis
      x
      x
      Araya girmek
      keçiboynuzu grubu
      E vitamini grubu x x x
      değerlendirmeler:
      FSH,LH,Prolaktin, MDA Testosteron, TAC seviyesi x
      Semen analizleri x
      Olumsuz olaylar x x x x
      Veri İzleme: Çalışmaya dahil olmayan ve üniversite tarafından seçilen BUMS'den iki araştırmacı, verileri izleyecek ve çalışmanın yürütülmesini denetleyecektir.

      Araya girmek: Hastalara günde iki kez keçiboynuzu şurubu veya E vitamini (karşılaştırma grubu) 3 ay boyunca günde bir kez 100 mg (1:1) verilecektir. Keçiboynuzu baklaları Tahran'daki bitki pazarından satın alınacak ve botanikçi tarafından tanımlanıp onaylandıktan sonra toz haline getirilecek ve suda (100 gram Keçiboynuzu, (geleneksel dozaj) 500 ml su içinde) kaynatılarak ekstrakte edilecektir. Daha sonra süzüldükten sonra 500 ml USP şurubu ile karıştırılacaktır. Her hasta günde 15 ml Keçiboynuzu şurubu (bölünmüş × 2) (geleneksel tıpta ~ dozaj) kullanacaktır. Tüm hastalar için önce bir spermogram yapılır. Tedaviden üç ay sonra iki gruptan spermogram ve kan örnekleri alındı. Çalışmanın ana sonucu, spermogram testini ve prolaktin, FSH, TAC, MDA ve testosteron parametrelerinin her birinin ikincil sonucunu iyileştirmektir. Çalışmaya dahil edilen ilk ziyaret sırasında, katılımcılara ilaç reçete edilecektir. Başlangıçta iki hafta boyunca reçete edilir. Bir hafta sonra yan etkileri gözden geçirmek ve hastanın isteği doğrultusunda erken randevu ayarlamak için bir telefon görüşmesi yapılacaktır. İki hafta sonra hasta kalan ilaçları alacak ve tedaviye uyum değerlendirilecektir (Şekil 1).
      Resim, illüstrasyon vb. içeren harici bir dosya. Nesne adı cjim-10-452-g001.jpg
      Ayrı bir pencerede aç
      Şekil 1
      Çalışmanın akış şeması

      Takip: Katılımcılar, olumsuz etkilerin belirtileri veya semptomları için aylık olarak izlenecektir. Bir ay sonra katılımcılar klinikte gözden geçirilecek ve olası bir yan etki kontrol listesi yapılacaktır. Yıpranmayı önlemek ve tedaviye uyumu değerlendirmek için ilacın uygulanmasından 2 ay sonra tekrar telefon görüşmeleri yapılacaktır. Müdahaleden 3 ay sonra ve ilaçlar tamamlandıktan sonra tüm katılımcılar kısırlık kliniğinde kontrol edilecek, sperm sayısı, hareketliliği ve morfolojisi için standart klinik protokollere göre semen analizi yapılacak ve ayrıca serum örnekleri toplanacak. oksidatif stres ve üreme hormonlarının belirteçlerini değerlendirmek (Şekil 1).

      Uyum: Tedaviye uyumu değerlendirmek için kendi kendini değerlendiren hastanın kontrol listesi kullanılacaktır, ayrıca katılımcılar her ziyarette Keçiboynuzu şurubu şişelerini getirmelerini söyleyecektir.

      Sonuç ölçütleri: Birincil sonuç ölçütü, E vitamini alan erkeklere kıyasla Keçiboynuzu şurubu alan erkeklerde 3 ay sonra semen parametrelerindeki değişiklik olacaktır. (WHO) metodolojilerine göre birincil sonuç ölçütü.

      [Zaman çerçevesi: Tedaviden önce ve 2 tedavi kolunda 3 aylık tedavi tamamlandıktan sonra semen analizi yapılacaktır].
      1. sperm konsantrasyonu, 2) yüzde motilite, 3) sperm morfolojisi İkincil sonuç ölçütleri, endokrin parametrelerdeki değişikliği, stres oksidatif belirteçleri ve tedaviye uyumun değerlendirilmesini içerecektir.
      1. Tedavi sonrası üreme hormonlarının serum seviyelerindeki değişiklikler (Zaman Çerçevesi: Tedavi öncesi ve 2 tedavi kolunda 3 aylık tedaviler bittikten sonra üreme hormonları yapılacaktır) Serum folikül uyarıcı hormon, lüteinizan hormon, toplam testosteron ve prolaktin konsantrasyonları.
      2. Serumdaki oksidatif stres biyobelirteçlerinin seviye değişikliğini değerlendirin (Zaman çerçevesi: Tedaviden önce ve 3 ay sonra tedavi 2 tedavi kolunda tamamlanır, oksidatif stres biyobelirteçleri yapılır) Serum Malondialdehit (MDH) ve toplam antioksidan kapasite (TAC) konsantrasyonları kullanılarak 532 nm'de spektrofotometre.
      3. Tedaviye uyumu değerlendirmek için öz değerlendirme hastasının kontrol listesi kullanılacaktır. Ayrılma ve uyumsuzluk nedenleri de not edilecek ve rapor edilecektir.

      İstatistikler ve veri analizi: Temel özellikler, kategorik değişkenler için ki-kare testleri ve normal dağılımlı sürekli değişkenler için bağımsız t testi kullanılarak Keçiboynuzu ve E vitamini grupları arasında karşılaştırılacaktır . Normallik varsayımları ihlal edilirse parametrik olmayan teknikler uygulanacaktır. Keçiboynuzu tedavisinin etkilerini değerlendirmek için tek yönlü kovaryans analizi (ANCOVA) kullanılacaktır. Parametreler arasındaki nispi ilişkiler Pearson korelasyon katsayısı ile belirlenecektir. Tüm istatistiksel analizler SPSS (Sürüm 16) yazılımı kullanılarak yapılacaktır. 0,05'ten küçük bir p değeri (iki taraflı), %95 güven aralığı ile istatistiksel olarak anlamlı bir farkı gösterir.

      Git: Tartışma

      Son on yılda erkek üreme teşhisi

      performansı önemli ölçüde ilerlemiştir. Birçok kısır erkek, doğru teşhis ve tedavi edildiğinde ortadan kaldırılabilen ve doğal döllenmeye izin verecek ilaçlarla tedavi edilebilen rahatsızlıklara sahiptir. Şu anda dünya nüfusunun %60'ı hastalıkların tedavisi için bitkisel ilaçlar kullanıyor ve doktor reçetelerinin %25'i diğer ilaçlara göre daha az yan etkisi olan bitkisel bileşikler içeriyor. Kısırlık, çiftlerin tıbbi sorunlarından biridir ve Dünya Sağlık Örgütü'ne (WHO) göre, çiftlerin %10'u bu sorundan etkilenmektedir, %10 ila %40-50'si erkek faktörüne bağlıdır, en önemlisi kısırlıktır. düşük sperm kalitesi. Bu nedenle bu bozuklukların giderilmesine özen gösterilmesi çiftlerin kısırlık tedavisi için çok önemlidir. Dünyada doğurganlığı önleyici ve gübreleme etkisi olan çok sayıda şifalı bitki bulunmaktadır. Bu otlar tarih boyunca erkeklerde doğurganlığı azaltmak veya arttırmak için kullanılmıştır. Birçok kişi artık doğurganlığı ve cinsel isteği artırmak için bitkisel ilaçlar veya türevlerini kullanıyor. Bu nedenle, erkek doğurganlığı ve östrojenik ve anti-östrojenik özelliklere sahip doğal bitkisel maddeler üzerinde bitkisel biyolojik olarak aktif maddeyi incelemek gerekir (5 ) DSÖ, bitkisel ilaçların artan kullanımına rağmen, hala önemli ölçüde yetersiz araştırma bilgisi olduğunu, bitkileri inceleyen makalelerin rolünün çok önemli olduğunu bildirmiştir. Kimyasal ilaçların insan üzerindeki olumsuz etkilerinin netleşmesiyle birlikte kadınlar ve erkekler giderek bitkisel ilaçlara yönelmektedir. Bitkisel ilaçlar normal ilaçlar için uygun bir ikamedir.

      Bu, iki farklı müdahaleden sonra sperm parametrelerindeki değişiklikleri karşılaştıran ilk çalışmadır: aktif müdahale (Keçiboynuzu) ve E vitamini müdahalesi. Başarılı olursa, bu çalışma erkeklerin ve çiftlerin gebe kalmasına yardımcı olmak için tercih edilen prosedürler hakkında yeni bilgiler sağlayacak ve bu erkekleri tedavi eden ürologlara rehberlik edecektir.

      Kısaltmalar listesi:

      Reaktif oksijen türleri (ROS)

      Ceratonia Siliqua (Keçiboynuzu)

      Döngüsel AMP (CAMP)

      Vücut kitle indeksi (BMI)

      Folikül uyarıcı hormon (FSH)

      Luteinize edici hormon (LH),

      Toplam antioksidan kapasitesi (TAC)

      Malondialdehit (MDA)

      beyannameler

      Etik onayı ve katılım onayı: Araştırma projesi, Kurum Etik Kurulu'nun (Babol Tıp Bilimleri Üniversitesi) 3/2/2015 tarih ve 5121 numaralı onayını almıştır. Kan örneklerinin kullanımı için her hastadan yazılı izin alınacaktır.

      Yayın Onayı: Hastalarımızın onam formu alınacak ve hazır bulundurulacaktır.

      Veri ve materyallerin mevcudiyeti: Mevcut çalışma sırasındaki veri setleri, makul talep üzerine ilgili yazardan temin edilebilir.

      Git: Teşekkür

      Üniversitenin Araştırma Görevlisi, Sağlık Araştırmaları Enstitüsü başkanı ve tüm çalışma katılımcılarının işbirliğini takdir ediyoruz.

      Git: Finansman:

      Bu araştırma, Babol Tıp Bilimleri Üniversitesi Araştırma ve Teknoloji Rektör Yardımcısı tarafından finanse edilmektedir.

      Git: Rekabet eden ilgi alanları:

      Yazarlar, rekabet eden çıkarları olmadığını beyan eder.

      Git: Referanslar

      1. Tuttelmann F, Ruckert C, Ropke A. Spermatogenez bozuklukları: 20 yıllık değişmeyen rutinden sonra yeni genetik tanı perspektifleri. Med Genet. 2018; 30 :12–20. [ PMC ücretsiz makale ] [ PubMed ] [ Google Akademik ]
      2. Lobo V, Patil A, Phatak A, Chandra N. Serbest radikaller, antioksidanlar ve fonksiyonel gıdalar: İnsan sağlığına etkisi. Farmakogon Rev. 2010; 4 :118–26. [ PMC ücretsiz makale ] [ PubMed ] [ Google Akademik ]
      3. Lavranos G, Balla M, Tzortzopoulou A, Syriou V, Angelopoulou R. Erkek kısırlığında ROS kaynaklarının araştırılması: çok sayıda yol için ortak bir son. Reprod Toksikol. 2012; 34 :298–307. [ PubMed ] [ Google Akademik ]
      4. Teixeira-Lemos E, Nunes S, Teixeira F, Reis F. Düzenli fiziksel egzersiz eğitimi, tip 2 diyabet gelişimini önlemeye yardımcı olur: antioksidan ve antiinflamatuar özelliklerine odaklanın. Kardiyovasküler Diabetol. 2011; 10 : 12. [ PMC ücretsiz makale ] [ PubMed ] [ Google Akademik ]
      5. Dorostghoal M, Kazeminejad SR, Shahbazian N, Pourmehdi M, Jabbari A. Fertil ve infertil erkeklerde oksidatif stres durumu ve sperm DNA fragmantasyonu. androloji. 2017; 49 [ PubMed ] [ Google Akademik ]
      6. Agarwal A, Virk G, Ong C, du Plessis SS. Oksidatif stresin erkek üremesine etkisi. Dünya J Erkek Sağlığı. 2014; 32 :1–17. [ PMC ücretsiz makale ] [ PubMed ] [ Google Akademik ]
      7. Sabeti P, Pourmasumi S, Rahiminia T, Akyash F, Talebi AR. Sperm oksidatif stres etiyolojileri. Int J Reprod Biomed (Yazd) 2016; 14 :231–40. [ PMC ücretsiz makale ] [ PubMed ] [ Google Akademik ]
      8. Vafaei A, Mohammadi S, Fazel A, et al. Busulfan ile infertil farelerde keçiboynuzunun (ceratonia siliqua) sperm kalitesi, testis yapısı, testosteron seviyesi ve oksidatif stres üzerine etkileri. Eczacılık Bilimi. 2018; 24 :104–11. [ Google Akademik ]
      9. Custodio L, Escapa AL, Fernandes E, et al. Keçiboynuzu ağacı (Ceratonia siliqua L) germ unu özlerinin fitokimyasal profili, antioksidan ve sitotoksik aktiviteleri. Bitki Besinleri Hum Nutr. 2011; 66 :78-84. [ PubMed ] [ Google Akademik ]
      10. Rtibi K, Jabri MA, Selmi S, et al. Sıçanlarda etanolün neden olduğu oksidatif strese karşı keçiboynuzunun (Ceratonia siliqua L) mide koruyucu etkisi. BMC Tamamlayıcı Alter Med. 2015; 15 [ PMC ücretsiz makale ] [ PubMed ] [ Google Akademik ]
      11. Mokhtari M, Sharifi E, Sh A. Ceratonia siliqua L tohumlarının hidro alkolik ekstraktının sıçanlarda hipofiz-testis hormonları ve spermatogenez üzerindeki etkileri. Adv Environm Biol. 2012; 6 :2778–84. [ Google Akademik ]
      12. Gülay M, Yıldız-Gülay O, Ata A, Balic A, Demirtaş A. Erkek Yeni Zelanda beyaz tavşanlarında keçiboynuzu (Ceratonia silique) fasulyesi ekstraktlarının toksikolojik değerlendirmesi. J Animasyon Veterineri Av. 2012; 11 :1853–7. [ Google Akademik ]
      13. Takagi H, Onodera H, Yun L, et al. Sıçanlarda amonyum sülfatın 13 haftalık subkronik oral toksisite çalışması. Kokuritsu Iyakuhin Shokuhin Eisei Kenkyusho Hokoku. 1999; 117 :108–14. [ PubMed ] [ Google Akademik ]
      14. Cooper TG, Noonan E, von Eckardstein S, et al. İnsan semen özellikleri için Dünya Sağlık Örgütü referans değerleri. Hum Reprod Güncellemesi. 2010; 16 :231–45. [ PubMed ] [ Google Akademik ]
      15. Chan AW, Tetzlaff JM, Altman DG, et al. SPIRIT 2013 Beyanı: klinik araştırmalar için standart protokol öğelerinin tanımlanması. Rev Panam Salud Publica. 2015; 38 :506–14. [ PMC ücretsiz makale ] [ PubMed ] [ Google Akademik ]

      Yorum yap

      Hazırlanıyor...
      X