Duyuru

Collapse

Devamını görüntüle
See less

Maytake Mantarı, Maitake Mantarı ( Grifola Frondosa)

Collapse
X
  • Filtrele
  • Zaman
  • Göster
Hepsini Sil
new posts

  • Maytake Mantarı, Maitake Mantarı ( Grifola Frondosa)

    Maitake, Grifola Frondosa Polisakkarit: Çin'deki Antitümör ve Diğer Biyolojik Aktivite Çalışmalarının Gözden Geçirilmesi
    Özet:
    Bir Basidiomycotina türü olan Grifola frondosa , üst üste binen kapaklarla karakterize, büyük bir meyve gövdesine sahip yenilebilir bir tıbbi mantardır. Β-glukan , başlıca biyolojik açıdan aktif bir bileşeni olarak G. Frondosa polisakkarit (GFP) veya yaklaşık 30 yıldır kapsamlı olarak araştırılmıştır D fraksiyonu. GFP, 2010 yılında Çin'de kanser tedavisi için yardımcı bir terapötik ilaç olarak onaylandı. Çin VIP, CNKI ve Wanfang veritabanlarının arama sonuçlarına dayanan bu makalede, 105 bağımsız hayvan çalışması özetlendi. GFP'nin kimyasal yapısı, antitümör, immünomodülatör, anti-diyabetik, anti-hiperlipidemi ve antiviral aktiviteleri ve moleküler mekanizmaları gözden geçirilmiş ve tartışılmıştır.

    Giriş
    Grifola frondosa , Japonya'da maitake olarak da adlandırılan bir İtalyan tarafından keşfedilen bir mantardır . Japonca olarak, mai araçlar dans ve almak , araç mantar böylece “dans mantar” (Mayell, 2001). Meyve veren gövdeleri, amino asitler, polisakkaritler ve eser elementler gibi çeşitli besinler bakımından zengindir. Ve besin değerleri Shiitake mantarından daha yüksektir. Japon bilim adamları, Grifola frondosa polisakkaritinin ( GFP ) veya D-fraksiyonunun biyolojik olarak aktif ana bileşen olduğunu buldular . Farklı ekstraksiyon yöntemleri kullanılarak, GFP meyve veren cisimlerden, miselden ve fermantasyon et suyundan çıkarılabilir (Bian ve ark.., 2004). Sıcak su ekstraksiyonu, alkali ekstraksiyon ve asit çökeltme ve mikrodalga ekstraksiyon gibi farklı ekstraksiyon yöntemleri kullanılarak farklı suda çözünür ve suda çözünür olmayan bileşenler elde edilebilir. Aktif bileşenler bir glikoprotein veya saf bir polisakkarit olabilir (Li ve diğerleri , 2006). D-fraksiyonu veya GFP,-glukandan (β-1,3 dallı β-1,6-bağlantılı glukan veya β- ile dallanmış β-1,3-bağlantılı glukan) oluşan, proteine ​​bağlı bir polisakarit veya proteoglukandır. 1,6 glukozid) ( Şekil 1 ) (Konno, 2009; Zhao ve diğerleri , 2009). Glikanları çoğunlukla D-ksiloz, D-fukoz, D-mannoz, L-arabinoz, gentiobioz, üronik asit, trehaloz ve galaktoz ile birlikte D-glikozdan oluşur (Li ve ark.., 2006). Ek olarak, glikan bazlı ilaçlar kapsül olarak mevcuttur ve SFDA onaylı tek ilaç, 2010 yılında Çin'de verilen "Mai Te Xiao" (Hui Shu Hua Jiao Nang) (ilaç # B20020023) 'dir. Maitake daha sonra tıbbi bir mantar olarak kabul edildiğinden, yaklaşık 30 yıldır yoğun bir şekilde bilimsel araştırma çalışmalarına tabi tutuldu. Zaman ilerledikçe, araştırmacılar sağlık açısından kayda değer faydalar sağlayabilecek bir dizi tıbbi özelliği ortaya çıkardılar. Ve aşağıdaki zaman çizelgesi ( Şekil 2 ) Grifola frondosa polisakkaridinin araştırma ilerlemesidir .





    Grifola frondosa Polisakkaritinin Farmakolojik Etkileri
    Tablo 1.

    Tablo 1 . S-GAP-P ve GFP'nin farklı kanser hücreleri üzerindeki büyümeyi inhibe edici etkileri.
    Çok sayıda farmakolojik analiz ve klinik deney, polisakkaritlerin önemli anti-tümör ve anti-viral aktivitelere ( hepatit B ve insan immün yetmezlik virüsü ) sahip olduğunu ve bağışıklık sistemini iyileştirebileceğini, kan şekeri, kan yağı ve kolesterol seviyelerini, kan basıncını, ve herhangi bir yan etki olmaksızın başka etkiler uygular.
    Bu tür biyolojik aktiviteleri göstermek ve doğrulamak için in vitro ve in vivo veya klinik ortamlarda çok sayıda çalışma yapılmıştır . GFP dışında, mantar polisakkarit preparatlarının büyük çoğunluğu ağızdan alındığında geçersizdir (Xing ve diğerleri , 1999). Ayrıca enjeksiyon, klinik uygulama ve çalışmalar için etkili ve uygundur (Xuve diğerleri , 1999b).

    Anti-tümör aktivitesi
    Farelerde GFP'nin anti-tümör aktivitesi ile ilgili kırk iki makale geri alındı. GFP'nin anti-tümör mekanizması, diğer mantar polisakkaritlerine benzer. Ancak, GFP'nin kanserle mücadele yeteneği Ganoderma lucidum , lentinan ve Coriolus versicolor'un polisakkaritlerinden üstündü (Zheng ve ark.., 2001). GFP esas olarak bağışıklığı artırır ve vücudun tümör hücrelerini yok etme yeteneğini geliştirir. GFP, sadece vücudun spesifik olmayan bağışıklığını iyileştirmekle kalmayıp aynı zamanda vücudun spesifik bağışıklığını da geliştirebilen ve ayrıca çeşitli sitokinler ve kemokinlerin üretimini tetikleyebilen bağışıklığı çeşitli yönlerden geliştirir. GFP, tümör hücrelerini doğrudan öldürmez, bunun yerine vücudun bağışıklık sistemini güçlendirir ve tümör büyümesini engellemek, metastazı önlemek ve normal hücrelerin kanserli hale gelmesini önlemek için vücudun kendi bağışıklık sistemine güvenir (Xing ve diğerleri , 1999). Ancak Inoue ve ark.. (2002), GFP'nin anti-tümör etkilerinin, spesifik olmayan immün reaksiyonlarla değil, esas olarak tümöre özgü bağışıklığı indükleyen lenfositler tarafından sağlanabileceğini varsaydı. Ayrıca, GFP kemoterapi veya radyoterapi ile birleştirildiğinde , immün yetkin hücre aktiviteleri , kemoterapiye kıyasla 1,2-1,4 kat arttı (Kodama ve diğerleri , 2002; 2005; Lin ve diğerleri , 2004) ve kemoterapi veya radyoterapinin yan etkilerini azalttı. veya tek başına radyoterapi. D-fraksiyonu olarak adlandırılan biyoaktif bir β-glukan fraksiyonu, Grifola frondosa'nın hem miselinden hem de meyve veren gövdesinden izole edilmiştir. Japon mikologlar tarafından 1984'te hazırlandı. Çözünebilir bir β- (1,3) (1,6) -glikan olan maitake D-fraksiyonunun antitümör aktiviteye sahip olduğunu buldular. 1998'de ABD Gıda ve İlaç Dairesi (FDA), maitake MD fraksiyonunun bir kanser inhibitörü olarak etkinliğini test etmek için bir faz II denemesini onayladı (Zhou ve diğerleri , 2012). Zhang vd . (2000), yüksek konsantrasyonlarda (500 μg / mL), maitake'den elde edilen ham özütlerin K562, Jurkat ve SW620 üzerinde önemli inhibisyon gösterdiğini ve in vitro olarak MCF7 ve LS180 üzerinde belirgin bir inhibisyona sahip olmadığını bildirdi . Ayrıca, diğer bilim adamları ayrıca Grifola frondosa'dan GFP ve diğer polisakkaritlerin aşağıda gösterildiği gibi anti-tümör aktivitelerine sahip olduğunu buldular ( Tablo 1 ve Tablo 2)). Tablo 1 ve Tablo 2'de listelendiği gibi, Grifola frondosa meyve gövdelerinden, miselden ve ferment sıvısından elde edilen GFP ve diğer polisakaritler, çeşitli katı tümörler üzerinde önemli inhibisyon gösterdi. Deneysel doz aralığında, artan GFP konsantrasyonu ile inhibisyon oranı arttı ve tümör ağırlığı azaldı. Ham polisakkaritlerin bazen saflaştırılmış fraksiyonlara göre tümörü inhibe etmede daha aktif olduğu bulunmuştur (Wang ve diğerleri , 2003). Son zamanlarda, üç makale Grifola frondosa meyve gövdelerinden gelen polisakkaritlerin anti- hepatoselüler karsinom etkisine sahip olduğunu bildirmiştir (Hu ve diğerleri , 2015; Mao ve diğerleri , 2015; Zhang ve diğerleri , 2016).



    Bağışıklık Düzenleme
    Literatürde, GFP'nin immünomodüle edici aktivitesi esas olarak anti-tümördür. Polisakkaritlerin anti-tümör mekanizması iki yönü içerir. Birincisi, aktif polisakaritlerin sitotoksik aktiviteye sahip olması ve Pachymaran veya Acanthopanax polisakkaritleri gibi kanser hücrelerini doğrudan öldürebilmesidir ; ikincisi, bir BRM (biyolojik yanıt değiştirici) olarak aktif polisakaritlerin, konakçı immün fonksiyonunu güçlendirerek tümörü inhibe edebilmesidir (Kodama ve diğerleri , 2004). GFP'nin bağışıklık yetkin hücre aktivitelerini güçlü bir şekilde geliştirdiği konusunda artan bir fikir birliği vardır ( Şekil 3 ). Çok sayıda bağışıklama deneyi, GFP'nin sadece makrofaj fagositozunu önemli ölçüde artırmadığını gösterdi.ve normal farelerin karın boşluğunda fagositik indeks, fakat aynı zamanda farelerde dalak ve timus ağırlık kazanımını teşvik etti ( Tablo 3 ). CTX grubunda, farelerin timus indeksi önemli ölçüde azaldı, bu da farelerin immün fonksiyonunun inhibe edildiğini, özellikle şiddetli hücresel immün baskılamanın, farelerin hayatta kalma oranının azalmasıyla sonuçlandığını düşündürdü. Bununla birlikte, polisakkarit grubunda timus indeksi ve dalak indeksi normal farelerden daha yüksektir, bu da PGF'nin tümör taşıyan farelerin immün fonksiyonunu iyileştirdiğini gösterir. Bunun ötesinde, G. frondosa'dan GFP'nin bağışıklık aktivitelerinin başka göstergeleri vardır ( Tablo 4 ). GFP'nin Leiws taşıyan farelerin NK hücrelerinin aktivitelerini artırabileceği bildirildi (Kodama ve diğerleri , 2002; Laove diğerleri , 1997; Li ve diğerleri , 2013; Yan ve diğerleri , 2010). GFP'nin DTH yanıtını iyileştirebileceği, dalak lenfosit proliferasyonunu artırabileceği ve dalak hücrelerinde antikor oluşumunu ve S180 taşıyan farelerde HCIgM üretimini destekleyebileceği bulunmuştur (Li, 2007; Li ve diğerleri , 2003b; Yan ve ark . , 2010). Çalışmalar ayrıca GFP salımını teşvik doğruladı , IL-1 , IL-2 ve TNF -a S180 engellenmesinde sarkomu polisakaridlerinin mekanizmalardan birini olabilir G. Frondosa (Hou ve arkadaşları , 2007;. Xia ve arkadaşları ., 2005; Zhao ve diğerleri., 2011). Ek olarak, Matsui ve ark . (2001), hücresel bağışıklığa uygun hücrelerin aktivasyonunun yanı sıra, D-Fraksiyonunun ayrıca bir anti-tümör etki fonksiyonuna sahip olduğunu öne sürmüştür.


    Ek olarak, formaldehite maruz kalan farelerle karşılaştırıldığında, orta doz ve yüksek doz G. frondosa polisakkarit gruplarında kan lenfosit sayısı artmıştır . G. frondosa polisakkaritleri, formaldehite maruz kalan farelerde lenfositler üzerinde koruyucu bir etkiye sahipti (Zhang ve diğerleri , 2010). Bir çalışmadan elde edilen sonuçlar, GFP'nin Newcastle hastalığı virüsü (NDV) enfeksiyonuna karşı koruyucu etkilerinin IFN sistemi tarafından aracılık edilebileceğini ileri sürdü (Xiang ve diğerleri , 1995). Lei vd . (2013), GFP'nin dalak eksikliğinden kaynaklanan azalmış CD 4+ / CD 8+ T hücre oranını iyileştirdiğini veTh1 ila Th2 ve dalak eksikliği sendromunun semptomlarını hafifletti. Tip 2 diyabet tedavisi üzerine yapılan bir çalışmada , GFP, dalak hücrelerinin çoğalması ve IL-2 salınımı ile kendini gösteren bağışıklık düzenleyici etkileri, kontrol grubuna kıyasla gösterdi (Ge ve diğerleri , 2008). GFP'nin, 60 Co-y'ye maruz kalan farelerde önemli bir anti-radyasyon etkisi ve bağışıklık düzenlemesi gösterdiği bulunmuştur (Wang, 2003; Yan ve diğerleri , 2010).



    Karaciğer koruması
    Alkolik karaciğer hastalığı , ilaca bağlı hepatit ve diğer karaciğer hastalıkları yaygındır ve insidans oranları artmaktadır. Ancak şimdiye kadar, etkili ilaçların bulunması zordu. Karaciğer hasarının önlenmesine ve tedavisine yönelik ilaçlar, klinik uygulama için önemli değere sahiptir (Li ve diğerleri , 2010; Wang ve diğerleri , 2010). Karaciğer hasarı, şiddetli karaciğer hastalığı oluşumu, gelişimi ve nihayetinde karaciğer yetmezliği için bağlantılar ve yollar başlatıyor (Cao ve diğerleri , 2010). Özellikle GFP'nin, ALT ve AST'de önemli bir artış olmaksızın kan MDA ve TG seviyelerini düşürebildiği bulunmuştur, bu da GFP'nin farelerde alkolik oksidatif hasar üzerinde koruyucu etkiye sahip olduğunu göstermektedir (Wu ve ark ., 2002; Zhou ve ark.., 2002). Bu fenomen, etanolün oksidasyonu zayıf olduğu için, sadece membranda lipid peroksidasyonuna neden olması ve sitoplazmadan transaminaz sızıntısı derecesine ulaşmaması olabilir (Wu ve diğerleri , 2002). Cao vd . (2010), GFP'nin karaciğer dokusunda ALT, AST, LDH (laktat dehidrojenaz) ve MDA'nın serum aktivitelerini azaltabileceğini, ancak CCl 4'ün neden olduğu akut karaciğer hasarı olan farelerde katalazın serum aktivitelerini artırabileceğini belirtti ve GFP'nin koruyucu olduğunu gösterdi. akut karaciğer hasarı olan fareler üzerindeki etkisi. CCl 4 ile karşılaştırıldığında L-02 hücre modelinde- tedavi edilen grup, PGF, L-02'nin bağıl sağkalımını iyileştirdi, AST ve ALT'ın ortamdaki aktivitelerini düşürdü, MDA'nın yükselmesini engelledi, yüksek SOD seviyesini korudu, mitokondriyal membran potansiyelinin azalmasını ve konsantrasyonun artmasını engelledi Ca2 + , Bcl-2 ekspresyonunu yukarı ve Bax ekspresyonunu aşağı regüle etti. PGF, L-02 hücrelerini CCl 4'ün neden olduğu hasardan önemli ölçüde önleyebilir ve etkisinin mekanizması, serbest radikalleri süpürme, hücre içi kalsiyum aşırı yüklenmesini inhibe etme, mitokondriyal membran potansiyelini stabilize etme ve Bcl-2 ve Bax proteinlerinin ekspresyonlarını düzenleme ile ilgili olabilir. (Li ve diğerleri , 2010; Wang ve diğerleri , 2010). Ancak Zhang ve ark.. (2014), Grifola frondosa'nın farelerde metabolik ve biyokimyasal göstergeler üzerinde önemli bir etkisi olmadığını buldu . Bu fenomen, farklı çalışmalarda kullanılan farklı modellerden kaynaklanıyor olabilir ( Tablo 5 ).

    GFP, kan lipitlerini, kan şekeri seviyelerini düzenleyebilir ve yağ metabolizmasını ve kilo kaybını iyileştirebilir.
    Anti-diyabetik aktivite
    Diyabet , yaygın bir metabolik bozukluktur . İnsülin enjeksiyonlarına ek olarak, sülfonilüre ve biguanid benzeri hipoglisemik ilaçlar diyabeti oral uygulama yoluyla tedavi eder. Bununla birlikte, bu kimyasal ilaçların önemli yan etkileri vardır; yan etkisi olmayan veya düşük düzeyde yan etkisi olan anti-diyabetik ilaçların aktif olarak araştırılması zorunludur (Gu ve ark ., 2010). Birden fazla deney, maitake'den gelen polisakkaritlerin kan şekeri seviyesini düşürebileceğini göstermiştir (Kubo ve diğerleri , 1994; Ma ve diğerleri , 2014; Preuss ve diğerleri , 2007; 2012). Ma ve diğerleri. (2007), maitake'den MT-α-glukanın Kkay fareleri üzerinde anti-diyabetik bir etkiye sahip olduğunu gösterdi. Mekanizma, MT-α-glukanın glikoz metabolizmasıyla ilgili enzimleri etkilemesi, pankreas ve pankreas adacık hücrelerini koruması ve insülin duyarlılığını iyileştirmek ve insülin direncinin rolünü azaltmak için hedeflenen hücre zarındaki insülin reseptörlerinin sayısını artırması olabilir . Ge vd . (2008), maitake'den elde edilen polisakkaritlerin, Kkay fareleri ve streptozotosin ile indüklenen 2-diyabet fareleri üzerinde kan şekeri seviyesini düşürmede etkili olduğunu ve 2 diyabet tedavisi için bir ilaç haline gelme potansiyeline sahip olduğunu belirtmiştir. GFP'nin alloksan kaynaklı diyabetik farelerde açlık kan şekerini azaltabileceği ve diyabetik farelerde şeker toleransını artırabileceği bulundu (Cao ve ark.., 2009; Zhou ve diğerleri , 2009). Lei vd . (2010), MT-α-glukanın hipoglisemik bir etkiye sahip olduğunu gözlemlemiştir; bu, α -glukozidaz aktivitesi üzerindeki inhibitör etkisiyle ilişkili olabilir . Daha fazla ayrıntı Tablo 6'da gösterilmektedir .

    Anti-hipertansif aktivite
    Tablo 5.
    Tablo 5 . Karaciğer hasarı olan farelerde GFP'nin farklı karaciğer göstergeleri üzerindeki etkisi.
    Hipertansiyon , genellikle kalp lezyonuna, böbrek rahatsızlıklarına ve diğer hayati organ bozukluklarına neden olan, kan basıncında sürekli yükselmenin ana tezahürü olan kronik bir hastalıktır. Hipertansiyon ilaçlarının güvenliği ve yan etkileri önemli bir konu haline gelmiştir. 2007 yılında araştırmacılar, 37 gün boyunca spontan hipertansiyonlu Wistar erkek sıçanları besleyen bir maitake toz besleme sistemi kullandılar ve vücut ağırlığı, kan basıncı ve toplam kolesterol ve trigliserit düzeylerinin düştüğünü buldular (Wu, 2007). 2009 yılında, üç GFP'nin anestezik yüksek tuz kaynaklı hipertansif SD sıçanın LVSP ve LVEDP ± dp / dtmax (sol ventrikül maksimum değişim oranı) gibi kardiyak hemodinamik indekslerini düşürdüğü, GFP'nin hemodinamiği etkileyebileceğini gösteren kan basıncını düşürmek ve kalbi korumak (Nivd ., 2009). Ek olarak, Zhang ve ark . (2013), farklı dozlardaki GFP'nin anti-hipertansif aktiviteye sahip olduğunu ve yüksek tansiyonun neden olduğu kalp ve böbrek rahatsızlıkları üzerinde koruyucu bir etkiye sahip olduğunu bulmuştur. Bu bulgular Tablo 7'de özetlenmiştir .



    Hiperlipidemi, plazmada farklı lipidlerin anormal birikimi olarak ortaya çıkan yaygın bir metabolik hastalıktır. Ana lipitler arasında kolesterol ve trigliseritler bulunur. Yüksek serum kolesterol seviyeleri, yüksek LDL -C seviyeleri ve düşük HDL-C seviyeleri ile çeşitli hiperlipidemi ve kardiyovasküler hastalıkları kolayca indükler . Ayrıca, cHDL-C: cTC oranı artmıştır, bu da ateroskleroz üzerinde önleyici etkilere yol açmaktadır (Yang ve diğerleri , 2009). 2008 yılında, apolipoprotein E eksikliği olan farelerde yenilebilir mantar Grifola frondosa'nın (Maitake) kısmen serum TC konsantrasyonlarını düşürerek anti-aterosklerotik etkisi araştırılmıştır (Mori ve ark.., 2008). Yuan ve ark . (2003), incelenen dozlar aralığında, GFL'nin fermente sıvısı ve saflaştırılmış hücre dışı polisakkaridi (GIP), yüksek yağlı diyetle indüklenen hiperkolesterolemik KM fareleri üzerinde dikkate değer hipolipidemik etkiler gösterdi. Ayrıca, S-GAP, fare kanı lipidemik profili üzerinde kayda değer düzenleyici etki gösterdi. Yang ve arkadaşları tarafından yapılan bir çalışmada, yüksek yağlı diyetle indüklenen hiperkolesterolemik KM fareleri, 50 mg / kg / gün dozunda başarıyla tedavi edildi. (2009) ( Tablo 8 ).
    Son yıllarda, tümörlerin tedavisinde artan radyoaktif kontaminasyon ve radyasyon tedavisine bağlı yan etkilerle birlikte koruyucu bir anti-radyasyon ajanı aramak gerekmektedir. Wang vd . (2002), C-GLP ve P-GLP'nin radyasyondan korunmada çok önemli bir role sahip olduğunu ve C-GLP'nin P-GLP'den daha önemli olduğunu bulmuştur. Jin vd. (2003), GFP'nin 8Gy 60 Co-ile yayılan KM farelerinde beyaz kan hücrelerinin sayısının iyileşmesini önemli ölçüde desteklediğini ve hayatta kalma oranını ve hayatta kalma süresini arttırdığını gösterdi. Bu sonuçlar, maitake'nin hücre içi polisakkaritlerinin bir anti-radyasyon etkisine sahip olduğunu gösterdi. Wang (2003), kemik iliğinin 30 günlük sağkalım oranı ve DNA içeriğininDozaj aşıldığında artış, 200 mg / kg / gün -1 GFP anti-radyasyon etkileri olduğunu göstermektedir. Yan vd . (2010), maitake polisakkaridinin hücre aracılı ve humoral immün fonksiyonları ve spesifik olmayan immün fonksiyonu iyileştirebileceğini ve fareleri radyasyon yaralanmalarından koruyabileceğini belirtmiştir ( Tablo 9 ).Araştırmacılar, GFP'nin HIV'i inhibe edebileceğini , vücudun HIV ile savaşması için bağışıklık sistemini uyardığını ve vücudun hastalığın tekrarına direnme yeteneğini geliştirebileceğini bildirdiler (Zhao, 1993; Mao ve diğerleri , 2003). Maitake'den gelen polisakkaritlerin , vücudun bağışıklık sistemini artırarak Influenza virüsü ve Herpes simplex I virüsü üzerinde terapötik etkilere sahip olduğu bulunmuştur (Wang ve diğerleri , 2012; Xiao ve diğerleri , 1995). Gu vd . (2006), Grifola frondosa'dan elde edilen D-fraksiyonunun IFN ile kombinasyon halinde, kronik hepatit B virüsü ( HBV) HepG2 2.2.15 hücrelerinde (2.2.15 hücre) ve IFN ve D-fraksiyonunun kombinasyonunun deneysel hayvan modellerinde HBV enfeksiyonlarının tedavisi için daha fazla test edilmesi gerektiğini önerdi. Araştırma grupları, maitake özütünün fareleri mide mukozal hasarından koruyabileceğini keşfetti (He ve diğerleri , 2011; Huang ve diğerleri , 2016; Zeng ve diğerleri , 2007). Bazı araştırma sonuçları, Griflola frondosa polisakkaritlerinin , peroksit radikali ve hidroksil radikal temizleme yeteneklerinin gösterdiği gibi antioksidan özellikler gösterdiğini göstermiştir (Cao ve diğerleri , 2014; Chen ve diğerleri , 2012; Du ve diğerleri , 2003; Gu ve diğerleri , 2012; Live diğerleri , 2003a; Zhou ve diğerleri , 2011). Ayrıca araştırmacılar, Grifola frondosa kaynaklı polisakkaritlerin farelerde akut hemorajik anemi üzerinde terapötik etkileri (Wen ve diğerleri , 2006), Grifolaβ-glukan yoluyla anti-inflamatuar ve analjezik etkiler (Zhang ve diğerleri , 2009), anti-yorgunluk etkileri olduğunu bildirdi . (Wang ve diğerleri , 2013) ve Grifola frondosa'dan su ekstraktlarının Bacillus subtilis , Escherichia coli ve Staphylococcus aureus üzerindeki antibakteriyel aktiviteleri (Chai ve diğerleri , 2014). Grifola frondosa olduğu bulundu.İnce partikül madde (SRM2786) tarafından indüklenen insan bronşiyal epitel (16HBE) hücre hasarı üzerinde koruyucu etkilere sahip olan D fraksiyonu (Ru vd ., 2016; Xiong vd ., 2016).




    Toksikolojik Deneyler
    Tablo 9 . GFP'nin 60Co-y ile yayılan fareler üzerindeki etkisi.
    Maitake, aktif polisakkaritlerin güçlü bir güvenlik profili ile düşük toksisiteye sahip olduğu toksik olmayan yenilebilir bir mantardır. Akut toksisite testlerinde, fermantasyon sıvısından maksimum güvenli maitake polisakkarit dozu farelerde 3 g / kg'dır (Zheng ve diğerleri , 2001). Fare organlarında hiçbir toksisite tespit edilmedi (Xu ve diğerleri , 1999a). Wang vd . (2010), miselyumdan ekstrakte edilen β-glukanın, farelerde genotoksik etkiler ve büyüme üzerinde olumsuz etkiler olmaksızın toksik olmayan bir materyal olduğunu bulmuştur. Fareler üzerinde yapılan bir başka çalışma, maitake β-glukanın fareler üzerinde mutajenik etkisi olmadığını ve erkek farelerin germ hücreleri üzerinde toksik etkisi olmadığını kanıtladı (Wang ve ark.., 2008). Randomize bir çalışmada, polisakkarit kullanan 28 sağlıklı hastada, yüksek düzeyde bir güvenlik olduğunu gösteren belirgin bir fiziksel rahatsızlık ve advers reaksiyon görülmemiştir (Glauco ve diğerleri , 2004). Başka bir çalışmada, meme kanserinden kurtulanların bu faz I / II denemesinde çalışma süresi boyunca hiçbir ciddi yan etki gözlenmedi . Günde 10 mg / kg'a kadar doz sınırlayıcı toksisite yaşanmadı (Deng ve diğerleri , 2009).

    Sonuç
    Bir biyolojik yanıt değiştirici olan GFP'nin biyolojik işlevlerinin, bağışıklık düzenleme, anti-tümör, anti-yaşlanma, antivirüs ve kan lipid aktivitelerini azaltmayı içerdiğini doğrulayan çok sayıda çalışma var. Özellikle, iki ana biyolojik aktivitesi, immünomodülatör ve antitümör aktiviteleri iyi bir şekilde belgelenmiştir ve klinik ve terapötik faydaları tanımlanmıştır (Konno, 2009). Bununla birlikte, bu derleme için elde edilen makalelerde, çalışmaların çoğu kültürlenmiş hücreler ve hayvan modellerinde gerçekleştirilen preklinik çalışmalardır. Bu bulgular, hastalar üzerinde yapılan klinik çalışmalarla doğrulanmalıdır. Bir dereceye kadar polisakkaritlerin yapısı biyolojik aktivitelerini belirler. Daha iyi arıtma metodolojileri ve gelecekteki çalışmalarda etki mekanizmalarını daha iyi anlayarak,

    Sorumlu Yazar
    1. Lijuan Zhang, MD, Ph.D., Serebrovasküler Hastalıklar Enstitüsü, Qingdao Üniversitesi Bağlı Hastanesi, Qingdao, Shandong 266003, Çin.
    2. Yazar: Yanli He, Serebrovasküler Hastalıklar Enstitüsü, Qingdao Üniversitesi Bağlı Hastanesi,Adres: Qingdao, Shandong, 266003, Çin
    3. Eser sahibi: Xiulian Li, Kurum: Serebrovasküler Hastalıklar Enstitüsü, Qingdao Üniversitesi Bağlı Hastanesi,Adres: Qingdao, Shandong, 266003, Çin
    4. Eser sahibi: Cui Hao, Kurumu: Serebrovasküler Hastalıklar Enstitüsü, Qingdao Üniversitesi Bağlı Hastanesi, Adres: Qingdao, Shandong, 266003, Çin
    5. Pengjiao Zeng, Kurumu: Serebrovasküler Hastalıklar Enstitüsü, Qingdao Üniversitesi Bağlı Hastanesi,Adres: Qingdao, Shandong, 266003, Çin
    6. Meng Zhang, Kurum: Serebrovasküler Hastalıklar Enstitüsü, Qingdao Üniversitesi Bağlı Hastanesi, Adres: Qingdao, Shandong, 266003, Çin
    7. Yong Liu, Kurumu: Nanjing Drum Tower Hastanesi, Laboratuvar Tıbbı Bölümü, Nanjing Üniversitesi Tıp Fakültesi, Adres: Nanjing, Jiangsu, 210008, Çin
    8. Yajing Chang, Adres: Qingdao, Shandong, 266003, Çin Kurum: Serebrovasküler Hastalıklar Enstitüsü, Qingdao Üniversitesi Bağlı Hastanesi
    9. Lijuan Zhang, Enstitüsü: Serebrovasküler Hastalıklar Enstitüsü, Qingdao Üniversitesi Bağlastanesi, Adres: Qingdao, Shandong, 266003, Çin

    Maitake Mantarı (Grifola Frondosa) adını 'dans eden mantar' anlamına gelen Maitake'den alan bu mantar doğu tıbbında bağışıklık sistemi üzerine olan olumlu etkileriyle tanınır. Maitake mantarının kansere yönelik yardımcı bir etki gösterdiği ve yayılmasını engellemeye destek olduğu kabul görmektedir. Maitake mantarları en çok kayın ve meşe gibi ağaçların köklerine yakın ve üst üste binen yelpaze şeklinde koloniler halinde büyürler. 1980’lerde Grifola frondosa kültüründe kütük ve talaş kültürleri en çok kullanılan kültür olmuş, bunlarda pirinç kepeği, buğday kepeği gibi maddeler katkı olarak kullanılmıştır. Uygun şartlar altında aşılama ile meyvelenme arası 70-80 günlük süre gerekmektedir.

    Grifola frondosa’nın orijini Japonya’dır. Büyük ölçekte üretimi 1981 yılında Japonya’da başlamıştır. 1993 yılında AIDS hastalığına karşı iyi etkisinin olduğu bildirilmiştir. Japonlar, Maytake mantarını adaptojen olarak vücudun kimyasal dengesini koruması veya yeniden sağlaması için kullanmışlardır. Bilinen az sayıdaki adaptojen besinden biridir. Grifola frondosa özel ve mükemmel tadı olan mantardır. Besince zengindir. Özellikle tıbbi özelliği vardır ki, bu gelecekte tıbbi açıdan önemli bir rol oynayacağını göstermektedir. Bu mantarın sap ve şapkaları tedavi için kullanı*lır. Şeker hastalığı, tansiyon yüksekliği, kolesterol yüksekliği, kilo kaybı, bağı*şıklık sisteminin uyarılması ve kanser tedavisi için kullanılmaktadır. Belirgin bir yan etkisi bulunmamaktadır.

    Dünyada en yaygın kullanım alanı, AİDS, kanser tedavisi ve bağışıklık sis*teminin uyarılmasıdır. Maitake mantarının kemik iliğini uyardığı ve dokso-rubisin isimli ilacın yan etkisini azalttığı gösterilmiştir. Yapılan küçük klinik çalışmalarda kanser hastalarında yararlı olduğu, bazı hastalarda kanserde ge*rileme olduğu, bağışıklık sistemini uyardığı bildirilmiştir. Maitake mantarının içinde bulunan bazı maddeler meme, mesane (idrar yolları ve idrar torbası) ve kalınbağırsak kanseri hücrelerini öldürmekte, mito-misin C isimli ilacın kanser hücrelerini öldürücü etkisini artırmaktadır. Hayvan çalışmalarında kanserin başka organa sıçrama riskini azalttığı gösterilmiştir. Yapilan arastirmalarda, maitake mantarinin özellikle T hücrelerini, makrofajlari harekete geçirerek vücudun dogal bagisikligini öne çikarabilmektedir.

    Maitekenin fraksiyonları akciğer, kolon, karaciğer, prostat, beyin tümörlerinde büyümeyi yavaşlatmaya destek bir potansiyel olarak görülüyor. Diyabet, kolesterol, hipertansiyon, bağışıklık sistemi için yardımcı olmakla birlikte kilo kaybına karşı destek olarak kullanımı önerilmektedir. Yapılan araştırmalarda maitake mantarinin özellikle T hücrelerini, makrofajlari harekete geçirerek vücudun dogal bagisikligini öne çikarabilmektedir.

    Ayrıca Maitake’nin kemik iliğinde koloni oluşumunu hızlandırdığı, doxorubicin toksisitesini azalttığı ve tümör metastazını inhibe ettiği tespit edilmiştir. Kanserden korunmak için, kanser tedavisinde destek olarak ve kanser kemoterapisinin yan etkilerini azaltmak için yardımcı olarak kullanılabilir.

    Neden Maitake Mantarı Tüketilmelidir?

    • Maitake mantarları ve onlardan hazırlanan maitake D-fraksiyonu, beta glukan denen bir çeşit polisakkarit içerir. Polisakkarit, daha küçük şeker moleküllerince oluşturulan büyük ve karmaşık bir moleküldür. Beta glukan’ların, bağışıklık sistemini uyardığı ve kanser hastalığına saldıran; makrofaj, T-hücreleri, doğal öldürücü hücreler ve interleukin-1 ve -2’nin de dahil olduğu belirli hücreleri ve proteinleri aktive ettiğine inanılmaktadır.

    1990′larda Amerikalı etnobotanist Douglas Schar maitake mantarını bağışıklık sistemini güçlendirici bir besin takviyesi olarak tanımladı ve kliniğinde AIDS ve hepatit hastalarında kullanmaya başladı.

    New York Tıp Okulu ‘ndaki bilim adamları, androjenden bağımsız prostatik kanser hücreleri üzerinde; maitake mantarından çıkarılmış beta-glukanların olası sitotoksik etkilerini incelediler. ‘Moleküler Üroloji‘nin 2000 bahar sayısında yayınlanan sonuçlar, polisakkarit beta-glukan’ın apoptosis’e; ya da hücre intiharına yönlendirerek, prostat kanseri hücrelerini öldürme yeteneğine sahip olduğu yolundaydı.

    2003 yılında, Tıbbi Besin Gazetesi’nde yayınlanan insan klinik çalışmada, 10 kanser hastasına, 63 ay boyunca, günlük dozlarla maitake verilmiştir. Yazarlara göre, maitake; metastatik süreci engellemiş, tümör belirteçle göstergesi azalmış, ve muayene edilen tün hastaların NK hücre (MAKROFAJ) aktivitesi çoğalmıştır.

    • Maitake ile ilgili Çinde yapılan bir klinik çalışmada mesane kanseri ameliyatı sonrasındaki nüks oranının %33 ile %65 arasında azalmasını sağlamıştır.

    • Toz haldeki maitake ve maitake özü kombinasyonunun kullanıldığı bir çalışmada karaciğer kanseri hastalarının %58, akciğer kanserli hastaların %63, meme kanseri hastalarının %69′unda tümör regresyonu veya semptomlarında anlamlı bir düzelme olduğu ‘Principles & Practice of Pediatric Oncology‘ adlı kitapta belirtilmiştir.

    • George Mason Üniversitesi, bağışıklığı canlandırıcı bir ajan olan beta-glukan’ın oral uygulamasının, monoklonal antikorların (ya da mAb) anti-tümör etkilerini geliştirdiğini rapor etmiştir. Kanser hücreleri, makrofaj ve yardımcı T-hücreleri gibi bağışıklık hücrelerinin saldırılarına karşı dirençli hale gelebilir. Rituksimab gibi monoklonal antikorlar, vücut içindeki kanser hücrelerini tanımlamak ve imha etmek üzere etiketlemek için, vücudun bağışıklık sistemine yardımcı olurlar.

    • Amerika’da yapılan bir çalışmada Agaricus bisporus, Pleurotus ostreatus ve maitake mantarının meme kanseri hücrelerine karşı etkisi incelenmiş; maitakenin meme kanseri hücrelerinin çoğalmasını engellediği, kanser dokusunun küçülmesini sağladığı ve de diğer mantarlardan daha etkili olduğu tespit edilmiştir.

    2008 yılında Amerikan Kanser Birliği’nce rapor edilen çalışmalar, maitake D-fraksiyon’unun enjekte edilebilir formunun, insanın bağışıklık sistemini geliştirdiğine ve göğüs kanseri hücrelerinin implant edildiği farelerde tümör yayılımını baskıladığına, ve ikisi birden, hem yeni tümörlerin oluşmasını; hem de karaciğer kanser hücreleri ile implante edilmiş farelerdeki tümör yayılımını baskıladığını rapor etmiştir.

    • Uluslararsı İmmünofarmakoloji Bülteni Eylül 2009 sayısında yayınlanana bir çalışmaya göre, maitake mantarları, kanser tedavisi sırasında bağışıklık sistemini harekete geçirmekte etkiliydi. Çalışma, maitake ekstresinin, kök hücre üretimini çoğaltan hormonun üretimini canlandırdığını gösterdi. Maitake aynı zamanda, bir cins beyaz kan hücresi olan granülositlerin sayısını da arttırıyor, bağışıklık hücrelerinin, kemik iliklerinden, dolaşımdaki kana ikmalini sağlıyor gibi görünmekteydi.

    Kanser, İmmünoloji, İmmünoterapi dergisi Ekim 2010 sayısında yayınlanan bir Japon çalışmasına göre, Kolon kanseri, maitake mantarı tarafından büyük ölçüde inhibe ediliyordu. Maitake Z-fraksiyonu olarak bilinen maitake mantarına has eşsiz bir polisakkarit molekülü, hücresel bağışıklığı arttırıyor ve tümörün büyümesini baskılıyordu.

    Japonya Ulusal Kanser Merkezi’nce yapılan araştırmada, maitake, shiitake ve reishi mantarlarının özleriyle beslenen ve önceden kanser başlatılmış hayvanların yaklaşık olarak %80′inde tümörler bütünüyle yok olmuştur. Buradaki en güçlü etkinin de maitake mantarından kaynaklandığı düşünülüyor.

    • Araştırmacılar Maitake D-fraction denilen maitake türünün, tümörlerin büyümesini engelleme konusunda %45′e karşı %yüzde 80 oranında daha etkili olduğunu belirtiyorlar.

    • Maitake mantarı ağızdan alındığında bile tümör büyümesini engelleme konusunda güçlü bir antikanser aktivite göstermektedir. Maitake mantarından elde edilen D-fraction maddesinin, enjeksiyon ya da oral şekilde alımının tümör gelişimini engellediği araştırma raporlarında ifade edilmiştir.
    Konu mert tarafından (https://bitkiseltedavi.net/vb5/member/685-mert Saat 05 Nisan 2021, 14:21 ) değiştirilmiştir.

  • #2
    Maitake ( Grifola frondosa ) Parçacık Boyutlarının İnsan Mezenkimal Kök Hücreleri Üzerindeki Etkisi ve Bunların Terapötik Potansiyelinin İn Vivo Değerlendirilmesi
    Dinesh K. Patel , 1 Yu-Ri Seo , 1 Sayan Deb Dutta , 1 Ok Hwan Lee , 2 ve Ki-Taek Lim 1

    Öz
    Maitake ( Grifola frondosa ) mantarı, yüksek besin değerleri nedeniyle besin takviyesi olarak büyük ilgi görmüştür. G. frondosa mantarlarının partikül boyutları, bir sınıflandırma değirmeni tarafından izlendi. β -Glukanlar, mantarın biyoaktif bileşenidir ve Fourier transform kızılötesi spektroskopisi (FTIR), proton ve karbon nükleer manyetik rezonans ( 1 H ve 13 C-NMR), matris destekli lazer desorpsiyonu / iyonizasyonu ve zaman yoluyla ortaya çıkarılmıştır. -of-uçuş (MALDI-TOF) spektrometresi. G. frondosa'nın biyouyumluluğupartiküllerin yanı sıra hMSC'lerin indüklenen osteogenezi, sırasıyla WST-1 deneyi ve alizarin boyama (ARS) tekniği ile değerlendirildi. Özellikle, G. frondosa varlığında artmış hücre canlılığı kaydedildi . G. frondosa ile hMSC'lerde önemli ölçüde gelişmiş kalsiyum birikimi gözlemlenmiştir , bu da mineralizasyon potansiyellerini düşündürmektedir. G. frondosa varlığında osteojenik ilgili gen belirteçlerinin ekspresyonu, gerçek zamanlı polimeraz zincir reaksiyonu (qPCR) tekniği ile incelenmiştir. G. frondosa partiküllerinin varlığında osteojenik gen markörlerinin yukarı regülasyonu, üstün osteojenik potansiyellerini gösteriyordu. Ayrıca, G. frondosaAyrıca, doku mühendisliği uygulamaları için potansiyellerini gösteren hMSC'lerden çeşitli protein türlerinin salgılanmasını aktive etti. G. frondosa varlığında sıçan serumunda farklı immünoglobulinlerin artmış sekresyonu gözlemlendi , bu da bunların terapötik doğasını daha da ortaya koydu. Bu nedenle G. frondosa , gelişmiş osteogenez için etkilidir ve doğal, yenilebilir ve osteojenik bir ajan olarak kullanılabilir.

    1. Giriş
    Fungi krallığının bir üyesi olan Mantar, anti-enflamatuar, antimikrobiyal, antidiyabetik, kardiyovasküler koruyucu, hepatoprotektif ve antikanser özellikleri nedeniyle biyomedikal uygulamalar için önemli miktarda ilgi çekmiştir. Mantarların fagositik aktiviteyi aktive ederek çeşitli yollarla bağışıklık sisteminin yanı sıra makrofajlar, T hücreleri, dendritik hücreler (DC), doğal öldürücü (NK) hücreler ve hematopoetik kök hücre aktivitelerini de düzenleme etkinliğine sahip olduğu bilinmektedir. reaktif oksijen türlerinin oluşumu, inflamatuar aracılar ve sitokin üretimi [ 1 - 4 ]. Sitokinler, hücre farklılaşması, proliferasyon, apoptoz, enflamatuar reaksiyonlar ve ayrıca immün yanıtlar yoluyla bireyin homeostazının düzenlenmesinde kritik roller oynar [5 ]. Maitake mantarı ( Grifola frondosa ) Japonya'da popüler bir yenilebilir mantardır ve aynı zamanda orman tavuğu, koyun başı ve koç başı olarak da bilinir [ 6 ]. Mantarlar zengin protein, lif ve vitamin kaynağıdır ve yenilebilir ve tıbbi mantarlar arasında ayrım yapmak kolay değildir çünkü birçok yenilebilir mantar tedavi edici özelliklere sahiptir ve birçok tıbbi mantar da yenilebilir [ 7 - 9 ]. Kitin ve β -glucans mushroom hücre duvarının iki temel bileşenleridir; ve bunun dışında, β- glukanlar (1 ⟶ 3), β (1 ⟶ 4) ve β (1 ⟶ 6) mantarları terapötik ajan olarak kullanılacak hayati bir materyal haline getirir [10 - 12 ]. Ayrıca mantarların yapılarında polisakkaritler, polisakkarit-protein kompleksleri, polifenoller, terpenoidler, agaritin, ergosterol ve selenyum da bulunur [ 13 , 14 ]. Glukanlar, çok sayıda glikoz biriminin birbirine farklı şekilde bağlandığı heterojen polisakkaritlerdir. β -Çeşitli kaynaklardan türetilen glukanlar, yapılarında biyolojik aktiviteyi etkileyen çeşitli derecelerde dallanma, dal bağlantısı ve omurga bağlantısına sahiptir. Nedenle, ve karakterize edilmesidir tanımlamak için gerekli olan β daha iyi bir terapötik ve bağışıklık uyarıcı faaliyetleri [ile -glucans 15 ]. Glukanların enfeksiyonlara ve kansere karşı savunma reaksiyonlarını uyardığı görülmüştür [16 , 17 ]. Bunun yanı sıra, stres ve kolesterol düzeyi, hipoglisemik etkiler, ve ülseratif kolit gelişmeler azaltılması da glukanların [varlığında gözlenmiştir 18 - 21 ]. Ayrıca proinflamatuar sitokinler olarak bilinen tümör nekroz faktörü- α (TNF- α ), interlökin-6 (IL-6, IL-1) ve interferon- γ (IFN- γ ) üretimi de varlığında gözlendi. ve β makrofaj hücreleri [etkinleştirerek -glucans 22 , 23 ].

    Çalışma, G. frondosa'nın farklı partikül boyutlarının insan mezenkimal kök hücreleri ( hMSC'ler) üzerindeki etkilerini hücre canlılığı, mineralizasyon, osteogenez ve immünoglobulin sekresyonu açısından değerlendirmeyi amaçladı . Β -glukan etanol ekstresi baş olarak mevcuttu G. Frondosa ve FTIR vasıtasıyla karakterize edildi 1 H-NMR, 13 C-NMR, ve MALDI-TOF spektrometresi. G. frondosa partikülleri tarafından hMSC'lere doğru biyolojik uyumluluklarını gösteren hiçbir yan etki gösterilmemiştir . HMSC'lerin aktivitesi , çeşitli uygulamalar için uygun bir G. frondosa partikül boyutu dikkate alınarak kolayca ayarlanabilir .

    2. Malzemeler ve Yöntemler
    2.1. Ultra İnce Zemin Malzemelerinin Hazırlanması
    Çok ince öğütülmüş mantar tozları ( Grifola frondosa , Kore Cumhuriyeti) hava sınıflandırma değirmeni (ACM-AL, Daega, Kore Cumhuriyeti) ile elde edildi. Mantar örnekleri, hava sınıflandırmalı öğütme makinesinde yüksek hızda dönen bir pervane ile toz haline getirildi. İşlemde besleme kütlesi 13 kg'da sabit tutuldu ve dönme hızı 3600 g'a ayarlandı. Ultra ince öğütülmüş mantarlar, bir sınıflandırıcı analiz yazılımı (Mastersizer S v3.10, Malvern, İngiltere) aracılığıyla analiz edildi. Mantar tozu üç parçacık boyutu (10-20, 20-30, ve 30-40 paylarına ayrılan  μ m, sırasıyla).

    2.2. Β -Glukanın Ekstraksiyonu ve Yapısal Karakterizasyonu
    G'den β- glukan ekstraksiyonu . frondosa , daha önce başka bir yerde tarif edildiği gibi başka bir yenilebilir mantardan yapılmıştır [ 24 ]. Kısaca, In G . Frondosaparçacıklar 48 saat 60 ° C'de sıcak hava fırınında kurutuldu, ardından 90 ° C'de 1 saat sürekli mekanik karıştırma ile sulu (% 4 NaOH solüsyonu) işleme tabi tutuldu. Bundan sonra polisakarit, oda sıcaklığında etanol çözeltisi ile çökeltildi ve 4 ° C'de 24 saat inkübe edildi. Çökelti, santrifüj yoluyla (4000 rpm, 30 dakika) ayrıldı ve süpernatan çıkarıldı. Bundan sonra çökelti toplandı ve birkaç kez etanol ve aseton ile yıkandı. Elde edilen malzemeler, küçük çözünür molekülleri 3 gün uzaklaştırmak için selüloz torbası (12000-14000 Da, Cellu Sep, Texas, ABD) ile diyaliz edildi, ardından santrifüjlendi ve dondurularak kurutuldu. Malzemenin verimi ~% 30 (a / a) idi. Çıkarılan materyalin yapısal özellikleri FTIR (Perkin-Elmer, Buckinghamshire, UK),-1 4 sm bir çözünürlükte -1 , 1 Me 'H-NMR ölçümü (600 MHz, FT-NMR ile, Bruker) 2 , SO-D 2 O: 70 ° (6 1, 15 mg / ml) C, matris - destekli lazer biriktirme / iyonizasyon (uçuş süresi) ve MALDI-TOF kütle spektrometresi (Bruker Autoflex hız TOF / TOF) daha önce tarif edildiği gibi [ 25 ]. Ekstrakt yalnızca G'de bulunan P- glukanın kimyasal karakterizasyonu için kullanıldı . frondosa ve diğer çalışma G ile yapıldı . frondosa parçacıkları.

    2.3. Hücre Canlılığı
    Farklı boyutlardaki mantar tozlarının sitotoksisitesini değerlendirmek için hücre canlılığı deneyi yapıldı. İnsan mezenkimal kök hücreleri (hMSC'ler) kemikten (Kore Hücre Hattı Bankası, Kore Cumhuriyeti) alındı ​​ve proliferatif ortam (% 90 Dulbecco'nun modifiye Eagle ortamı (DMEM),% 10 fetal sığır serumu ve% 1 antibiyotikler) ile kültürlendi. . HMSC'ler% 5 CO içeren nemlendirilmiş bir atmosferde 37 ° C'de inkübe edildi 2 istenen zaman dilimleri ile. Hücre canlılığı, WST-1 testi (EZ-Cytox Cell Viability Assay Kit, Daeillab Service Co., Ltd, Kore Cumhuriyeti) aracılığıyla incelenmiştir. Bunun için G'nin farklı partikül boyutları . frondosa (10, 20, 50 ve 100  μg / mL) numuneler, 24 saat boyunca 96 oyuklu plakalarda hMSC'ler ile inkübe edildi. Bundan sonra, numuneler EZ-Cytox ile işleme tabi tutuldu ve çözülebilir formazanı oluşturmak için 4 saat daha inkübe edildi. Oluşturulan formazanın konsantrasyonu, 450 nm'lik (referans değer olarak 625 nm) bir absorbans değerine sahip bir spektrofotometre (Infinite® M Nano 200 Pro; TECAN, İsviçre) ile ölçüldü. Tüm numuneler üç nüsha olarak gerçekleştirildi ve veriler şu adreste verildi:. Numunesiz hücre ortamı bir kontrol olarak ayarlandı.

    2.4. Alkali Fosfataz (ALP) Aktivitesi
    HMSC'ler () 50 ihtiva eden DMEM ortamı içinde kültürlenmiştir  μ gr / ml, askorbik asit, 10 mM β -gliserofosfat, ve 7 gün ALP aktivitesini değerlendirmek için 100 nM deksametazon (Sigma-Aldrich, ABD). Kısaca, hücreler% 10 formalin solüsyonunda (Duksan Chemicals Co., Gyeonggi-do, Kore Cumhuriyeti) sabitlendi, ardından iki kez 1 x PBS ile durulandı. Bu hücreler, 5 dakika boyunca% 0.1 Triton X-100 ile inkübe edildi, ardından üreticinin protokolüne göre Lökosit Alkalin Fosfataz Kiti (Sigma-Aldrich, ABD) ile boyandı. Hücre lizatlarında ALP aktivitesi, 5 mM MgC! İhtiva eden bir deney tamponu içinde bir alt-tabaka olarak para-nitrofenilfosfat (p-NPP) ile reaksiyona sokulması ile belirlendi 2 Na 2 CO 3. Absorbans, absorbans değeri 405 nm olan bir spektrofotometre kullanılarak alındı.

    2.5. RNA Hazırlama ve Gerçek Zamanlı PCR Analizi
    RNA hazırlama ve gerçek zamanlı PCR, grubumuz tarafından daha önce bildirildiği gibi gerçekleştirildi [ 26 ]. Bunun için,hücreler, farklılaşma ortamı altında 7 ve 14 gün boyunca 6 mm'lik bir kültür kabında inkübe edildi. RNeasy Mini Kiti (Qiagen, Valencia, CA, ABD), üreticinin cDNA'yı ters transkriptaz (Superscript II Preamplification System, Invitrogen, Gaithersburg, MD, ABD) yoluyla sentezleme talimatı uyarınca RNA'yı hazırlamak için kullanıldı. Gerçek zamanlı PCR, 95 ° C'de 15 s denatürasyon için 40 döngü ve 60 ° C'de 1 dakika amplifikasyon ile SYBR Green PCR Master Mix (ABI Prism 7500 sekans tespit sistemi; Applied Biosystems, Warrington, UK) ile gerçekleştirildi. ° C. Tüm deneyler, üç nüsha bir şekilde uygulandı ve onu, temizlik geni hipoksantin-guanin fosforibosiltransferaz ( HPRT ) ile normalleştirdi . HMSC'lerdeki göreceli RNA ekspresyon seviyeleri, kontrol veG. frondosa ile muamele edilmiş numuneler bir histogramda karşılaştırılmıştır. ALP , BSP , OPN , OCN , COL1 , OSX ve RUNX2 ekspresyon seviyeleri değerlendirildi. Bu analiz için kullanılan spesifik primer setleri Ek Tablo 1'de verilmiştir .

    2.6. Büyüme Faktörü için Antikor Dizileri
    RayBio ™ insan sitokin dizisi C1 (AAH-CYT-1-2), sitokin ekspresyonunun analizi için Ray Biotech Inc.'den (Norcross, GA, ABD) satın alındı. Bir dizi membran 44 farklı büyüme faktörünü tespit edebilir. Mantar tozlarının farklı partikül boyutlarına sahip hMSC'ler, 100 mm'lik bir kültür plakasına tohumlandı ve 7 ve 14 gün süreyle inkübe edildi. Örneksiz hücre ortamı kontrol olarak kabul edildi. Daha sonra hücreler, 24 saat boyunca serum hücrelerinin etkisini dışlamak için aç bırakıldı. Hücresiz süpernatanlar elde edildi ve insan sitokin dizileri ile analiz edildi. Deney, üreticinin talimatlarına göre gerçekleştirildi. Kısaca, zarlar blokaj tamponu ile bloke edildi ve daha sonra bir gece boyunca 4 ° C'de bir numune ile işlendi. Membranlar daha sonra yıkama tamponu ile yıkandı, ardından biyotinlenmiş bir antikor kokteyli ilave edildi. Membranlar, oda sıcaklığında 2 saat inkübe edildi ve yıkama ile tamamlandı. Elde edilen örnekler HRP-Streptavidin ile oda sıcaklığında 2 saat inkübe edildi. Son olarak, membranlar yeniden yıkandı ve 5 dakika boyunca saptama tamponu ile inkübasyon yoluyla geliştirildi. Membranların kemilüminesansı Chemidoc XRS sistemi (BR170-8265, Bio-Rad, ABD) kullanılarak ölçüldü. Bağıl protein ekspresyonu, sinyal yoğunluklarının karşılaştırılmasıyla elde edildi.

    2.7. In Vivo Çalışması
    Sıçanlar (ICR; erkek, 248.78-249.67 g, altı haftalık) Orient Bio Inc.'den (Seongnam, Kore Cumhuriyeti) alındı. Bu hayvanlar, 10 ° C'lik ortam sıcaklığında iyi yalıtılmış bir odada tutuldu.% 35-65 nem oranında otomatik olarak kontrol edilen 12 saat aydınlık / 12 saat karanlık döngüsü (20: 00'da ışıklar söner) ile deney dönemleri için. Deney hayvanları, kontrol dahil dört gruba ayrıldı. G. frondosa dozu olmayan bir hayvan , kontrol olarak tedavi edildi. Hayvanlar G. frondosa ile tedavi edildi .300 mg / kg oranında. Sıçanların kan serumundaki IgA, IgG ve IgM gibi farklı immünoglobulinlerin sekresyonları, uygulamanın bitiminden sonra ölçüldü. IgA, IgG ve IgM, sırasıyla E-EL-R0516, R0518 ve R0519 içermeyen bir ELISA kiti kullanılarak ölçüldü. Deney süresince deney hayvanlarının vücut ağırlıkları her gün ölçülmüştür. Deney hayvanlarının tüm süreci, Kangwon Ulusal Üniversitesi Hayvan Deneysel Etik Komitesi (Kangwon Ulusal Üniversitesi, KW-170922-1 Kurumsal Hayvan Bakım ve Kullanım Komitesi) tarafından onaylandı.

    2.8. İstatistiksel analiz
    Tüm istatistiksel analizler SPSS Statistics (IBM SPSS Statistics 23, IBM Inc., ABD) kullanılarak yapılmıştır. Kontrol ve tedavi grupları arasındaki istatistiksel anlamlılık, tek yönlü varyans analizi (ANOVA) ile karşılaştırıldı. İstatistiksel anlamlılık kabul edildi.

    3. Sonuçlar ve tartışma
    3.1. Β -Glukanın Yapısal Analizi

    FTIR spektroskopisi, polisakkaritlerin yapısal değerlendirmesinde yaygın olarak kullanılan önemli bir analitik araçtır [ 27 ]. FTIR spektroskopisi, glukanlardaki glikosidik bağların konumu ve anomerik konfigürasyonu ile ilgili yararlı bilgiler sağlar. Mantarların meyve veren yapılarının yapılarında öncelikle dallı (1 ⟶ 3) (1 ⟶ 6) - β -D-glukan ve lineer (1 ⟶ 3) - α -D-glukan içerdiği belirtilmiştir [ 28 ]. Polisakkaritlerin yapısal aydınlatılmasında “şeker bölgesi” (1200-950 cm -1 ) ve “anomerik bölge” (950-750 cm -1 ) önemli özelliklerdir. G. frondosa'dan elde edilen β - glukanın FTIR spektrumu(Şekil 1 ) ' de verilmiştir . 3298 cm '' de absorpsiyon tepe görünümü -1 FTIR spektrumu yapısında (-OH) işlevsel gruplar hidroksil varlığını gösterir. FTIR absorpsiyon piklerinin 1371, 1313, 1077 ve 889 cm- 1 civarında varlığı , yapıdaki β- glukanın özelliklerini açıkça göstermektedir [ 29 ]. 1631 ve 1.536 cm FTIR absorpsiyon tepeleri -1 (II) 'yarımı ekstre malzeme içinde amid (I) ve amid varlığına bağlı idi. 889 cm '' de absorpsiyon tepe -1 - (1 ⟶ 3) karakteristik bir zirvedir β -D-glukan. FTIR sonucu, çıkarılan materyalin esas olarak aşağıdakilerden oluştuğunu açıkça göstermektedir:β -D-glukan.




    Şekil 1

    G. frondosa'dan elde edilen p - glukanın FTIR spektrumu .
    G. frondosa'dan ekstrakte edilen β - glukanın proton NMR spektrumu (Şekil 2 ) ' de verilmiştir . Glukanın anomerik bir proton sinyalinin 4-6 ppm aralığında ortaya çıktığı ve bu pozisyonun yapılarında bulunan kimyasal kısımlardan oldukça etkilendiği iyi bilinmektedir [ 30 ]. ~ 4.89 ve 4.28 ppm'de tepe görünümü 1 'H-NMR spektrumunun mevcudiyetine işaret eden P (1 ⟶ 3) ve - β sırasıyla [çıkarılan malzeme (1 ⟶ 6) -D-glukan proton - 28 , 31 , 32 ]. Ayrıca, β - (1 ⟶ 3) -dallanmış β ' nin dallanma sinyali- (1 ⟶ 6) -D-glukan proton spektrumunda ~ 4,55 ppm'de gözlenir [ 30 ]. 400 MHz 13 C-NMR spektrumu ekstre β -glukan gelen G. Frondosa döteryumlu Me 2 SO ve D 2 O (6: 1) 'de verilmiştir, oda sıcaklığında çözücü (Şekil 3 ). Kimyasal kaymada ( δ ) 101.7 ppm anomerik pikin varlığı , glukanın β- konfigürasyonunu açıkça gösterir . Δ 83.5 ppm'deki sinyal, β değerinde bir C-3 varlığına atanır.- (1 ⟶ 3) -D-glukan yapısı. Diğer karbon sinyallerinin varlığı spektrumda belirlenir. Sonuç, yenilebilir mantardan ekstrakte edilen β- glukanın önceden bildirilen δ değerleri ile iyi bir uyumdur [ 24 ].

    Şekil 2
    Bir 1 H-NMR spektrumu β gelen glükan çıkarılan G. Frondosa varlığını gösteren P (1 ⟶ 3) ve - β - (1 ⟶ 6) -D-glukan kısmı.
    G. frondosa parçacıklarından elde edilen MALDI-TOF kütle spektrumu β -glukan (Şekil 4 ) ' de gösterilmiştir . MALDI-TOF kütle spektrumu , gözlemler daha önce bildirildiği gibi, yaklaşık 162 Da'lık (bir heksoz birimi) moleküler kütle (pikler arasında) boşluğa sahip ekstraktaki β - (1 ⟶ 3) glukan biriminin varlığını açıkça göstermektedir [ 33 , 34]. 2,5-dihidroksibenzoik asit (2, 5-DHB) matrisinin MALDI-TOF kütle spektrometresindeki polisakkarit sinyal yoğunluğunu kolaylaştırdığını fark etmiştir. Bununla birlikte, bazı zirveler arasındaki moleküler boşluğun 162 atomik kütle biriminden (amu) daha yüksek olması ilginçti ve 487 amu idi. Bu, bir heksoz yapısından üç kat daha yüksekti, bu da bazı oligomer birimlerinin varlığını gösterir. özü [ 35 ]. G. frondosa'dan çıkarılan β - glukanın kütle spektrumu, glukanların 679.6 ~ 1977 civarında moleküler ağırlıklara sahip bir glikoz birimleri karışımından oluştuğunu göstermektedir. 1 m / z polimerizasyon derecesi ilemantarlardan ekstrakte edilen daha önce bildirilen glukan değerlerine benzerdir [ 36 ]. Bu sonuçlara dayanarak, sonucuna β -glukan ile heksoz birimlerinden oluşan olan β (1 ⟶ 3) ve - β - (1 ⟶ 6) -D-glukan bağlantısı. Glukanların tahmin edilebilir yapısı, kütle spektrumu içinde sunulmuştur




    Şekil 4

    G. frondosa glukanlarının MALDI-TOF kütle spektrumu, matris olarak 2, 5-DHB kullanılarak.
    3.2. Parçacık Boyutu ve Hücre Canlılığı
    G. frondosa tozunun partikül boyutu analizi, bir hava sınıflandırma değirmeni ile gerçekleştirildi ve sonuç, (Şekil 5 (a) ) 'da verilmektedir. Burada, daha ileri çalışmalar için G. frondosa parçacığının üç farklı boyutunu (10-20, 20-30 ve 30-40  μ m) kullandık . Kullanılan G. frondosa tozunun granülometrik dağılımı Ek Tablo 2'de verilmiştir . Hücresel davranışın, partikül boyutundan, yüzey yükünden ve ayrıca partiküllerdeki kimyasal kısmın kaplanması ve bağlanmasından derinden etkilendiği bilinmektedir [ 37 ]. 20-30'luk farklı konsantrasyonlarda (10, 50 ve 100 μ g / mL)  hMSC'lerin hücre canlılığı verileri μ m boyutu G. Frondosa farklı zaman aralıklarından sonra (Şekil verilmiştir 5 (b) ). G. frondosa partiküllerinin varlığında 1 günlük muameleden sonra daha iyi hücre yaşayabilirliği gözlendi, G. frondosa'nın hMSC'lere karşı biyouyumluluğunu gösterdi . Ayrıca, G. frondosa ile muamele edilmiş ortamda, 5 günlük tedaviden sonra kontrole göre hücre canlılığında bir artış gözlendi , bu da daha iyi biyouyumluluklarını gösteriyor. Bu konsantrasyonlarda arasında, 50  μ diğer g / ml kadar yüksek olur, hücre canlılığı, 50 önerdi  μ g / mL konsantrasyonda hücre aktivitesi için en uygun olanıdır. Üstelik bunlardan 20-30  μG. frondosa'nın m boyutu, diğer boyutlara göre 5 günlük inkübasyondan sonra daha fazla hücre canlılığını desteklemiştir. G. frondosa'nın diğer boyutları (10-20 ve 30-40  μ m) için farklı konsantrasyonlarda ve zaman aralıklarında hücre canlılığı sonuçları Ek Şekil 1'de gösterilmektedir . G. frondosa'nın diğer boyutlarının varlığında hMSC'lerin canlılığı üzerinde hiçbir olumsuz etki kaydedilmemiştir, bu da biyouyumluluklarını göstermektedir. Ancak, hücre canlılığında bir hafif bir azalma 20-30 daha bu örneklerde tespit edildi  μ m boyutu G. Frondosa. Bu, 20-30 μ m boyutundaki G. frondosa'da daha yüksek miktarda β- glukan  varlığına atfedilir.hücrelerin daha iyi büyümesini kolaylaştıran parçacıklar [ 35 ].



    Şekil 5
    (a) G. frondosa toz hava sınıflandırma değirmeninin partikül boyutları analizi ve (b) belirtilen zaman aralıklarında farklı G. frondosa (20-30  μ m) konsantrasyonlarının varlığında hMSC'lerin hücre canlılığı ve ).

    3.3. Mineralizasyon ve Gerçek Zamanlı PCR Analizi
    HMSC'lerin aktivitesinin çevreleyen ortamlardan derinden etkilendiği ve ayrıca uygun koşullar kullanılarak optimize edilebildiği iyi bilinmektedir. Kök hücreler, farklılaşma potansiyelleri nedeniyle doku mühendisliği alanındaki en kritik hücreler olarak kabul edilir. Kök hücreler, osteoblastlar, kondrositler ve adipositler dahil olmak üzere çeşitli diğer hücrelere farklılaştırılabilir [ 38 , 39 ]. HMSC'lerin osteojenik farklılaşması alkalin fosfataz aktivitesi (APA), kalsiyum birikimi ve hücre sayısı ile izlenebilir [ 40 ]. HMSC'ler tarafından çevreleyen ortamda kalsiyum birikimi, alizarin boyama tekniği ile değerlendirildi ve (Şekil 6 (a) ve 6 (b) 'de verilmiştir.). G. frondosa varlığında 7 günlük inkübasyondan sonra önemli ölçüde artmış kalsiyum birikimi gözlemlendi ve bu, 14 günlük inkübasyondan sonra daha da iyileşerek, hMSC'lerin osteojenik farklılaşma potansiyelini düşündürdü. İlginç bir şekilde, 20-30  μ m boyutu G. Frondosa tanecikler biyoaktif yüksek içeriği varlığına inkübasyondan 14 gün sonra, diğer boyutları ile karşılaştırıldığında daha yüksek kalsiyum depozitleri β 20-30 içinde glükan  μ m boyutu G. Frondosa uyarılan hMSC'lerin daha büyük osteogenezi [ 35 ]. 20-30 μ m boyutunda G. frondosa varlığında ALP aktivitesinin kalitatif analizi 7 günlük tedaviden sonra farklı konsantrasyonlarda Ek Şekil 2'de verilmiştir . Materyal içermeyen ortam bir kontrol olarak kabul edildi. Daha yüksek ALP aktivitesi, 50  μ g / mL ile muamele edilmiş ortamda diğerinin yanı sıra kontrole göre kaydedildi, bu da onların üstün osteojenik potansiyelini gösterdi. Kemik oluşumu oldukça karmaşık bir biyolojik süreçtir ve çeşitli osteojenik ilişkili gen belirteçlerinin ekspresyonu ile doğrudan ilişkilidir [ 41 ]. 50 μ varlığında  RUNX2 , OSX , ALP , BSP , OCN , OPN ve COL1 ekspresyon seviyelerini inceledik.20-30 g / mL konsantrasyonda  μ m boyutu G. Frondosa parçacıklar içinde verilmiştir 7 ve 14, tedavi gününe ve sentezleme değerlerden sonra moleküler düzeyde osteojenez işlemi doğrulamak için (Şekil 7 (a) ve 7 (b) ) . Bu çalışmada 50  μ g / mL G. frondosa konsantrasyonlarını aldık çünkü bu konsantrasyonda hücre canlılığı diğer konsantrasyonlardan daha yüksekti. Kontrol için nispi osteojenik gen ekspresyon değeri bu deneyde birdi. Kolajen1 ( COL1 ), kemik matriksinde meydana gelen ve osteoblast hücrelerinin proliferasyonu sırasında oluşan en belirgin proteindir [ 42 ]. İfadesiHMSC'lerden COL1 gen markeri, G. frondosa varlığında kemik hücrelerinin oluşumunu gösterir . Bu ifade potansiyeli, 14 günlük tedaviden sonra kontrole kıyasla daha yüksek osteojenik etkinliklerini ortaya koydu. ALP, hücrelerin farklılaşması sırasında preosteoblastların ve osteoblast hücrelerinin oluşumunu gösteren bir başka önemli gen belirtecidir [ 43 ]. G. frondosa ile muamele edilmiş ortamda ALP aktivitesi, kontrolün üstün osteojenik yeteneklerini gösterdiğinden daha yüksekti. G. frondosa'nın osteojenik farklılaşma kabiliyetini gösteren kontrole göre numune ile işlenmiş ortamdan runt ile ilişkili transkripsiyon x2 ( RUNX2 ) gen markörünün daha yüksek ifadesi .RUNX2 erken bir osteojenik belirteçtir ve osteogenezin RUNX2 ekspresyonu olmadan gerçekleşmediği gözlenmiştir. Hücrelerin osteojenik farklılaşmasını kontrol eder ve ayrıca Cbfal veya AML3 transkripsiyon faktörü olarak adlandırılır [ 44 ]. RUNX2 markörünün ekspresyonunun ve aktivitesinin, diğer transkripsiyon faktörlerinden ve protein-nükleik asit etkileşimlerinin protein-proteininden derinden etkilendiği kaydedilmiştir. Kemik erimesi işlemi, RUNX2 faktörünün aşırı miktarında kolaylaştırılır [ 45]. Kemik sialoprotein (BSP), kemik ve dentinde oluşan "küçük integrin bağlayıcı ligand N-bağlı glikoprotein" (SIBLING) proteini sınıfıdır. Kemik oluşumunda, iyileşmesinde, yeniden şekillenmesinde ve mineralizasyonunda çok önemli bir rol oynarlar [ 46 ]. 7. ve 14 günlük tedaviden sonra G. frondosa varlığında BSP markörünün yukarı regülasyonu, bunların osteojenik yeteneklerini daha da doğrular. OPN ve OSX'in ifadesi de G. frondosa'da daha yüksekti.kontrole göre işlenmiş ortam. OCN, kök hücrelerin osteojenik farklılaşması için bir başka en önemli gen belirtecidir. Maksimum ekspresyonu cevherleşme sırasında meydana gelir ve mineralize kemikler biriktirir. OCN ekspresyonu, kontrole kıyasla numune ile muamele edilmiş durumda yüksekti; bu, 14 günlük tedaviden sonra daha fazla düzenlenmiş, G. frondosa'nın üstün osteojenik potansiyelini açıkça göstermektedir . Bu sonuçlar (mineralizasyon ve PCR verileri) G. frondosa'nın osteojenik yeteneğini doğrulamaktadır ve doku mühendisliğinde osteojenik bir ajan olarak kullanılabilir.



    Şekil 6

    G. frondosa partiküllerinin varlığında hMSC'lerden alizarin boyama tekniği ile kalsiyum birikiminin değerlendirilmesi (a) 7 gün ve (b) 14 günlük inkübasyondan sonra (



    Şekil 7

    Mevcudiyetinde hMSC'ler gelen göreceli gen ekspresyonu G. Frondosa (20-30  μ m), (a) sonra 7 ve (b) tedavi 14 gün ( ve ).

    3.4. Büyüme faktörleri
    İnsülin benzeri büyüme faktörleri (IGF), farklı bağlayıcı proteinleri ile hücre kültürü mikro ortamlarına bağlı olarak hücre büyümesinde, hayatta kalmada ve farklılaşmada hayati rol oynarlar [ 47 ]. İnsan büyüme faktörü dizisi üzerine lekelenmiş protein için antikorların konumunu gösteren bir şablon Ek Tablo 3'te verilmiştir . G. frondosa varlığında hMSC'ler tarafından çeşitli insülin benzeri büyüme faktörleri bağlayan protein (IGFBP) türlerinin salgılanması meydana geldi . IGF'ler, kök hücrelerin hayatta kalma, kendini yenileme ve farklılaşma potansiyelini kontrol edebilen küçük polipeptidlerdir [ 48 ]. G. frondosa içeren veya içermeyen hücresiz süpernatantlarda antikorların salgılanmasımembran yüzeyinde (Şekil 8 (a) ) gösterilmektedir. G. frondosa varlığında membran yüzeyinde kontrole göre daha önemli ve yoğunlaşmış noktalar gözlendi . IGFBP2 ve IGFBP6'nın farklı G. frondosa partiküllerinin varlığında hMSC'ler aracılığıyla salgılanmasına yönelik karşılaştırmalı bir çalışma (Şekil 8 (b) ve 8 (c) ) 'de gösterilmektedir. G. frondosa varlığında daha yüksek miktarda IGFBP2 ve IGFBP6 sekresyonunun meydana geldiği görüldü. Bu IGFBP2 ve IGFBP6 daha yüksek bir miktar 10-20 üzerinde hMSC'ler tarafından salgılanan olduğunu not ilginçti  μ m ve 20-30  μ m boyutunda , G. Frondosasırasıyla. Ayrıca, IGFBP4 salgılaması artan bir miktarı da 20-30 gözlendi  μ m boyutu G. Frondosa . IGFBP4 ve HGF'nin salgılanması (Şekil 9 (a) ve 9 (b) ) 'de verilmiştir. IGF-1'in, RUNX2 , OCN , OSX ve COL1 dahil olmak üzere çeşitli osteojenik gen markörlerinin ekspresyonunu aktive etmek için mTOR sinyal yolunu kolaylaştırdığı kaydedildi [ 49]. Çalışmamız, farklı osteojenik gen markörlerinin ekspresyonunu tetikleyen IGFBP 2, 4 ve 6'nın farklılaşma yukarı regülasyonu sırasında meydana geldiğini gösterdi. Büyüme faktörleri ayrıca, farklı bir sinyal yolu aracılığıyla kök hücrelerin osteogenezinde hayati bir rol oynar. Vasküler endotelyal büyüme faktörünün (VEGF) hücre göçü ve osteojenik farklılaşma üzerinde doğrudan bir etkiye sahip olduğu görülmüştür. VEGF varlığında hücre proliferasyonunda ve farklılaşmasında bir artış kaydedildi [ 50 ]. İle tedavi edilen hücreler G. Frondosa kalsiyum birikimi, ALP aktivitesi ve bu şekilde osteojenik genetik marker ekspresyonunda bir artış göstermiştir Runx2 , OS X , ALP , BSP ,OCN , OPN ve COL1 kontrole göre. Bu bulgular, G. frondosa'nın hMSC'lerden çeşitli büyüme faktörlerini ifade etme potansiyeline sahip olduğunu ve sonuç olarak osteojenik belirteçleri yukarı regüle ederek hücrelerin osteojenik farklılaşmasına neden olduğunu gösterdi.



    Figür 9

    (A) IGFBP4 ve (b) HGF'nin farklı G. frondosa partiküllerinin varlığında hMSC'ler tarafından salgılanması ().

    3.5. In Vivo Çalışması
    G. frondosa partiküllerinin varlığında ve partikül içermeyen deney sıçanının gıda tüketim grafiği (Şekil 10 (a) ) 'da gösterilmiştir. Grafik, G. frondosa partiküllerinin varlığında gıda tüketim oranının kontrole göre yüksek olduğunu gösteriyor ve bu da biyouyumluluklarını gösteriyor. Tüm deney dönemleri için standart sapma ile bir sıçan tarafından gıda tüketiminin bir grup özeti Tablo 1'de sunulmuştur . Tüm deney dönemleri boyunca bir sıçandan hiçbir klinik belirti gözlenmemiştir ve günlük gözlemleri Tablo 2'de özetlenmiştir.. Deney dönemlerinde sıçanda hızlı kilo alımının meydana geldiğine dikkat etmek ilginçti. Bununla birlikte, vücut ağırlığında bir azalma varlığında gözlenmiştir G. Frondosa kontrole göre ve bu azalma, küçük boyutlu (10-20 daha etkili olduğunu göstermiştir  μ tarafından inhibe edildiğini ağırlık artışı gösteren m) parçacıklar G. Frondosa daha önce rapor edildiği gibi [ 51 ]. G. frondosa partiküllerinin varlığında tedavi edilen sıçanın vücut ağırlığındaki değişiklik (Şekil 10 (b) ) 'de gösterilmektedir. G. frondosa varlığında sıçanların vücut ağırlığındaki bu azalma , antihipertansif ve antidiyabetik etkileriyle ilişkilidir [ 52 ]. EtkisiG. frondosa parçacıkları sıçan vücut ağırlığı üzerinde Tablo 3'te özetlenmiştir . G. frondosa'nın sıçan serumunda immünoglobulin (Ig) A, G ve M'nin salgılanmasıyla indüklenen sekresyonu (Şekil 11 ) ' de gösterilmiştir . Her durumda, yukarıda bahsedilen Ig'nin salgılanmasının kontrolden daha yüksek olduğunu ve bunun da terapötik yapılarını akla getirdiğini belirtmek önemlidir. IgA'nın mukozadaki homeostazı düzenleyen bir anti-enflamatuar antikor görevi gördüğü iyi bilinmektedir [ 53 ]. G. Frondosa IgA antikor kaynaklı salgı verilmiştir (Şekil 11 (a) ' ). G. frondosa varlığında IgA antikorunun salgılanmasıkontrolden ~ 1.13 kat daha yüksekti, bu da immün koruma için gelişmiş immüno-modüle edici potansiyellerini gösteriyordu. Yüksek afiniteli IgA antikorunun, mikroorganizmalar yoluyla bağırsak mukozal yüzeyini koruduğu, düşük afiniteli IgA antikorunun ise bakterilere karşı bağırsak lümeninde önemli bir rol oynadığı kaydedildi [ 54 ]. G. frondosa varlığında IgG antikorunun salgılanması (Şekil 11 (b) ) 'de gösterilmektedir. Kontrolden ~ 1.12 kat daha yüksekti. IgG antikoru, immün yanıtta doğrudan veya diğer immün hücreleri aktive ederek önemli bir rol oynar [ 55 ]. Bu nedenle, G. frondosa varlığında serumda daha yüksek IgG salgılanmasıayrıca vücuttaki homeostazın korunmasına yardımcı olan indüklenmiş immüno-modüle edici doğasını gösterir. G. frondosa'nın sıçan serumunda IgM antikor üretimini tetiklediği gösterilmiştir (Şekil 11 (c) ). IgM, bağışıklık tepkisinin erken aşamasında eksprese olan başka bir antikordur. O köklü β -glukan mantar bağışıklık arttırıcı etki için, aktif bileşen, ve 20-30 daha yüksek bir konsantrasyonuna sahiptir  μ m boyutu G. Frondosa [ 35 ]. Bununla birlikte, küçük boyutlu partiküller biyolojik bariyeri delmede büyük boyutlu ve kan dolaşımında hızla stabilize olanlara göre daha etkilidir [ 56 ]. Bu nedenle, her durumda, 10-20 μ m boyutu G. Frondosa diğerlerinden daha bağışıklık potansiyel arzetmiştir. Ayrıca, bu sonuçlar G. frondosa mantarının farklı fizyolojik aktivitelere sahip olduğunu göstermiştir.



    4. Sonuçlar
    Mantarlar, besleyici ve tıbbi değerlerinin yüksek olması nedeniyle bilim camiasından önemli miktarda ilgi görmüştür. Genellikle, farklı biyoaktif bileşenleri yoluyla insanların bağışıklığını indükleyen bir gıda takviyesi olarak kullanılır. G. frondosa varlığında kontrole göre daha iyi hücre canlılığı gözlemlendi ve bu potansiyel G. frondosa partiküllerinin boyutlarından büyük ölçüde etkilendi . Ayrıca, G. frondosa partiküllerinin varlığında kontrole göre artmış kalsiyum birikimi kaydedildi ve bu da mineralizasyon verimlerinin daha yüksek olduğunu gösterdi. Osteojenik gen markörlerinin daha yüksek ekspresyonu, G. frondosa'nın üstün osteojenik etkinliğini doğrulamaktadır.. IGFBP-2, 4 ve 6 gibi çeşitli insülin benzeri büyüme faktörü bağlayıcı proteinlerin (IGFBP) gelişmiş sekresyonu, G. frondosa'nın daha iyi hücresel aktivitelerini gösterdi . Ayrıca, G. frondosa'nın sıçan serumunda farklı immünoglobulin salgılanmasına neden olduğu , bunların terapötik doğasını daha da ileri sürdü. Bu salgının, mantar parçacıklarının boyutundan derinden etkilendiğine dikkat etmek önemliydi. Bu nedenle, daha iyi bir terapötik sonuç için uygun büyüklükte mantar kullanılmalıdır. G. frondosa polisakkaritlerinin yapıları ve işlevleri arasındaki ilişkiyi incelemek için gelecekte yapılacak araştırmalara ihtiyaç vardır . Bu çalışma, araştırmacıların sağlığı geliştiren daha fazla ilaç ve fonksiyonel gıda takviyeleri geliştirmesini kolaylaştıracak.

    Veri kullanılabilirliği
    Bu çalışmanın bulgularını desteklemek için kullanılan veriler talep üzerine ilgili yazardan temin edilebilir.

    Çıkar çatışmaları
    Yazarlar çıkar çatışması olmadığını beyan ederler.

    Yazar katkıları
    Dinesh K. Patel ve Yu-Ri Seo bu çalışmaya eşit derecede katkıda bulundu.

    Teşekkürler
    Bu araştırma, Tarım Bilimi ve Teknoloji Geliştirme için Ortak Araştırma Programı (No. PJ012854012019) ve Kırsal Kalkınma İdaresi tarafından desteklenmiştir. Yazarlar ayrıca, Kore Ulusal Araştırma Vakfı (NRF) aracılığıyla Temel Bilim Araştırma Programında mali destek sağladığı için Eğitim Bakanlığı'nı (No. 2018R1A6A1A03025582 ve 2019R1D1A3A03103828) kabul etmektedir. Bu çalışma aynı zamanda Kore Cumhuriyeti Chuncheon Kangwon Ulusal Üniversitesi'nden 2019 Research Grant (PoINT) tarafından da desteklenmiştir.

    Tamamlayıcı Malzemeler
    Ek Şekil 1: farklı G. frondosa konsantrasyonları varlığında hMSC'lerin hücre canlılığı; 10-20 (a)  μ m, boyutları ve (b) 30-40  μ m boyutları belirtilen zaman aralıklarında (). Ek Şekil 2: 20-30 varlığında ALP aktivitesi kalitatif analizi  μ m boyutu G. Frondosa tedaviden 7 gün sonra, değişik konsantrasyonlarda. Ek Tablo 1: kantitatif gerçek zamanlı polimeraz zincir reaksiyonu (qRT-PCR) için kullanılan belirli primer dizileri. Ek Tablo 2: G. frondosa örnekleriningranülometrik dağılımı. Ek Tablo 3: insan büyüme faktörü dizisi üzerine lekelenmiş protein için antikorların konumunu gösteren bir şablon. ( Tamamlayıcı Malzemeler )

    Referanslar: https://www.hindawi.com/journals/bmri/2020/8193971/
    Konu mert tarafından (https://bitkiseltedavi.net/vb5/member/685-mert Saat 05 Nisan 2021, 15:12 ) değiştirilmiştir.

    Yorum yap


    • #3
      Kolon Kanseri Hücrelerinde Trametes Versicolor ve Grifola Frondosa'dan Polisakkaritten Zengin Ekstrelerin İn Vitro Anti-proliferatif ve Anti-invazif Etkisi
      Daniel Roca-Lema 1 * , Olaia Martinez-Iglesias 1 * , Catalina Fernández de Ana Portela 2 , Arturo Rodríguez-Blanco 2 , Manuel Valladares-Ayerbes 3 , Andrea Díaz-Díaz 1 , Alba Casas-Pais 1 , Cecilia Prego 4 , Angélica Figueroa 1Ilgili adres

      Öz
      Kolorektal kanser (CRC) batı ülkelerinde önde gelen ölüm nedenlerinden biridir ve yeni tedavi stratejileri gereklidir. Mantarların tıbbi uygulaması birçok doğu ülkesinde geleneksel tıpta kullanılmaktadır. Bazı tıbbi mantar türlerinden elde edilen polisakkarit yönünden zengin özütler, farklı deneysel modellerde antitümör etkiler göstermiştir. Bu çalışmada, Trametes versicolor (TV) ve Grifola frondosa (GF) meyve gövdelerinden polisakkarit açısından zengin özütler geliştirdik . Bu polisakkarit yönünden zengin özütlerin LoVo ve HT-29 insan kolon kanseri hücrelerinde antikanser etkilerini değerlendirmeyi amaçlıyoruz. in vitroetkiler, sitotoksisite deneyi, proliferasyon deneyi, yara iyileştirme deneyi ve istila deneyi ile belirlendi. Ayrıca ankrajdan bağımsız hücre büyümesi üzerindeki etki de belirlendi. Sonuçlarımız, TV ve GF ekstrelerinin insan kolon hücresi çoğalmasını engellediğini ve sitotoksisiteyi uyardığını gösterdi. Ayrıca, her iki mantar özütü de onkojenik potansiyeli, hücre göçünü ve kolon kanseri hücrelerinde istilayı önemli ölçüde inhibe etti. Ek olarak, ekstreler, western blot analizleri ile saptanan E-kaderin epitel markörünün artan bir ekspresyonu ile birlikte faz kontrast görüntüleriyle gözlenen daha epitel fenotipini indükler. Ayrıca, jelatin zimografi deneyleri kullanılarak, hücre dışı matrisin bozunması için önemli bir metaloproteinaz olan MMP-2 enzim aktivitesinde bir azalma tespit edildi. En sonunda, Ekstrelerin kolorektal kanser için en çok klinik olarak kullanılan ajanlardan biri olan 5-florourasil ile kombinasyonu hücre sitotoksisitesini arttırır. Sonuçlarımız birlikte ele alındığında, insan kolon kanseri hücre dizilerinde TV ve GF'den elde edilen polisakkarit bakımından zengin özütlerin potansiyel bir antitümör etkisinin altını çizmektedir. Bu bulgular, mantar özlerinin bildirilen sağlık etkilerine katkıda bulunabilir.

      Anahtar Kelimeler : Kolon kanseri, istila, proliferasyon, Fugal ekstraktları

      Giriş
      Kolorektal kanser (CRC) Batı ülkelerinde önde gelen ölüm nedenlerinden biridir [ 1 , 2 ]. Kansere bağlı ölümlerin yaklaşık% 90'ı metastaza bağlıdır [ 3 ]. Metastatik süreç, tümör hücresinin başarılı bir şekilde metastaz yapması için gereken bir dizi ardışık olaydan oluşur. Metastatik kaskadda, epitel hücreleri birincil tümörden ayrılır, göç eder, istila etme yeteneği kazanır ve sonunda ikinci bir bölgeye yerleşmek için vücuda yayılır. Bu metastatik kaskad sırasında, hücre-hücre temaslarının ve hücre-matriks adezyonlarının değişmesi gibi diğer önemli değişiklikler meydana gelir. Tamamlayıcı ve alternatif ilaçlar, çok sayıda hastalığı tedavi etmek için umut verici bir strateji olarak ortaya çıkmıştır. Aslında, doğal ürünler, kanser sonuçlarını ve hastaların yaşam kalitesini iyileştirmek için gıda takviyeleri için güçlü kaynaklar olarak ortaya çıkmaktadır [ 4 ]. Önemli araştırma hatları, tıbbi mantarların anti-proliferatif ve anti-anjiyogenez özellikleri dahil olmak üzere güçlü bir anti-neoplastik aktiviteye sahip olduğunu göstermiştir. Trametes versicolor (TV) ve Grifola frondosa (GF) gibi bazı yüksek Basidomycet türlerinin anti-proliferatif, antioksidan, antiviral, antimikrobiyal ve immünomodülatör terapötik etkileri olan birkaç metabolit ürettiği bildirilmiştir [ 5 , 6 ]. Grifola frondosa , yerleşik bir immünolojik etkiye sahip yenilebilir bir mantardır. Aslında, meme kanseri hastalarında insan klinik deneylerinde GF ekstraktlarının etkisi zaten bildirilmiştir [ 7 ]. Örneğin, GF'den β - (1,3) (1,6) -glukan özütü, hematopoezi artırarak ve konakçı bağışıklık sistemini aktive ederek anti-tümör aktivitesini indükler [ 8 ]. Ayrıca, GF'den Z-fraksiyon polisakkaridi, kolon kanseri hücre dizileri ile aşılanmış BALB / c farelerde tümör büyümesini inhibe eder [ 9 ]. Öte yandan, Trametes versicolorayrıca immünomodülatör etkiye sahiptir ve spesifik özler, meme kanserinin önlenmesinde insan kanser tedavisinde kullanılır. Bununla birlikte, antitümör etkisine dahil olan moleküler mekanizma hala net değildir. Son kanıtlar, polisakkarit ekstrelerinin, bağışıklık sisteminden bağımsız olarak insan tümör hücrelerinin canlılığını doğrudan etkileyebileceğini göstermektedir. Örneğin, GF'den polisakkaritle zenginleştirilmiş özütler, normal karaciğer hücrelerinin büyümesini hafifçe etkilerken, insan meme ve mide kanseri hücrelerinde toksisite ve apoptozu indükler [ 10 , 11 ]. Dahası, GF'den gelen polisakkaritler, migrasyon ve metastaza dahil olan IGFBP-7 gibi genlerin ekspresyonunu değiştirerek insan meme kanseri hücrelerinde tümör ilerlemesini modüle edebilir [ 12, 13 ]. GF ve TV'den polisakkaritlerle zenginleştirilmiş özütlerin insan kolon karsinomundaki potansiyel etkisi kapsamlı bir şekilde araştırılmamıştır ve bunların tümör ilerlemesi ve metastazında bir rol oynayıp oynayamayacakları da bilinmemektedir. Kolon tümör hücreleri, metastaz yapmak için farklılaşmaya ve gelişmiş göç yetenekleri edinmeye başlar. Dediferansiye işlemi sırasında kritik bir moleküler işaret, epitelden mezenkime geçiş (EMT) adlı bir program sırasında hücre-hücre temaslarında E-kaderin kaybıdır. E-kaderin kaybı, iyi huylu tümörden kötü huylu tümöre ilerlemeyle ilişkilidir. Nitekim, E-kaderin negatif tümör hücrelerinde E-kaderin proteininin in vitro yeniden ekspresyonunun hücre büyümesini inhibe ettiği ve invazivliği bloke ettiği bildirilmiştir [ 14 , 15]. Öte yandan hücre hareketliliği, matris metaloproteinazların (MMP'ler) proteolitik aktivitesiyle de ilişkilidir. MMP'ler, hücre dışı matrisin (ECM) proteolitik bozunmasında ve hücre yüzeyi reseptörlerinin bölünmesinde rol oynayan bir çinko bağımlı endopeptidaz ailesidir. MMP'ler proliferasyon, kanser göçü ve istilasında önemli bir rol oynar [ 16 ]. İki jelatinaz MMP (MMP-2 ve MMP-9), tümör invazivliğinde kritik bir rol oynayan kolajen tip IV'ü indirgeyebilir [ 17 ]. Bu çalışmada, insan kolon kanseri hücrelerinde Trametes versicolor ve Grifola frondosa'dan polisakkarit bakımından zengin ekstraktların antikanser etkisini değerlendirmeyi hedefliyoruz . Her iki ekstrenin de hücre çoğalmasını, onkojenik potansiyeli, göçü ve istilayı engellediğini özellikle gösteriyoruz. Ayrıca, antitümör etkisi, E-kaderin protein ekspresyonunun artmasına ve MMP-2 aktivitesinin azalmasına bağlı olabilir. Son olarak, kolorektal kanser için kullanılan yaygın bir klinik ilaç olan 5-Fluorouracil kombinasyonunun, polisakkarit bakımından zengin özler ile birlikte, kolon kanseri için potansiyel bir klinik fayda olduğunu düşündüren hücre sitotoksisitesini arttırdığını da gösteriyoruz.

      Malzeme
      Grifola frondosa ve Trametes versicolor'dan meyve veren gövdeler , Hifas da Terra SL fabrikasında ve endüstriyel karıştırıcılar kullanılarak öğütülmüştür. Elde edilen materyal, 30 dakika boyunca 80 ° C'de Grifola frondosa için 1:12 (w / v) ve Trametes versicolor için 1:10 (w / v) oranında damıtılmış su ile özümlendi ve Whatman No. 1 filtre kağıdı ile süzüldü. Elde edilen tortu, aynı prosedür ve birleştirildiği ve liyofilize edildiği her iki süzüntü kullanılarak tekrar özümlendi. Grifola frondosa özütü, sırasıyla α-Glucans ve β-glukanların (w / w; β-Glucan Assay Kit Maya ve Mantar, Megazyme)% 10.20 ve% 34.80'ini temsil eden toplam% 45 (ağırlık / ağırlık) Glukan içeriği sunmuştur. Grifola frondosaözüt, Hifas da Terra SL'nin birkaç MicoSalud® ürününde mevcuttur. Trametes versicolor özü, toplam% 74.30 (a / a) bir Glukan içeriği sunmuştur; burada a-Glukanlar ve β-glukanlar sırasıyla% 8.7 ve% 65.60'ı (w / w) temsil etmektedir. Trametes versicolor özütü, Mico-Corio PSK® dahil olmak üzere Hifas da Terra SL'nin çeşitli MicoSalud® ürünlerinde mevcuttur. Her iki ekstraktın stok çözeltileri 50mg / ml'de damıtılmış suda yeniden süspanse edildi ve -20ºC'de saklandı. 5-Florourasil (5-Fu), Sigma-Aldrich'ten satın alındı.


      Hücre hatları
      İnsan kolon karsinomu LoVo ve HT-29 hücreleri, sırasıyla F-12K Medium (Kaighn´s Modification of Ham´s F-12 Medium) ve McCoy's 5a Medium Modified ile büyütüldü. Hücreler penisilin / streptomisin (50 U / ml) ve% 10 ısı ile etkisiz hale getirilen fötal sığır serumu ile takviye edilmiş ve% 5 CO ile 37 ° C'de nemlendirilmiş bir enkübatörde serumsuz keratosit besiyeri 2 . Hücreler, StemElite ID sistemi (Promega) ile doğrulanmış ve serbest kontaminasyon kültürlerini sağlamak için aylık olarak mikoplazma için test edilmiştir.

      Sitotoksisite deneyi
      Sitotoksisite deneyleri için, 1x10 4 hücreleri, 96 oyuklu bir plaka içerisine oyuk başına kaplandı ve 24 saat boyunca kültürlenir. Daha sonra hücreler, Trametes versicolor veya Grifola frondosa'dan 10, 50, 100, 250 veya 1000μg / ml özütlerle tedavi edildi.24, 48 veya 72 saat için Canlılık, bir MTT [3- (4,5-dimetiltiyazol-2-il) -2,5-difeniltetrazolyum bromür] kolorimetrik hücre canlılığı deney kiti (Sigma Aldrich, St Louis, MO) kullanılarak ölçüldü. Hücreler, 3 saat süreyle 0.5 mg / ml MTT ile muamele edildi. Daha sonra ortam çıkarıldı ve her oyuğa 100 ul DMSO ilave edildi ve 10-15 dakika zincirlendi. Absorbans, bir Multiskan Plus Okuyucu (Thermo Fisher, MA, ABD) kullanılarak 570 ve 630 nm'de ölçüldü. Deneyler en az üç kez tekrarlandı ve her işlem için 6 çukur kullanıldı. Yarı-maksimum engelleyici konsantrasyon (IC 50) değerleri, GraphPad Prism yazılımı kullanılarak oluşturulan doz-yanıt eğrilerinden hesaplandı. Sonuçlar, ortalama ± SD olarak ve işlenmemiş hücrelere kıyasla kat değişimi olarak ifade edilir. Mantar özütlerinin 5-florourasil (5-Fu) ile kombinasyonunun etkisini incelemek için, hücreler farklı 5-Fu (5, 10, 100 ve 1000 ng / ml) konsantrasyonları ile işleme tabi tutuldu, taze ortamda çözündürüldü. 250 μg / ml mantar özleri. Ekstreler ve 5-Fu ile 72 saat inkübasyondan sonra hücreler, 3 saat süreyle 0.5 mg / ml MTT ile muamele edildi ve hücre canlılığı, daha önce belirtildiği gibi hesaplandı.

      Yayılma Deneyi
      Proliferasyon deneyleri için, 1x10 4 LoVo hücreleri, 96 oyuklu bir plaka içerisine oyuk başına kaplanmış ve 24 saat sonra, hücreler 48 saat boyunca, 10 veya 100 ug / ml farklı mantar özleri ile muamele edildikten sonra. Daha sonra hücreler, 2 saat boyunca 10 mM BrdU ile muamele edildi. Yeni sentezlenen DNA'ya BrdU katılımı, üreticinin talimatlarına göre bir hücre proliferasyon kolorimetrik immünolojik test kiti (Roche) kullanılarak ölçüldü. Veriler, altı kez gerçekleştirilen üç bağımsız deneyin ortalamasıdır. Sonuçlar, ortalama ± SD olarak ifade edilir ve kat değişimi, işlenmemiş hücrelere kıyasla temsil edilir.

      Yumuşak agar ankrajdan bağımsız hücre büyümesi
      Yumuşak agar-koloni oluşturma deneyi için, 5x10 3 LoVo hücre / göz az eriyen agaroz (Sigma Aldrich, St. Louis, MO)% 0.375 içeren ortamda bir 12-kuyucuklu plaka içine kültürlenmiştir. Bu agaroz,% 0.6 agaroz üzerinde tabakalandı. Her oyuğun katılaşmasına izin verildi ve ardından belirtilen mantar özlerinin (10, 100 veya 250 ug / ml) varlığında veya yokluğunda 150 ul kültür ortamı ile kaplandı. Mantar özleri her 3 günde bir yenilendi. 21 gün sonra hücreler sabitlendi ve% 5 formalin solüsyonu içinde% 0.2 kristal viyole ile boyandı. Koloniler Olympus mikroskobunda sayıldı (büyütme 40x) ve tüm oyuklar fotoğraflandı. Deneyler, üç kopya halinde plakalarda iki kez tekrarlandı. Sonuçlar, ortalama ± SD olarak ifade edilir ve kat değişimi, işlenmemiş hücrelere kıyasla temsil edilir.

      Yara iyileştirme deneyi
      Hücreler, bir yüksek yoğunlukta (7x10 tohumlanmıştır 5 Kültür Uçlar (Ibidi) ve gece boyunca yapışmaya bırakıldı içeren 24 oyuklu plakalar içinde hücre / ml). Daha sonra hücreler 2 saat 10 ug / ml mitomisin C ile işleme tabi tutuldu ve ekler çıkarıldı. Hücreler, 10 veya 100 ug / ml mantar özleri ile tedavi edildi ve 24, 48 ve 72 saat boyunca yara iyileşmesi sürdürüldü. Fotoğraflar belirtilen zamanlarda Nickon Eclipse-Ti mikroskobunda (büyütme 100x) çekildi. Hücre göçünden sonraki mesafenin ölçümü, MRI Yara İyileştirme Aracı kullanılarak ImageJ programı kullanılarak belirlendi. Deneyler, kopyalar halinde en az iki kez tekrarlandı ve sonuçlar, ortalama ± SD olarak ifade edildi ve kat değişimi, işlenmemiş hücrelere kıyasla temsil edildi.

      İstila deneyi
      İstila tahlilleri için, hücreler 48 saat boyunca mantar özleri (10 veya 100 ug / ml) ile% 1 FBS ile Ham F-12K ortamında kültürlenmiştir. Daha sonra, LoVo hücreleri (3x10 5 hücre / çukur) hücre dışı matrisin ince bir tabaka halinde kaplanmış 24 gözlü içeren plaka 8 mikron gözenek boyutu polikarbonat membran içinde (hücre istilası deney kiti, Chemicon International), bir hücre istilası odası içinde tohumlanmıştır tarif [ 19 ]. 72 saat sonra filtreler sabitlendi ve üreticinin spesifikasyonlarına göre kristal mor ile boyandı. Hücreler, bir Olympus mikroskobunda (büyütme 200x) beş alanın fotoğraflanmasıyla sayıldı. Deneyler, her koşul için üç kopya halinde gerçekleştirildi ve en az iki kez tekrarlandı. Sonuçlar, ortalama ± SD olarak ifade edilir ve indüksiyon, işlenmemiş hücrelere kıyasla temsil edilir.

      Kontrast mikroskopi aşaması
      Faz-kontrast görüntüleri için, 1x10 5 LoVo hücreleri, oyuk başına kaplandı 12 oyuklu / ml ug plaka ve 10 veya 100 ile tedavi öncesinde 24 saat süreyle kültürlendi Trametes versicolor veya Grifola Frondosa 48 saat özleri. Daha sonra hücreler, 20 dakika süreyle fosfat tamponlu salin (PBS) içerisinde% 4 paraformaldehit ile sabitlendi. Faz kontrastlı görüntüler 100x büyütmeli Nickon Eclipse-Ti mikroskobu kullanılarak elde edildi.

      Western lekeleme
      Protein ekstre için, 8x10 5 LoVo hücreleri, 60 mm tabaklar içinde plakalanmıştır ve 24 saat sonra, hücreler daha sonra 100 veya 72 saat süreyle mantar ekstrelerinin 250 ug / ml ile muamele edilmiştir. Daha sonra, daha önce tarif edildiği gibi [ 18 ] protein ekstraksiyonu için tam hücre ekstreleri hazırlandı . Kısaca, hücreler 5μg ml-1 leupeptin içeren 0.3 ml% 1 Triton X-100 liziz tamponunda (20 mM Tris-HCL [pH 7.5], 150 mM NaCl ve% 1 Triton X- 100) 30 dakika süreyle lize edildi, 50 mM fenilmetilsülfonil florür ve aprotinin için 7.2 tripsin inhibitörü birimi. 14000 g'de 10 dakika süreyle santrifüjlendikten sonra, yirmi mikrogram süpernatan,% 10 poliakrilamid SDS-PAGE içine yüklendi. Western blotlama, daha önce tarif edildiği gibi yapıldı [ 19]. Western blot için, kullanılan antikorlar şunlardır: monoklonal E-kaderin antikoru (BD 610182) ve monoklonal GAPDH antikoru (Invitrogen, 39-8600). Deneyler en az üç kez tekrarlandı. Görüntüler, dansitometri ile nicelendirildi ve sonuçlar, ortalama ± SD olarak ifade edildi ve indüksiyon, işlenmemiş hücrelere kıyasla temsil edildi.

      Jelatin zimografi
      Matris metaloproteinaz 2 ve 9 (MMP-2 ve MMP-9) aktivitesini saptamak için zimogram tekniği kullanıldı. Hücreler, 60 mm'lik kaplara tohumlandı ve 72 saat boyunca 100 veya 250 mg / ml mantar özleri ile inkübe edildi. Son 24 saat, hücreler 1 ml serumsuz ortamda büyütüldü. Normalizasyon için hücre sayısı kullanılarak ortam toplandı, santrifüjlendi ve yüklendi. Örnekler, indirgeyici olmayan koşullar altında jelatin (% 0.05) içeren% 10'luk bir poliakrilamid jel içinde yürütülmüştür. SDS,% 2.5 Triton X-100'de yoğun bir şekilde yıkanarak çıkarıldı ve metaloproteinaz aktivitesi, jelin 40 mM Tris-HCl pH 7,5 içeren bir tamponda inkübe edilmesiyle yeniden etkinleştirildi; 0,1 M benzamidin (SIGMA) ve 10 mM CaCl 272 saat Jel, gece boyunca% 10 asetik asit,% 50 metanol çözeltisi içinde Coomassie Blue R250 ile boyandı ve daha sonra bantlar açıkça görünene kadar% 10 asetik asit,% 50 metanol içinde damıtıldı. Proteaz aktivitesi, MMP-2 veya MMP-9'un sindirilmiş jelatin substratına sahip olduğu mavi bir arka plana karşı açık bantlar olarak göründü. Jeller fotoğraflandı ve Amersham Imager 600 ekipmanıyla ölçüldü. Deney üç kez tekrarlandı ve kantifikasyon ortalama ± SD olarak ifade edildi.

      istatistiksel analiz
      İstatistiksel anlamlılık, ANOVA veya Kruskal-Wallis testi uygulanarak GraphPad Prism yazılımı ile belirlendi. Normal dağılımı kontrol etmek için Shapiro-Wilk testi, varyansların eşitliğini belirlemek için Levene testi kullanıldı. Sonuçlar ortalama ± SD olarak ifade edilir. Şekillerde belirtilen deney grupları arasında Student t- testinin önemi * p <0.05, ** p <0.01 ve *** p <0.001 olarak gösterilmiştir.

      Sonuçlar
      TV ve GF ekstrelerinin insan kolon kanseri hücrelerinde hücre canlılığı ve proliferasyonu üzerindeki etkisi
      TV ve GF mantar özlerinin kanser hücresi canlılığı üzerindeki etkisini belirlemek için, iki farklı insan kolon kanseri hücre çizgisi seçildi. Bir metastatik bölgeden türetilen LoVo kolon hücreleri ve bir epitelyal morfolojiye sahip bir kolorektal adenokarsinom hücre hattı olan HT-29. Hücreler, 24 saat, 48 saat ve 72 saat süreyle 10 ug / ml ila 250 ug / ml arasında değişen farklı konsantrasyonlarda işleme tabi tutuldu. TV özütü, LoVo hücrelerinde 24 saatlik tedaviden sonra hücre canlılığı üzerinde önemli bir etki göstermedi. Bununla birlikte, 48 saat sonra hafif bir azalma tespit edildi ve 72 saat sonra, daha düşük bir konsantrasyonda (10 ug / ml)% 40'a varan düşüşle önemli ölçüde azalma gösterildi (Şekil 1 A). Öte yandan, HT-29 hücreleri 24 saat, 48 saat ve 72 saat sonra TV ekstreleri ile tedavi edilirken önemli bir etki tespit edilmedi (Şekil 1B). GF tedavisi, LoVo hücre canlılığı üzerinde inhibe edici etkisini, daha yüksek konsantrasyonlar (100 µg / ml ve 250 µg / ml) kullanarak TV ekstresine göre daha erken zamanlarda göstermiştir. GF tedavi 72 saat sonra hücre canlılığı ile ilgili belirgin bir azalma daha düşük bir konsantrasyon görüldü (tedavi edilmemiş hücreler ile karşılaştırıldığında% 40 azalma 10 ug / ml), (Şekil 1 C). Son olarak, HT-29 hücrelerinde GF ekstresi kullanılarak en belirgin sitotoksisite etkisi gözlendi. Bu hücrelerde, 50 ug / ml GF özütünün düşük bir konsantrasyonunda, 24 saat, 48 saat ve 72 saat sonra zaten güçlü bir düşüş gözlendi. Sitotoksisite üzerindeki bu inhibitör etki, 100 µg / ml konsantrasyonla 72 saatlik GF tedavisinden sonra% 60-70'e kadar azalmaya ulaştı ve test edilen sürelerin herhangi birinde (24 saat, 48 saat) 250 µg / ml konsantrasyonda benzer sonuçlar gözlendi. h ve 72h) (Şekil1 D). Ayrıca, tümörijenik olmayan epitelyal MDCK hücre hatlarında TV ve GF ekstrelerinin sitotoksisite etkisi tespit edilmemiştir (veriler gösterilmemiştir). IC 50 TV ve GF için değerler, her kolon kanseri hücre çizgileri (Tablo belirlenmiştir 1 ). Birlikte ele alındığında, sonuçlarımız, GF özütlerinin LoVo ve HT-29 kolon kanseri hücre dizilerinde TV özütlerine kıyasla daha güçlü bir sitotoksisite etkisi olduğunu göstermektedir.

      Kolon kanseri büyümesinde TV ve GF özütlerinin etkilerini analiz etmek için LoVo hücreleri, 48 saat boyunca her bir özütün artan konsantrasyonlarıyla (10 ug / mg ve 100 ug / ml) işleme tabi tutuldu ve ardından proliferasyon, BrdU deneyi ile ölçüldü. BrdU katılımının nicelendirilmesi, daha düşük konsantrasyonlarda (10 ug / ml) TV'ye maruz kalmanın, önemli ölçüde bir büyüme inhibisyonu (muamele edilmemiş hücrelere kıyasla% 45'e kadar) ile sonuçlandığını doğruladı. Ayrıca, 10 ug / ml GF özütü ile tedavi% 50-60'a kadar önleme oluştururken, bu önleyici etki 100 ug / ml GF özütünde% 80'e kadar inhibisyonu artırdı (Şekil 1E). Sonuçlarımız, Lovo hücrelerinde TV ekstraktına kıyasla GF ekstresinin daha güçlü bir anti-proliferatif etkisi olduğunu gösterdi. İlginç bir şekilde, her iki mantar özütünün etkileri proliferasyon üzerinde toksisiteden daha belirgindir, bu nedenle daha düşük konsantrasyonlara maruz kalma, sitotoksisite etkisinden kaçınarak bir büyüme inhibisyonu ile sonuçlanmıştır.

      Şekil 1
      Trametes versicolor ve Grifola frondosa ekstraktlarının kolon kanseri hücrelerinin canlılığı üzerine etkisi . LoVo (A ve C) ve HT-29 hücreleri (B ve D) 24, 48 ve 72 saat süreyle Trametes versicolor ve Grifola frondosa ekstraktları ile tedavi edildi ve MTT aktivitesi belirlendi. (E) Mantar ekstraktlarının LoVo hücrelerinde hücre proliferasyonu üzerindeki etkisi, Materyal ve Metotlar'da tarif edildiği gibi bir BrdU testi ile belirlendi. Veriler, üç bağımsız deneyin ortalama ± SD'sidir (* p <0.05, ** p <0.01 ** p <0.001)



      TV ve GF ekstrelerinin ankrajdan bağımsız hücre büyümesi üzerindeki etkisi
      Mantar ekstraktlarının kolon kanseri hücreleri üzerindeki sitotoksisite ve proliferasyonunda gözlemlenen etkisi göz önüne alındığında, tümör ilerlemesinin inhibisyonunda potansiyel bir rolleri olup olmayacağını merak ettik. Katı bir substratın yokluğunda kanser hücrelerinin hayatta kalma ve çoğalma yeteneği, bir istilacı ve metastatik fenotipin edinilmesi için önemli bir özelliktir. Yumuşak agar büyüme deneylerini kullanarak, TV ve GF özütlerinin LoVo hücrelerinde koloni oluşumu üzerindeki etkisini inceledik. Şekil 2'de gösterildiği gibiher iki ekstrakt da LoVo tümör hücrelerinin neden olduğu koloni oluşumunu önemli ölçüde azaltmıştır. Etki, her iki ekstrakt için 10 ug / ml'lik test edilen en düşük konsantrasyonda bile tespit edildi. Bu sonuçlar, TV ve GF özütlerinin ankrajdan bağımsız hücre büyümesini azalttığını ve böylece kolon kanseri hücrelerindeki onkojenik potansiyeli azalttığını göstermektedir.

      TV ve GF ekstrelerinin hücre göçü ve istilası üzerindeki etkisi
      Tümör hücrelerinin hücre göçü ve invazyon yetenekleri, tümör progresyonu ve metastazı sırasında kötü huylu tümörlerin önemli özellikleridir. TV ve GF özütlerinin, yara iyileştirme deneylerini kullanarak LoVo hücrelerinde hücre göçünü inhibe edip edemeyeceğini inceledik. Sonuçlar, LoVo hücrelerinde sırasıyla 48 saat ve 72 saat boyunca GF ekstraktları ile tedaviden sonra yara kapanmasının% 40 ve% 20'sini gösterdi (Şekil 3 A). 10 µg / mg ve 100 µg / ml TV ekstraktlarının konsantrasyonları, 48 saat sonra yara kapanmasını yaklaşık% 50 azaltır. 10 ug / mg konsantrasyonla 48 saatlik tedavi sırasında GF tedavisinden sonra benzer sonuçlar elde edildi (Şekil 3A). Mantar özlerinin LoVo hücrelerinin göçünü önemli ölçüde engellediği gözlemine dayanarak, TV ve GF'nin hücre istilasını da etkileyip etkilemeyeceğini varsaymak mantıklıdır. Ekstrelerin invazif kapasite üzerindeki olası etkisini araştırmak için LoVo hücrelerinde bir istila tahlilleri gerçekleştirildi. Daha önce LoVo hücrelerinin bir matrigel matrisinden geçebildiği bildirilmişti [ 20 ]. Sonuçlarımız, TV ve GF ekstrelerinin LoVo kolon kanseri hücrelerinin istila kabiliyetini önemli ölçüde zayıflattığını açıkça gösterdi (Şekil 3B) her iki ekstraktın 10 veya 100 ug / mg ile muamelesinden sonra. Bu sonuçlar, TV ve GF özütlerinin, sitotoksik olmayan dozajda (10 ug / mg) LoVo hücrelerinde hücre göçünü ve istilasını engellediğine işaret ederek, her iki özütün de kolon kanserinin ilerlemesini ve metastazı tedavi etmek için güçlü ve çok işlevli maddeler olabileceğini düşündürdü.

      TV ve GF ekstrelerinin yumuşak agarda ankrajdan bağımsız hücre büyümesi üzerindeki etkisi.
      LoVo hücre kolonileri, 21 gün boyunca Trametes versicolor (A) ve Grifola frondosa (B) özütleriyle işleme tabi tutuldu ve koloni oluşumu manuel sayımla belirlendi. Veriler, iki bağımsız deneyin ortalama ± SD'si ile temsil edilir (* p <0.05, ** p <0.01 ** p <0.001)



      Şek. 3
      Trametes versicolor ve Grifola frondosa özütlerinin LoVo kolon kanseri hücrelerinde hücre göçü ve istilası üzerine etkisi . (A) LoVo hücreleri, proliferasyonu engellemek için 2 saat mitomisin C ile ön işleme tabi tutuldu ve TV ve GF ekstraktlarının belirtilen konsantrasyonlarının varlığında veya yokluğunda 3 gün boyunca yara iyileşme deneyi izlendi. Yara kapanması, ImageJ programı kullanılarak ölçüldü. Veriler, iki bağımsız deneyden çiftler halinde ortalama ± SD ile temsil edilir. (B)TV ve GF ekstrelerinin LoVo kolon kanseri hücrelerinde hücre istilası üzerindeki etkisi. Hücreler 48 saat boyunca belirtilen öz konsantrasyonları ile işleme tabi tutuldu. Hücreler tripsinize edildi ve Materyal ve Yöntemlerde tarif edildiği gibi bir istila odasında tohumlandı. Göç edilen hücreler boyandı, fotoğraflandı ve mikroskopla 200X'de sayıldı. Ölçekli çubuk 627µm. Veriler, üç bağımsız deneyin ortalama ± SD'sidir (* p <0.05, ** p <0.01 ** p <0.001).




      TV ve GF ekstraktlarının E-kaderin protein ekspresyonu ve MMP-2 aktivitesi üzerindeki etkisi
      Daha sonra, göç ve istilanın düzenlenebileceği olası moleküler mekanizmaları incelemeye karar verdik. Bu amaçla, önce TV ve GF ekstraktlarının hücre morfolojisi üzerindeki etkisi faz-kontrast mikroskobu ile analiz edildi. Şekil 4'te gösterildiği gibi , tedavi edilmemiş hücrede gözlemlenen fibroblast fenotipine kıyasla TV ve GF tedavisi altında LoVo hücrelerinde ( sırasıyla Şekil 4 A ve B) daha belirgin bir epitel morfolojisi gözlendi . Fibroblasttan epitel fenotipe olan bu morfoloji değişimine, hücre-hücre adezyonlarında bir artış ve membran çıkıntılarının sayısında bir azalma eşlik etti (Şekil 4Sırasıyla A ve B). Ayrıca ekstraktların E-kaderin ekspresyonu üzerindeki etkisini değerlendirdik. E-kaderin, sıkı hücre-hücre temaslarının kurulması için önemli olan epitel hücreleri arasında en iyi karakterize edilen hücre yapışma moleküllerinden biridir. Gerçekten de, karsinom gelişimi sırasında E-kaderin kaybı kaybolur. Dediferansiye etme süreci, tümör hücrelerinin hücresel göçü ve istilası için çok önemli bir olay olan karsinomla ilişkili EMT ile bağlantılıdır. Ayrıca, E-kaderin kaybı, tümörün ilerlemesi, invazyonu ve metastazı ile ilişkilidir. Daha sonra, E-kaderin protein ekspresyonunu western blot ile analiz ettik (Şekil 4 C, üst panel ve Şekil S1) ve LoVo hücrelerinde TV ve GF ekstreleri ile muameleden sonra E-kaderin protein ekspresyonunda istatistiksel olarak önemli bir artış tespit edildi (Şekil 4 C, alt panel). Daha sonra, mantar özlerinin metaloproteinaz aktivitesini baskılayıp baskılayamayacağını test ettik. Hücre dışı matrisin bozulmasının tümör istilası ve metastaz sırasında çok önemli bir olay olduğu bilinmektedir. Jelatinazlar MMP-2 ve MMP-9, tümör istilası ve metastaz ile tutarlı ilişkileri göz önüne alındığında kapsamlı bir şekilde incelenen MMP ailesinin iki üyesidir. MMP-2 ve MMP-9 aktivitesi, bir zimogram analizi ile ölçüldü ve her iki mantar özütü ile tedaviden sonra MMP-2 aktivitesinde önemli bir azalma tespit edildi (Şekil 4 D, üst panel ve Şekil S2). Her iki mantar özütü de MMP-2 aktivitesinde güçlü bir azalmaya neden olabilse de, bu azalma GF özütü kullanılarak daha belirgindi ve 100 ug / mg'da test edilen en düşük konsantrasyonla MMP-2 aktivitesinde% 60'a varan düşüşe ulaştı (Şekil 4 D, alt panel).

      TV ve GF özleri, 5-florourasilin etkisini artırır
      5-florourasil (5-Fu), kolon kanseri hastalarını tedavi etmek için yaygın olarak kullanılan bir sitotoksik ajandır. 5-florourasil bazlı kemoterapinin doğal ürünler gibi diğer ajanlarla kombinasyonu kapsamlı bir şekilde incelenmiştir. Bununla birlikte, optimal kombinasyon rejimi belirlenmemiştir. LoVo hücrelerinde 5-FU ile kombinasyon halinde TV ve GF mantar ekstraktlarının sitotoksisite etkisini inceledik. LoVo hücreleri, tek başına veya mantar özleri ile kombinasyon halinde artan 5-Fu konsantrasyonları ile işleme tabi tutuldu. MTT sitotoksisite analizleri, 250 µg / ml TV veya GF mantar ekstraktları ile kombinasyon halinde test edilen en düşük 5-Fu (0,005 µg / ml) konsantrasyonlarında sitotoksisite etkisini artırdığını göstermiştir. Aslında, 5-Fu'nun TV özütleriyle kombinasyonu daha belirgindi (Şekil 5). Bu sonuçlar, kolon kanserinde 5-florourasil bazlı kemoterapi ile kombinasyon halinde bu mantar özlerinin olası bir faydasını ortaya koymaktadır.

      Şekil 4
      Etkisi Trametes versicolor ve Grifola Frondosa hücre morfolojisi ve invazyon-ilgili protein ile ilgili hülasalar. (A) TV ekstresinin LoVo hücrelerinin hücre morfolojisi üzerindeki etkisi. (B) GF ekstresinin LoVo hücrelerinde hücre fenotipi üzerindeki etkisi. (A ve B) Faz-kontrast mikroskopi görüntüleri, 10 ug / mg veya 100 ug / mg belirtilen özütlerle 48 saat işlemden sonra alındı. Ölçek çubuğu 100 um. (C) TV ve GF ekstrelerinin E-kaderin protein ekspresyonu üzerindeki etkisi. LoVo hücreleri, 72 saat boyunca mantar özleri ile işleme tabi tutuldu ve E-kaderin ekspresyonu, western-blot (üst panel) ile belirlendi. Western blot verileri, üç bağımsız deneyin temsilcisidir ve dansitometri ile kantifikasyon temsil edilmiştir (alt panel) (D)LoVo kolon kanseri hücrelerindeki metaloproteazların aktivitesi üzerindeki TV ve GF ekstrelerinin etkisi, zimogram analizi ile belirlendi. LoVo hücreleri, 72 saat boyunca belirtilen mantar özlerinin belirtilen konsantrasyonları ile işleme tabi tutuldu ve MMP2 aktivitesi, üst panelde gösterildi. Üç bağımsız deneyin nicelendirilmesi, alt panelde gösterilmektedir. Veriler, üç bağımsız deneyin ortalama ± SD'sidir (* p <0.05, ** p <0.01 ** p <0.001).



      Şekil 5
      Etkisi Trametes versicolor ve Grifola Frondosa LoVo kolon kanser hücrelerinde sitotoksik üzerindeki 5-Fluorourasil ile kombinasyon halinde ekstraktlar. (A) LoVo hücreleri, artan 5-Florourasil konsantrasyonları ile kombinasyon halinde belirtilen Trametes versicolor özütü konsantrasyonu ile işleme tabi tutuldu . (B) LoVo hücreleri, artan 5-Florourasil konsantrasyonları ile kombinasyon halinde belirtilen Grifola frondosa özütü konsantrasyonu ile işleme tabi tutulmuştur . Hücre canlılığı, materyal ve yöntemlerde belirtildiği gibi ölçüldü. Veriler, üç bağımsız deneyin ortalama ± SD'si olarak temsil edilir (* p <0.05, ** p <0.01 ** p <0.001).



      Tartışma
      Basidiomycete mantarlarının terapötik antikanser özellikler sergilediği gösterilmiştir, çünkü birincil olarak bir dizi biyolojik olarak aktif bileşik içerirler. Bu etki esas olarak polisakkaritlerin ve bunların türevlerinin varlığıyla bağlantılıdır. Bazı tıbbi mantar türleri, kanser kemoterapisi ile birlikte adjuvan olarak çalışabilen, antitümör aktiviteye sahip biyoaktif bileşikler üretir. Aslında, Grifola frondosa ve Trametes versicolor türlerinden elde edilen polisakkarit açısından zengin özütlerin kanser hastalarında önemli klinik faydalar sağladığı zaten gösterilmiştir [ 21 , 22]. Son kanıtlar, bağışıklık sistemi üzerindeki etkisinden bağımsız olarak kanser hücrelerinde polisakkarit ekstraktlarının doğrudan bir antitümör etkisine işaret etti. Bu çalışmada, insan kolon kanseri hücre dizilerinde antitümör etkisine dahil olan olası moleküler mekanizmayı araştırmak için GF ve TV'den polisakkarit bakımından zengin özütler kullandık. Sonuçlarımız, GF ve TV'den gelen polisakkarit bakımından zengin özütlerin yalnızca insan kolon karsinom hücrelerinde tümör hücresi çoğalmasını doğrudan inhibe etmekle kalmayıp, aynı zamanda metastatik süreci kolaylaştıran özellikler olan ankrajdan bağımsız hücre büyümesini, hücre göçünü ve istilasını da inhibe edebildiğini göstermektedir. çoklu karsinom tiplerinde [ 14]. Her iki ekstrakt, epitelyal E-kaderin protein markörünü artırarak bir epitel fenotipini indükleyebildi, buna karşın Vimentin mezenkimal markörü LoVo hücrelerinde hemen hemen tespit edilmedi. Önemli olarak, invazif özelliklerin edinimi sırasında E-kaderin kaybı, kolon tümör hücrelerinin metastatik sürecine bağlanmıştır [ 23 , 24 ]. Ek olarak, her iki ekstrenin de MMP-2 aktivitesini önemli ölçüde azalttığını gözlemledik. Önemli olarak, MMP-2 hücre dışı matrisi bozar ve kolorektal kanserde hücre büyümesini ve invazyonunu destekler ve düşük MMP-2 seviyeleri meme kanserinde sağkalım ile ilişkilidir [ 25 - 27]. MMP aktivitesinin, transkripsiyon, mRNA yarılanma ömrü, sekresyon, lokalizasyon, proteolitik yarılma ile regülasyon, proteinaz inhibitörleri veya translasyon sonrası modifikasyon (fosforilasyon veya asetilasyon gibi) gibi farklı seviyelerde düzenlenebileceği bildirilmiştir. Bununla birlikte, MMP-2 aktivitesinin bu iki TV ve GF ekstresi tarafından düzenlendiği en olası mekanizmayı belirlemek için daha fazla çalışmaya ihtiyaç vardır. Her iki ekstrenin de MMP-2 aktivitesini azaltabilmesi ve E-kaderin protein seviyelerini artırabilmesi gerçeği, en azından kısmen, insan kolon kanseri hücrelerinde hücre göçünü ve invazivliği engelleyebilecek mekanizmayı açıklayabilir. Bununla birlikte, TV alıntılarını kullanan diğer önceki çalışmaların farklı etkilere sahip olduğu bildirildi. Örneğin,28 ]. Öte yandan, insan pankreas ve mide kanseri hücre hatlarında TV'den ekstrakte edilen proteine ​​bağlı polisakkarit-K kullanılarak her iki enzimin inhibisyonu tespit edildi [ 29 ]. İlginç bir şekilde, her iki çalışmada da anti-göç aktivitesinin proliferatif aktiviteyle bağlantılı olmadığı gösterilmiştir. Bu çalışmada, GF ve TV'den geliştirilmiş polisakkarit bakımından zengin özütler, insan kolon kanseri hücrelerinde anti-proliferatif ve anti-migratuar bir etki göstererek, ekstrelerin insan kolon kanseri tedavisindeki potansiyel faydasını daha da destekledi.

      Pek çok çalışma, kolon kanseri hücrelerinde GF ve TV'den polisakkarit bakımından zengin ekstrelerin doğrudan bir etkisini bildirmemiştir ve genel olarak, bildirilen araştırmalar, farklı sonuçlarla murin kanser hücrelerinde yapılmıştır. Örneğin, GF'den bir heteropolisakkarit (MZF) fare kolon-26 hücreleri kullanılarak in vitro hücre proliferasyonunu etkilememiştir [ 30 ]. Öte yandan, TV polisakkarit yönünden zengin özütlerin apoptozu inhibe ederek bir insan kolon karsinom hücre dizisinde hücre canlılığını azalttığı gösterilmiş olmasına rağmen [ 31 ], insan pankreas ve mide kanseri hücre dizilerinde hücre proliferasyonu üzerinde hiçbir etki gözlenmemiştir [ 29]. Bu çalışmada geliştirilene benzer şekilde TV'den bir su özütü, daha yüksek bir konsantrasyonda (2 mg / mL) bile fare meme karsinomunda sitotoksisite etkisi göstermedi [ 28]. Bildirilen bu çalışmada, polisakkarit içeriğinin yalnızca% 8.34 (ağırlık / ağırlık) olduğu, çalışmamızda ise daha yüksek bir göreceli biyoaktif polisakkarit fraksiyonunun elde edildiğini (glukan içeriğinde% 45 ila 74) not etmek önemlidir. Bu farklılıklar, farklı hücre dizilerindeki farklı sitotoksisite etkisini açıklayabilir, ancak aynı zamanda meyve gövdesi kompozisyonundan veya gerçekleştirilen ekstraksiyon prosedürlerinden de etkilenebilir. Verilerimiz, bu çalışmada elde edilen ekstrelerin kanser hücresi çoğalmasını etkileyebileceğini ve kanser hücrelerinde bu etkileri gözlemlemek için kullanılan üretim tekniklerinin kritik önemini pekiştirdiğini düşündürmektedir. Son olarak, 5-florourasilin her bir polisakkarit yönünden zengin özütle kombinasyonu hücre sitotoksisitesini artırır. Bu veriler, 5-Fu gibi belirli kemoterapötik ajanlarla birlikte bu ekstraktlar için potansiyel bir adjuvan rolü olduğunu göstermektedir. Hepsi birlikte ele alındığında, polisakkarit bakımından zengin GF ve TV ekstrelerinin diğer insan kanser hücrelerindeki potansiyel antitümör etkisi vein vivo model sistemleri aydınlatılmayı beklemektedir. Ayrıca, yeni geliştirilen bu iki GF ve TV özütünün güvenliğini ve etkinliğini daha fazla değerlendirmek için gelecekteki klinik araştırmalara ihtiyaç vardır.

      Teşekkürler
      Bu çalışma, Fondo Europeo de Desarrollo Bölgesel (FEDER) "Avrupa Yapmanın Bir Yolu" tarafından finanse edilen Endüstriyel Teknolojik Gelişim Merkezi (CDTI, Interconecta Programı, 2015) ve CZ Veterinaria, SA şirketleri tarafından desteklenmiştir. ve Hifas da Terra SL Roca-Lema, Fundación Profesor Novoa Santos'un uzmanlık sonrası bursuyla desteklenmiştir, Diaz-Diaz, İspanya'dan Ministerio de Educación Cultura y Deporte ve Casas-Pais'in FPU sözleşmesiyle (FPU014 / 02837) desteklenmiştir Axencia Galega de Innovación (GAIN) -Consellería de Economía, Xunta de Galicia, İspanya'dan Empleo e Industria'dan bir predoktoral sözleşme (IN606A-2017/013) ile desteklenmiştir.

      Referanslar : https://www.medsci.org/v16p0231.htm

      Yorum yap


      • #4
        Bir Maitake ( Grifola frondosa ) polisakkaridi, mikroglial amiloid-klirensini artırarak Alzheimer hastalığına benzer patolojiyi ve bilişsel bozuklukları iyileştirir.
        Yao Bai , † birORCID logosu Lingling Chen , † bir Yao Chen , bir Xinmeng Chen , b Yilong Dong , bir Shangyong Zheng , bir Lei Zhang , c Weiyuan Li , bir Jing Du * a ve Hongliang Li * a

        Öz
        Alzheimer hastalığı (AD), amiloid-p (Ap) plaklarının birikmesi, nöronal kayıp ve nörofibriler yumaklarla karakterizedir. Ek olarak, nöroinflamatuar süreçlerin AD patofizyolojisine katkıda bulunduğu düşünülmektedir. Yenilebilir / tıbbi bir mantar olan Maitake ( Grifola frondosa ), yüksek besin değeri sergiler ve büyük miktarda sağlığa yararlı, biyoaktif bileşikler içerir. Maitake'den (PGM) türetilen bir polisakkarit olan proteo-β-glukanın güçlü immünomodülatör aktivitelere sahip olduğu bildirilmiştir. Bununla birlikte, PGM'nin APP swe / PS1 ΔE9 üzerindeki immünomodülatör ve nöroproteksiyon etkilerinden sorumlu olup olmadığıAD'nin yaygın olarak kullanılan bir hayvan modeli olan (APP / PS1) transgenik fareler belirsizliğini korumaktadır. Mevcut çalışmada sonuçlar, PGM'nin APP / PS1 farelerinde öğrenme ve hafıza bozukluğunu iyileştirebileceğini, nöron kaybını ve histopatolojik anormallikleri azaltabileceğini gösterdi. Ek olarak, PGM tedavisi mikroglia ve astrositleri aktive edebilir ve Aβ plaklarına mikroglial katılımı teşvik edebilir. Ayrıca PGM, Ap fagositozunu artırabilir ve böylece AP yükünü ve APP / PS1 farelerinde korteks ve hipokampustaki patolojik değişiklikleri hafifletebilir. Ayrıca, PGM, farelerin vücut ağırlığı üzerinde önemli bir etki göstermedi. Sonuç olarak, bu bulgular PGM yönetim hafıza bozukluğu artırabilirsiniz belirtti aracılığıyla immünomodülatör etki ve PGM ile diyet takviyesi, beyin yaşlanmasına bağlı hafıza disfonksiyonu üzerinde potansiyel faydalar sağlayabilir.


        Giriş
        Alzheimer hastalığı (AD) en yaygın nörodejeneratif hastalıktır ve yaşlanan popülasyonda en yaygın amnezi nedenidir. 1 Dünya çapında 150 milyona yakın insanın AD'den etkilendiği tahmin edilmektedir, bu da aile ve toplum üzerinde muazzam bir mali yük oluşturmaktadır. 2,3 AD'nin patofizyolojisinin anlaşılmasında kayda değer ilerlemeye rağmen, mevcut farmakoterapötik seçenekler hala çok sınırlıdır. Bu nedenle AD'nin başlamasını önlemek ve ilerlemesini geciktirmek için uygun ilaç bulmamız gerekmektedir. Amiloid-β (Aβ) agregasyonunun ve birikiminin, AD patogenezinde nöronal disfonksiyon, tau agregasyonu ve hiperfosforilasyon ve nöronal ölüm dahil olmak üzere bir dizi olayları başlatan kritik bir erken olay olduğu bildirilmiştir. 1,4 Aβ birikiminin beyindeki Ap üretimi ve klirens arasındaki bir dengesizlikten kaynaklandığı gösterilmiştir. Aβ klirensinin bozulmasının en yaygın AD tipinden sorumlu olduğuna dair artan kanıtlar vardır. 5,6Bu nedenle, Aβ homeostazının dengesizliğini gidermek ve beyinden Aβ plaklarının aşırı üretimini ortadan kaldırmak, AD'ye karşı koymak için etkili stratejiler olabilir. Mikroglia ve astrositler, nöroinflamasyonun düzenlenmesinde ve Aβ birikiminin düzenlenmesinde rol oynayan iki ana glial hücre türüdür. Microglia'nın, AD ilerlemesi üzerinde potansiyel olarak koruyucu etki ile Ap agregatlarının fagositozu ile Ap birikiminin derecesini düzenlediği düşünülmektedir. 7,8 Konakçıya faydalı etkiler sağlamanın yanı sıra, mikroglialin kronik aktivasyonu ayrıca nörotoksik inflamatuar sitokinlerin ve reaktif oksijen türlerinin aşırı üretimine yol açtı. 9Birlikte ele alındığında, mikroglia'nın net bir koruyucu veya zararlı etkiye sahip olup olmadığı ve mikroglia'nın AD nöropatolojisinin seyrini değiştirdiği kesin mekanizmalar hala tam olarak anlaşılamamıştır. Bu nedenle, mikroglia'nın Ap klirensine nasıl dahil olduğunu açıklamak ve AD'nin hastalığın ilerlemesindeki rollerini karakterize etmek zorunludur. Alternatif ve tamamlayıcı bir terapi olarak fonksiyonel besinler son yıllarda büyük ilgi gördü. AD'yi tedavi etmek için bazı fonksiyonel gıdaların hedef adaylar olabileceği öne sürülmüştür. 10,11 Örneğin, zencefil ve yaşlanmış sarımsak özütünün AD ile ilişkili amnezi ve nörodejeneratif bozuklukların tedavisinde etkili olduğu bulunmuştur. 10,12 Pek çok fonksiyonel gıda gibi, yenilebilir / tıbbi bir mantar olan Maitake ( Grifola frondosa ), Çin'de geleneksel olarak sağlığı geliştirme ve uzun ömürlülük için kullanılmaktadır. 13Farmakolojik çalışmalar, Maitake'den izole edilen polisakkarit fraksiyonlarının, anti-tümör, anti-inflamasyon ve immünomodülasyon dahil olmak üzere birçok fizyolojik ve sağlıklı teşvik edici etki gösterdiğini ortaya koydu. 14 Pek çok biyolojik aktivitesi arasında, polisakkaritlerin immün aktivitesi, bağışıklık organlarını, bağışıklık hücrelerini ve bağışıklık moleküllerini düzenleyerek vücudun bağışıklık fonksiyonlarını düzenleyebilen dikkate değer bir özellik olarak kabul edilmektedir. 15 Daha önce, Maitake'nin (PGM) polisakkarit biyoaktif bir bileşeni olan proteo-β-glukanın da nörofarmakoloji aktivitesine sahip olduğunu bildirmiştik. 16 Son zamanlarda, Maitake ekstre edildi polisakaritler, bilişsel işlevi arttırmak olabilir bulunmuştur ileoksidatif stresi inhibe etmek. 17 Ancak, PGM mikroglia faaliyete geçmesine aracılık ve immünomodülatör özelliğine katkıda AD patolojik özellikleri, geliştirmek, ister belirsizliğini koruyor. Bu nedenle, bu çalışmada, PGM'nin, yerleşik bir AD fare modeli olan APP / PS1 farelerindeki bilişsel bozukluk ve nöropatoloji üzerindeki etkilerini araştırdık. Ayrıca, etkilerinin altında yatan hücresel ve moleküler mekanizmaları da aydınlattık.

        Malzemeler ve yöntemler
        Hayvanlar

        C57Bl / 6J geçmişine sahip erkek APP / PS1 çift transgenik fareler, Nanjing Üniversitesi Model Hayvan Araştırma Merkezi'nden (Nanjing, Çin) satın alındı. Yunnan Üniversitesi Tıp Fakültesi'nde vahşi tip (WT) C57BL / 6J dişileriyle yetiştirildiler. Yavruların kuyruğu kesildi ve genotipler, APP / PS1 yapısının APP sekansına özgü primerler kullanılarak polimeraz zincir reaksiyonu (PCR) ile doğrulandı (ileri GACTGACCACTCGACCAGGTTCTG; GTGGATAACCCCTCCCCCAGCCTAGACC; ters: CTTGTAAGTTGGATTCAGTCATATCCG). APP / PS1 transgenik yapısı için heterozigot olan yavru erkekler daha sonra WT yavruları ile yaş eşleştirildi, kontrol olarak kullanılan transgeni ifade etmedi. Her iki fare grubu da bir hayvan odasında ( kafes başına n = 4) gruplandırıldı ve yiyecek ve suya erişmelerine izin verildiad libitum . Hayvanlar, sıcaklık kontrollü bir oda (22 ± 1 ° C) içinde 12 saatlik bir aydınlık / karanlık döngüsünde (ışıklar 8:00 AM / 20: 00 PM'de açılıp / kapanarak) tutuldu. Tüm hayvan prosedürleri, Laboratuvar Hayvanlarının Bakım ve Kullanım Kılavuzuna (ISBN: 0-309-05377-3) uygun olarak gerçekleştirildi ve Yunnan Üniversitesi Kurumsal Hayvan Etik Komitesi (ynucare 20180015) tarafından onaylandı.

        Maitake'den proteo-β-glukanın hazırlanması (PGM)
        Yöntem, önceki literatürümüzde açıklanmıştır. 16 Kısaca, Maitake D-fraksiyonu, daha önce Mushroom Wisdom, Inc. tarafından açıklandığı gibi standart bir prosedürle hazırlanan Maitake mantarlarından ekstrakte edildi. Bu standart yöntem kullanılarak elde edilen D-fraksiyonu, molekül ağırlığı 1200 - olan tek bir tepe gösterdi. HPLC analizine göre 2000 kDa ve% 98 polisakkarit ve% 2 peptitten oluştu. Malzemeleri Mushroom Wisdom Inc'den (East Rutherford, NJ, ABD) satın aldık ve ürünler, su ve gliserol içinde% 30 D-fraksiyon çözeltisi içerecek şekilde etiketlendi. Suyu ve gliserolu çıkarmak için üçlü hacimde% 95 etanol çökeltme prosedürü uyguladık. Oda sıcaklığında 60 dakika süre ile kuluçkaya bırakılması ve sonra, numuneler 12 000 RCF dakika santrifüj edildi -14 ° C'de 60 dakika Çökelti hava ile kurutuldu ve hayvanın ağızdan tatbikatı için salin içinde yeniden çözüldü. Etanol ekstraksiyonundan sonra, elde edilen proteo-p-glukan, Maitake'den (PGM) proteo-p-glukan olarak tanımlandı. Daha sonra, karışım oda sıcaklığında 1 saat süre ile inkübe edildi ve daha sonra 12 000 RCF dakika santrifüjlendi -1 , 4 ° C de 1 saat karıştırıldı. Çökelti hava ile kurutuldu ve daha ileri deneyler için salin içinde yeniden çözüldü.

        Gruplar ve ilaç yönetimi
        APP / PS1 fareleri (6 aylık) ve yaşları eşleştirilmiş WT yavru arkadaşları aşağıdaki sekiz gruba ( grup başına n = 12) rastgele atandı , yani WT, WT + PGM (5, 10 ve 20 mg kg- 1 sırasıyla günlük), APP / PS1 ve APP / PS1 + PGM ( sırasıyla günde 5, 10 ve 20 mg kg- 1 ) grupları.Farelere, 10 mL kg- 1 vücut ağırlığı hacminde arka arkaya 3 ay boyunca sabahları (9:00 AM ve 11:00 AM arasında) intraperitoneal PGM veya salin enjeksiyonu yapılmıştır . Ardından, davranışsal değerlendirmeler 7 gün art arda günde bir kez yapıldı. Davranışsal değerlendirme döneminde, 7 gün süren farelere hala PGM veya tuzlu su uygulandı. Son ilaç uygulamasından sonraki ikinci günde tüm fareler öldürüldü ( Şekil 1 ).

        Morris su labirenti (MWM) testi
        PGM tedavisinin farelerin uzamsal öğrenme ve hafıza yetenekleri üzerindeki etkisi MWM testi kullanılarak değerlendirildi. Kısaca, labirent, su yüzeyinin 1 cm altına yerleştirilmiş bir batık kaçış platformuna (10 cm çapında) sahip paslanmaz çelik bir havuzdan (120 cm çapında ve 50 cm yüksekliğinde) oluşuyordu. Su sıcaklığı 23 ± 1 ° C'de tutuldu. Fareler rastgele olarak labirent duvarına bakan dört kadrandan birine yerleştirildi ve platformu aramaya bırakıldı. Gizli platformu bulmak için gereken süre kaçış gecikmesi olarak kaydedildi. Farelere gizli platformu bulmaları için maksimum 60 saniye verildi. Fare platformu 60 saniye içinde bulamazsa, platforma yönlendirildi ve 3 saniye kalmasına izin verildi ve maksimum kaçış gecikmesi puanı 60 s atandı. Uzamsal öğrenme görevi, günde üç deneme ile art arda altı günlük testten oluşuyordu. Uzamsal hafızayı test etmek için, son uzaysal öğrenme görevinden yirmi dört saat sonra tek bir araştırma denemesi yapıldı. Fareler, hedef çeyreğin karşısındaki çeyreğe yerleştirildi. Farelerin 60 saniye boyunca platform olmadan serbestçe yüzmesine izin verildi. Bu çeyrekten geçenlerin sayısı kaydedildi.
        Beyin bölümlerinin hazırlanması
        Davranış testlerini takiben, farelere 10 g vücut ağırlığı başına 0.1 mL hacimde kloral hidrat (400 mg kg- 1 ) ile anestezi uygulandı ve yaklaşık 20 dakika boyunca fosfat tamponlu salin (PBS; Boster, Çin) ile transkardiyal olarak perfüze edildi. 20 dakika daha PBS içinde% 4 soğuk paraformaldehit (PFA) ile. Beyinler, gece boyunca% 4 PFA içinde sabitlendi ve daha sonra, beyin dehidrasyon için dibe batana kadar 4 ° C'de% 10,% 20 ve% 30 sükroz içine daldırıldı. Seri koronal kesitler (5 um ve 20 um) bir dondurucu mikrotomda (LEICA CM1950, Almanya) kesildi. Tüm kesitler, 50 ° C'lik sabit bir kurutucuda 1 saat pişirildikten sonra spesifik bir donmuş çözelti içinde -80 ° C'de saklandı.

        Hematoksilen ve eozin boyama ile histolojik analiz
        -80 ° C'de saklanan koronal kesitler (5 μm) oda sıcaklığında 15 dakika bekletildi. Daha sonra, kesitler, Mayer hematoksilenini takiben Eosin-Floksin B ile boyandı. Lamellerle monte edildikten sonra, iki taraflı hipokampal dentat girus (DG), CA1 ve CA3 alanları hasarı, bir ışık mikroskobu (Leica DM2500, Almanya) altında gözlendi.
        Nissl boyama
        Nissl boyaması için, oda sıcaklığında 15 dakika tutulduktan sonra kesitler, 3 dakika boyunca PBS ile durulanmıştır. Daha sonra kesitler, oda sıcaklığında 5 dakika süreyle% 95 etanol içine daldırıldı, ardından% 0.1 Nissl boyama çözeltisine (Cresyl Fast Violet) (C9140-1g, Cat: G1430, Lot: MKCC9169, Solarbio) 30 dakika süreyle daldırıldı. 60 ° C'de fırın. Daha sonra, bir ışık mikroskobu (Leica DM2500, Almanya) altında görüntüleme için kesitler monte edildi.
        İmmünohistokimya
        Bölümler% 0.3 ile inkübe edilmiştir, H 2 O 2 metanol 10 dakika endojen peroksidazlar inhibe için. PBS ile üç kez yıkandıktan sonra kesitler, oda sıcaklığında 20 dakika boyunca% 10 normal keçi serumu ile bloke edildi ve daha sonra birincil antikor anti- Ap 1-42 (1: 200, 14974, CST, ABD) ile gece boyunca 4 ° C'de inkübe edildi. C. Yıkamadan sonra kesitler, biyotinlenmiş anti-tavşan ikincil antikorları (Boster, Çin) ile PBS içinde 37 ° C'de 30 dakika süreyle inkübe edildi. Daha sonra kesitler, avidinbiotin peroksidaz çözeltisi (SABC kiti, Boster, Çin) ile inkübe edildi ve 3,3-diaminobenzidin (DAB) kiti (Boster, Çin) ile renklendirildi. Kesitler, bir ışık mikroskobu (Leica DM2500, Almanya) altında gözlendi.
        İmmünofloresan
        Kullanımın ardından bölümler, PBST (PBS içinde% 0.2 Tween-20) ile üç kez durulanmış ve 1 saat boyunca PBST içinde% 1 BSA ile bloke edilmiştir. Daha sonra kesitler, Iba1 (Kat no .: ab5076, Parti: GR237928-2, 1: 100, Abcam) ve GFAP (Kat no .: 12389S, Parti: D1F4Q, 1: 200, Hücre Sinyal Teknolojisi) gece boyunca 4 ° C'de. Yıkandıktan sonra, kesitler Alexa Fluor 488-konjuge keçi anti-fare IgG (Kat no .: 805-545-180, Lot: 139171, Jackson) veya Alexa Fluor 594-konjuge keçi anti-tavşan IgG (Kat no. : 711-585-152, Lot: 136429, Jackson) 4 ° C'de 1 saat boyunca% 5 BSA içeren PBST içinde ve nükleer 4p, 6-diamidino-2-fenilindol (DAPI) ile boyandı. Daha sonra kesitler fotoğrafa kadar saklanmak üzere karanlık bir kutuya aktarıldı.
        Görüntü analizi
        Her bir fareden alınan bölümler ( n = 5-8) seçildi ve bir Leica mikro-skop (Leica DM2500, Almanya) üzerine monte edilmiş bir video kamera ile sayısallaştırıldı. Resimler, Image-Pro Plus yazılımı (sürüm 6.0) ve Adobe Photoshop CS5 (Adobe sistemi) kullanılarak işlenmiştir. Veriler, toplam 1000 μm × 1000 μm alandaki entegre optik yoğunluk (IOD) ortalama değeri ile sunuldu ve ImagePro Plus sürüm 6.0 yazılımı (Media Cybernetics, Rockville, ABD) ile ölçüldü.
        istatistiksel analiz
        Sonuçlar, Graph Pad Prism Ver. 5.0 (Graph Pad Software, La Jolla, CA, ABD). Tüm veriler ortalama ± SD olarak ifade edilir. İki grup arasındaki farklılıklar Student t- testi veya parametrik olmayan Mann-Whitney U testi ile analiz edilmiş ve çoklu karşılaştırmalar Türkiye post hoc testi ile tek yönlü varyans analizi (ANOVA) ile değerlendirilmiştir . Bir gruptan ortalama artı 2 × standart sapmalardan (SD) daha büyük herhangi bir deneysel veri değeri bir aykırı değer olarak kabul edildi ve analizde dikkate alınmadı. P değeri <0.05 istatistiksel olarak anlamlı kabul edildi.
        Sonuçlar
        PGM, APP / PS1 farelerinde öğrenme ve hafıza eksikliklerini iyileştirdi
        PGM'nin APP / PS1 farelerinin bilişsel işlevi üzerindeki potansiyel terapötik etkisini araştırmak için, uzamsal öğrenmeyi ve hafıza yeteneğini değerlendirmek için MWM testi yaptık. WT fareleri ile karşılaştırıldığında, salinle tedavi edilen APP / PS1 fareleri, eğitim parkurları sırasında platformu (kaçış gecikme süreleri) bulmak için daha fazla zaman harcadı ( Şekil 2 ). Ek olarak, sonda yolundaki platform üzerindeki geçiş sayısı, salinle tedavi edilen APP / PS1 farelerinde WT farelerininkinden daha düşüktü. Sonuçlar, salinle tedavi edilen APP / PS1 farelerinin uzamsal öğrenme açısından önemli ölçüde azalmış bilişsel yeteneğe sahip olduğunu gösterdi. Bu tür bir eksiklik, PGM tedavisi ile iyileştirildi ve PGM 10 mg kg- 1 tedavisi, APP / PS1 farelerinde kaçış gecikmesini önemli ölçüde eski haline getirdi ( P <0.05) (Şekil 2B ). Bu arada, prob testinde, salinle tedavi edilen APP / PS1 fareleri ile karşılaştırıldığında, 10 mg kg- 1 (APP / PS1-PGM 10 mg kg - 1 ) ( P <0.05) ( Şekil 2D ). Bu mevcut veriler, PGM'nin APP / PS1 farelerinde öğrenme ve hafıza yeteneğini geliştirdiğini öne sürdü. Dahası, WT fareleri arasında kaçış gecikme sürelerinde önemli bir fark vardı ( Şekil 2C).). Sonuçlar, PGM tedavisinin WT farelerinin aktivitesini etkilemediğini gösterdi. Ek olarak, deney dönemi boyunca tüm farelerin vücut ağırlıkları biraz arttı, ancak sekiz grup arasında vücut ağırlığı artışında önemli bir fark vardı ( Tablo 1 )

        İncir. 2 PGM, Morris su labirenti testinde APP / PS1 farelerinde öğrenme ve hafıza eksikliklerini iyileştirdi. n = grup başına 12 fare. (A) Yüzme yolundaki değişiklikler. (B ve C) APP / PS1 (B) ve WT farelerinde (C) gizli bir platform bulma gecikmesi. (D ve E) APP / PS1 (D) ve WT farelerinde (E) uzamsal araştırma testi sırasında platform geçiş sayısı. # P <0.05 WT-saline karşı , * P <0.05 , APP / PS1-saline karşı.
        Tablo 1 PGM tedavisi süresince her bir fare grubundaki ağırlık değişiklikleri. Veriler ortalama ± SD olarak ifade edilir ( grup başına n = 12)

        PGM, APP / PS1 farelerinde hipokampal alanın histolojik ve morfolojisini iyileştirdi
        Hipokampal bölgenin öğrenme ve hafızadaki hayati rolü göz önünde bulundurularak, hipokampal hücrelerin sayısı ve morfolojisi H&E ve Nissl boyama kullanılarak incelendi. Şekil 3'te gösterildiği gibi , WT farelerindeki DG, CA1 ve CA3 hipokampal hücreleri, farklı kenarlara ve açık bir nükleolus ve çekirdeğe sahip düzenli bir düzenleme sergiledi ve salinle tedavi edilen APP / PS1 farelerine kıyasla daha az interstisyel boşluk bulundu. Bununla birlikte, salinle tedavi edilen APP / PS1 farelerinde çok sayıda nöronal nekrotik hücre ve net olmayan bir mimariye sahip hasarlı nöron gözlendi. Ek olarak, hücreler seyrek ve bu gruptaki çekirdek piknotik ile düzensiz bir şekilde düzenlenmiştir. Salinle tedavi edilen APP / PS1 fareleri ile karşılaştırıldığında, PGM ile tedavi edilen APP / PS1 fareleri (5 ve 10 mg kg- 1) açıkça azalmış bir nekrotik nöron sayısı gösterdi ( Şekil 3 ). Nöronal morfolojinin anormallikleri, PGM tedavisi ile iyileştirildi. Üstelik, geçiş boşluğunun, salinle muamele edilmiş APP / PS1 farelerine kıyasla PGM ile muamele edilmiş APP / PS1 farelerinde daha dar olduğu bulunmuştur ( Şekil 3 ). Bununla birlikte, 20 mg kg- 1 dozajında ​​PGM'nin terapötik etkisi açık değildi.

        Şek. 3
        Hipokampal bölgelerde nöronal morfolojinin H&E boyaması (DG, CA1 ve CA3 dahil). (A – C) APP / PS1 fare gruplarının temsili görüntüleri. (D ve E) WT fare gruplarının temsili görüntüleri. Ölçek çubuğu = 100 μm. n = grup başına 5-8 fare.
        Nissl boyaması, WT farelerine kıyasla salinle tedavi edilen APP / PS1 farelerinde hipokampal alanda nöron sayısının önemli ölçüde azaldığını gösterdi ( Şekil 4 ). Nissl boyamasından elde edilen sonuçlar, yukarıda bahsedilen sonuçlarla tutarlıydı. PGM ile tedavi edildikten sonra, bozulmuş hipokampal hücre morfolojisi hafifletildi ve Nissl cisimciklerinin sayısı önemli ölçüde arttı ( Şekil 4 ). Görünüşe göre, salinle tedavi edilen APP / PS1 farelerine kıyasla PGM 5 ve 10 mg kg- 1 ile tedavi edilen APP / PS1 farelerinde nöron sayısındaki azalma önemli ölçüde daha düşüktü ( sırasıyla P <0.05 ve P <0.01) ( Şekil . 4B). Ek olarak, salinle tedavi edilmiş APP / PS1 fareleri ile karşılaştırıldığında, PGM ile tedavi edilmiş (5 ve 10 mg kg- 1 ) APP / PS1 fareleri, nöronal morfolojide önemli ölçüde iyileşmiş anormallikler gösterdi. Bu mevcut veriler, PGM'nin APP / PS1 farelerinde hipokampal bölgenin anormalliklerini iyileştirebileceğini ve hipokampal nöronların morfolojisi üzerinde koruyucu etkiye sahip olduğunu gösterdi.

        Şekil 4
        Hipokampal DG bölgesinde nöronal morfolojinin Nissl boyaması. (A) Nissl lekeli DG hipokampal hücrelerin temsili ışık mikrografları. Ölçek çubuğu = 100 μm. (B) Hipokampusun DG bölgelerindeki Nissl hücrelerinin kantitatif analizi. n = grup başına 5-8 fare. # P <0.05 WT-saline karşı , * P <0.05'e karşı APP / PS1-saline, ** P <0.01 - APP / PS1-saline karşı.
        PGM, APP / PS1 farelerinde Ap plak yükünü hafifletti
        Daha sonra, PGM'nin etkisini Ap patolojisinin hafifletilmesi üzerinde uygulayıp uygulamadığını araştırdık. APP / PS1 farelerinde amiloid yükünün incelemek için, anti-Ap ile immüno-lekeleme 1-42 antikorunun beyin bölümlerinde gerçekleştirilir, ve miktarı Ap edilmiş 1-42 plaklar ölçülmüştür. WT fareleri ile karşılaştırıldığında, APP / PS1 fareleri , korteks ve hipokampal bölgede (DG, CA1 ve CA3 dahil) Apı.42- pozitif plaklarla kaplanan ortalama alanın önemli ölçüde daha yüksek olduğunu gösterdi ( Şekil 5A-D ). Bununla birlikte, Ap plaklarını içeren ortalama alan, PGM ile tedavi edilen APP / PS1 farelerinde salinle tedavi edilen APP / PS1 farelerininkinden önemli ölçüde daha azdı ( Şekil 5E-H ). Sonuçlar PGM önemli mm başına plak sayısı azaltılmış olduğunu göstermiştir 2Ap 1-42 pozitif plaklar PGM Ap patoloji hafifletilmesi üzerindeki etkisi gösterdiği göstermektedir, salin ile tedavi edilmiş APP / PS1 fareler ile karşılaştırıldığında.

        Şekil 5
        PGM , APP / PS1 farelerinde beyin Ap 1-42 yükünü hafifletti . (A – D) Serebral kortekste ve hipokampusun DG, CA1, CA3 bölgelerinde Ap 1-42 birikintilerinin sırasıyla temsili görüntüleri . Ölçek çubuğu = 100 μm. (E – H) Sırasıyla serebral kortekste Ap 1-42 alanı ve hipokampusun DG, CA1, CA3 bölgelerinin ölçümü . n = grup başına 5-8 fare, hayvan başına üç bölüm. * P <0.05 , APP / PS1-saline karşı, ** P <0.01 , APP / PS1-saline karşı, *** P <0.001 , APP / PS1-saline karşı.
        PGM, APP / PS1 farelerinde hipokampal bölgede glial hücre aktivasyonunu arttırdı
        Merkezi sinir sisteminde bol miktarda bulunan hücre tipleri olan Glia hücrelerinin, özellikle AD patolojisinde hem normal hem de hastalık durumlarının düzenlenmesinde önemli roller oynadığı gösterilmiştir. 18 PGM'nin glialin aktivasyonu üzerindeki etkisini araştırmak için astrosit işaretleyici (GFAP) ve mikroglial işaretleyici (Iba1) ekspresyonu, APP / PS1 farelerinin hipokampal DG bölgesinde immünofloresan boyama kullanılarak belirlendi ( Şekil 6A-D ). Salinle tedavi edilen APP / PS1 fareleri ile karşılaştırıldığında, 10 mg kg- 1 dozajında ​​PGM ile muamele edilmiş APP / PS1 fareleri , hipokampal DG'de önemli ölçüde artmış sayıda aktive astrosit ve mikroglia gösterdi ( sırasıyla P <0.01 ve P <0.05, ) ( Şekil 6E ve G). Ek olarak, hipokampal DG'deki aktive astrositlerin ve mikrogliaların boyutu, salinle tedavi edilen APP / PS1 farelerininkinden daha büyüktü ( Şekil 6A ve C ). 5 ve 20 mg kg- 1 gruplarının dozajında ​​PGM ile muamele edilmiş farelerde önemli bir fark olmamıştır . Bununla birlikte, WT farelerinde, PGM ile tedavi edilen fareler ile salinle tedavi edilen fareler arasında glia hücre aktivasyonunda önemli bir fark vardı ( Şekil 6F ve H ).

        Şekil 6
        PGM, APP / PS1 farelerinin hipokampal bölgelerinde glial hücre aktivasyonunu arttırdı. (A) APP / PS1 farelerinde hipokampın DG bölgelerinde Floresan GFAP (kırmızı) / DAPI (mavi) kolokalizasyonu. Ölçek çubuğu = 100 μm. (B) WT farelerinde hipokampın DG bölgelerinde Floresan GFAP (kırmızı) / DAPI (mavi) kolokalizasyonu. Ölçek çubuğu = 100 μm. APP / PS1 farelerinde hipokampın DG bölgelerinde (C) Floresan Iba1 (kırmızı) / DAPI (mavi) kolokalizasyonu. Ölçek çubuğu = 100 μm. (D) WT farelerinde hipokampın DG bölgelerinde Floresan Iba1 (kırmızı) / DAPI (mavi) kolokalizasyonu. Ölçek çubuğu = 100 μm. (E) Her APP / PS1 fare grubunda GFAP-pozitif hücrelerin miktarının belirlenmesi. n = grup başına 5-8, hayvan başına üç bölüm. (F) Her WT fare grubundaki GFAP pozitif hücrelerin miktarının belirlenmesi. n= Grup başına 5-8, hayvan başına üç bölüm. (G) Her APP / PS1 fare grubundaki Iba1-pozitif hücrelerin kantifikasyonu. n = grup başına 5-8, hayvan başına üç bölüm. (H) Her WT fare grubundaki Iba1 pozitif hücrelerin kantifikasyonu, n = grup başına 5-8, hayvan başına üç bölüm. * P <0.05 , APP / PS1-saline karşı, ** P <0.01 , APP / PS1-saline karşı.
        PGM, plaklar etrafında mikroglial katılımı arttırdı ve Ap fagositozunu ve klirensini teşvik etti

        Microglia, merkezi sinir sistemindeki makrofaj benzeri fagositlerdir. 6 Beyinde hücre dışı Aβ esas olarak fagositozdur ve mikroglia tarafından temizlenir. 18 AP tortularının önemli ölçüde azalmasının, PGM tedavisi üzerine APP / PS1 farelerinde bulunduğu göz önüne alındığında, immünokimya analizi, anti-Iba1 ve anti-Ap 1-42 antikorları kullanılarak mikroglia ve Ap plaklarını birlikte etiketlemek için gerçekleştirildi . Sonuçlar, mikroglianın APP / PS1 farelerinde kortekste ve hipokampal bölgede (DG, CA1 ve CA3 dahil) plaklara bitişik olarak toplandığını gösterdi ( Şekil 7A-D ). Ap çevredeki mikroglia işe 1-42plaklar, PGM muamelesi ile önemli ölçüde artmıştır. Bu alanlarda mikroglia ve Ap plak yükü örtüşme yüzdesi, optik yoğunluk analizi ile belirlendi. Görünüşe göre, PGM'de kortekste (% 73,65 ±% 2,5), DG (% 83,8 ±% 1,51), CA1 (% 73,96 ±% 1,41) ve CA3'te (% 81,07 ±% 0,98) ortak etiketlenmiş mikrogliya yüzdesinde artış gözlenmiştir. Salinle tedavi edilen APP / PS1 farelerine kıyasla 10 mg kg- 1 ile tedavi edilen fareler ( Şekil 7E – H ). Sonuçlar PGM Ap plak yükünü azalttığı ileri ile Ap plak yükü etrafında toplanmış ve bu şekilde fagositoz ve klirens gelen rolü gerçekleştirilen mikroglia hücrelerinin aktivasyonunu teşvik edilmesi.
        Şekil 7
        PGM, APP / PS1 farelerinin hipokampal bölgelerinde mikroglia tarafından glial hücre aktivasyonunu arttırdı ve amiloid endositozunu arttırdı. Hipokampusun korteks (A) ve DG (B), CA1 (C), CA3 (D) bölgelerinde (A – D) Floresan Aβ 1-42 (kırmızı) / Iba1 (yeşil) / DAPI (mavi) kolokalizasyonu APP / PS1 farelerinde. Ölçek çubuğu = 100 μm. (E – H) Hipokampusun korteks (E) ve DG (F), CA1 (G) ve CA3 (H) bölgelerinde de Aβ-pozitif olan Iba1-pozitif mikroglia hücre gövdelerinin yüzdesi. n = grup başına 5-8 fare, hayvan başına üç bölüm. ** P <0.01 - APP / PS1-saline karşı, *** P <0.001 - APP / PS1-saline karşı, **** P <0.0001 - APP / PS1-saline karşı APP / PS1-salin.
        Tartışma
        Geçtiğimiz yıllarda AD'nin patogenezini ve tedavilerini araştırmak için büyük çabalar sarf edilmiştir. Donepezil ve memantin içeren AD tedavisinde kullanılan mevcut ilaçlar çok etkili değildir. 19 Bu nedenle, AD ile mücadele edebilecek etkili müdahalelere ilişkin daha fazla araştırmaya ihtiyaç vardır. Son zamanlarda, multimodal etkileri ve nispeten düşük toksisiteleri nedeniyle, fonksiyonel gıdalar, AD tedavisi için oldukça güçlü ilaç adayları haline gelmiştir. 20 Bu çalışmada, Maitake'nin (PGM) polisakkarit biyoaktif bileşeninin APP / PS1 farelerinde öğrenme ve hafıza eksikliklerini önemli ölçüde azaltabileceğini ortaya çıkardık. Mevcut bulgular, PGM'nin AD tedavisi için bir ilaç olarak kullanılması olasılığını vurguladı. Mantar kralı Maitake ( Grifola frondosa ), en değerli geleneksel ilaçlardan biridir. Çin, Japonya ve diğer Asya ülkelerinde uzun süredir sağlıklı gıda olarak kullanılmaktadır. 15 Maitake ekstre edildi polisakaritler, örneğin immünomodülatör gibi birden fazla etki, anti-tümör ve antioksidan etkilere sahip olduğu rapor edilmiştir. 14 Yakın zamanda yapılan bir çalışmada Chen ve ark. Grifola frondosa polisakkaritlerinin oral uygulamasının yaşlı sıçanlarda antioksidan etki yoluyla hafıza bozukluğunu iyileştirebileceğini bildirmişlerdir . 17Bu tür polisakkaritler biyolojik aktivitelerini esas olarak immünomodülasyon yoluyla gerçekleştirdiler, ancak polisakkaritlerin immün yoluna aracılık ederek öğrenme ve hafıza yeteneğini geliştirip geliştirmediği belirsizliğini koruyor. Ek olarak, AD'nin en ikonik patolojik belirteci olan Ap birikiminde PGM'nin rolü keşfedilmemiştir. Günümüzde, Ap birikimi açısından AD'nin patolojik özelliklerini taklit eden APP / PS1 çift transgenik fareler, AD'nin bir hayvan modeli olarak yaygın şekilde kullanılmaktadır. 21Bu çalışma ayrıca PGM'nin APP / PS1 farelerinde öğrenme ve hafıza bozukluğunu iyileştirebileceğini ileri sürdü ve PGM tedavisinin hayatta kalan nöronların sayısını artırabileceğine ve hipokampusun histomorfolojisini koruyabileceğine dair net kanıtlar sağladı. Ayrıca PGM, Ap plaklarına bitişik mikroglial katılımı artırabilir ve mikroglial fagositik kapasiteyi geliştirebilir ve böylece APP / PS1 farelerinde Ap klirensini teşvik edebilir. Davranışsal sonuçla uyumlu olarak, H&E ve Nissl boyaması, APP / PS1 farelerinin korteks ve hipokampusundaki nöronal hücrelerin, WT farelerine göre önemli ölçüde kayıp ve küçülme olduğunu ortaya çıkardı. Nöronal hücre yoğunluğu ve morfolojisindeki değişiklikler, APP / PS1 farelerinin beyninde bir dizi patolojik modifikasyonun gözlemlendiği önceki çalışma ile tutarlıydı. 19,22 Bu çalışmada, PGM (5 ve 10 mg kg- 1 ) tedavisi ile küçültülmüş nöronların azalması ve iyileştirici hücre morfolojisi bulunmuş , bu da PGM'nin nöroprotektif bir etkiye sahip olduğunu göstermektedir. Ayrıca, mm başına Nissl pozitif hücre sayısı, 2 PGM hipokampusun (DG bölgesinde 5 ve 10 mg kg -1) tedavi edilen fareler, salinle tedavi edilen APP / PS1 farelerine kıyasla önemli bir artış gösterdi. Sonuçlar, PGM'nin nöronları hasardan koruyabileceğini ve böylece öğrenme ve hafıza bozukluğunu iyileştirdiğini gösterdi. Beyindeki Aβ birikiminin ve birikmesinin, AD'nin patojenik kaskadlarını harekete geçirebileceği bildirilmiştir. 1 Beynin yerleşik bağışıklık hücreleri olan Microglia, Ap birikimine ve fagositoza ilk yanıt verenlerdir. 23 AD'nin hastalığın ilerlemesi sırasında mikroglia, Ap birikintileri etrafında kümelenir ve plaklara doğru uzanan hipertrofik süreçlerle polarize bir morfoloji benimser. 18 Microglia, amiloid agregatlarının fagositozu ile amiloid birikiminin derecesini düzenleyerek AD ilerlemesi üzerinde potansiyel olarak koruyucu etki yaptı. 24Son zamanlarda, çoklu-duyusal gama uyarımının Alzheimer ile ilişkili patolojiyi iyileştirebildiği ve bilişi geliştirdiği, plaklar etrafında mikroglial toplanmayı artırdığı ve Ap fagositozunun ve temizlenmesinin bu süreçte önemli roller oynadığı bildirilmiştir. 25 Dahası, Zhao ve ark. bir AD fare modelinde mikroglianın tükenmesinin aşırı plak üretimine yol açtığını bildirdi. Ayrıca AD fare modelinde komşu nöronlarda dendritik omurga kaybı ve şaft atrofisi gözlendi. 26 Bununla birlikte, kronik ve sürekli mikroglial aktivasyon, AD'nin hastalığın ilerlemesini ağırlaştıran nörotoksik inflamatuar sitokinlerin ve reaktif oksijen türlerinin aşırı üretimine neden olabilir. 27Ne yazık ki, anti-enflamatuar tedaviyi kabul eden AD hastaları, herhangi bir bilişsel fayda göstermedi, 28 nöroinflamasyonun, AD'nin başlıca nedeni olmadığını öne sürdü. Aslında, nörodejeneratif hastalıktaki iltihap, iki ucu keskin bir kılıçtır. 29 Bu nedenle, glial hücrelerin aktive durumunun ve AD patolojisindeki rollerinin, AD'nin hastalığın ilerlemesi ve AD'yi tedavi etmek için kullanılan ilacın tipi, yoğunluğu ve süresi ile ilişkili olduğunu düşündük. Bu nedenle, belirli mekanizmalar ve bunlara karşılık gelen sonuçlar araştırılmalıdır. Ayrıca, çeşitli kanıtlar, Grifola frondosa'dan elde edilen bir β-glukanın yalnızca çeşitli bağışıklık efektör hücrelerini (makrofajlar, öldürücü T hücreleri ve doğal öldürücü hücreler) doğrudan aktive etmekle kalmayıp , aynı zamanda lenfokinler dahil olmak üzere çeşitli aracıların faaliyetlerini de güçlendirdiğini göstermiştir. ve IL-1 (T hücre hatlarının aktivasyonunda ilk aracı). 14 Dikkat çekici bir şekilde, Grifola frondosa'dan türetilen polisakkaritlerpatolojik koşullar altında bağışıklık sistemini aktive etme olasılığı daha yüksekti ve bu nedenle birden fazla biyolojik aktivite uyguladı. Bununla birlikte, çoğu immünomodülatör gibi, PGM de bağışıklığın düzenlenmesi ve müteakip etkisi üzerinde iki ucu keskin kılıç etkisi gösterdi; makul konsantrasyon ve yoğunlukta faydalı bir etkiye sahiptir, aksi takdirde etkisini uygulamak veya ters etki göstermek zor olabilir. Mevcut çalışmada sonuçlar, PGM'nin APP / PS1 farelerinin öğrenme yeteneği üzerinde en tatmin edici etkiye ve orta dozajda (10 mg kg- 1 ) hipokampus üzerinde en önemli koruyucu etkiye sahip olduğunu gösterdi . Ek olarak, Ap birikintilerinin temizlenmesi ve glial hücrelerin düzenlenmesi, bu dozajda PGM tedavisi ile en etkili oldu. Yüksek PGM dozu (20 mg kg- 1) yukarıdaki etkileri göstermedi. Bu nedenle, PGM'nin takip çalışması, özellikle glial hücreler üzerindeki doz-etki ilişkisi ve AD'deki buna karşılık gelen rol uygulanmalıdır. Ek olarak, başka immün efektör moleküllerinin olup olmadığını ve anahtar sinyal yollarının dahil olup olmadığını araştırmak da dahil olmak üzere PGM'nin terapötik temelini incelemek zorunludur.

        Sonuçlar
        Özetle, sonuçlarımız, Maitake'nin proteine ​​bağlı bir polisakkarit biyoaktif bileşeni olan PGM'nin APP / PS1 farelerinde hipokampal bölgede öğrenme ve hafıza fonksiyonunu ve histopatolojik anormallikleri iyileştirebileceğini gösterdi. Mikroglia ve astrositlerin aktivasyonu ve plaklara mikroglial alımın teşvik edilmesi ve Ap fagositozunun güçlendirilmesi, PGM tedavisi ile bulundu. Bu etkiler, Ap yükünün hafifletilmesine ve hipokampus ve korteksteki patolojik değişikliklere katkıda bulunmuştur. Bu arada, farelerde PGM'nin kronik veya akut kullanımıyla herhangi bir anormallik veya toksisite gözlemlemedik. Bu nedenle PGM, AD tedavisi için umut vaat eden yeni bir aday ilaç olabilir.

        Çıkar çatışmaları
        İlan edilecek herhangi bir çelişki yok.

        Teşekkürler
        Bu çalışma, Çin Ulusal Doğa Bilimleri Vakfı (no. 81860638 ve no. 81860499) ve Yunnan Applied Basic Research projesi (no. 2017FB138) tarafından mali olarak desteklenmiştir.
        Konu mert tarafından (https://bitkiseltedavi.net/vb5/member/685-mert Saat 05 Nisan 2021, 16:22 ) değiştirilmiştir.

        Yorum yap


        • #5
          Maitake mantarının faydaları neler?

          FacebookTwitterE-postaWhatsAppCopy Link
          Bilimsel olarak “Grifola frondosa” olarak bilinen Maitake mantarı Kuzeydoğu Japonya dağlarına özgüdür. Maitake, Japonca “dans eden mantar” anlamına gelir. İnsanların değeri ve sağlık faydaları nedeniyle bir tane bile bulduklarında sevinçten dans ettiği söylenir. Pek çok gıdayla pişirilebilir ve yenilebilir ve artık diyet takviyeleri ve toz olarak bulunabiliyor. Son zamanlarda yapılan araştırmalar, birçok bağışıklık sistemi sorununu ve kanseri önleyici yararı olduğunu göstermektedir.



          Bu mantar adaptojendir ve adaptojenler, herhangi bir zihinsel veya fiziksel zorluğa karşı savaşırken vücuda yardımcı olur. Ayrıca dengesizleşen vücut sistemlerini düzenlemek için çalışırlar. Bu mantar tıbbi bir besin olarak kabul edilir.

          Japonya, Çin ve Kuzey Amerika’nın bazı bölgelerinde yetişir. Meşe, karaağaç ve akçaağaç ağacının dibinde yetişir. Tipik olarak vahşi doğada olduğu gibi büyümemesine rağmen, evde bile yetiştirilebilir. Mantarı genellikle sonbahar aylarında bulabilirsiniz. Maitake mantarı Japonya ve Çin’de binlerce yıldır kullanılmasına rağmen, son yirmi yılda popülerlik kazanmıştır. Faydaları Nelerdir?

          Diğer mantarlarla karşılaştırıldığında, kanseri ve diğer sağlık durumlarını önlemede ve tedavi etmede daha iyi sonuçlar vermiştir. Ayrıca genel bağışıklık üzerinde olumlu bir etkiye sahiptir. Aşağıdaki besin yüküne sahiptir:

          • Antioksidanlar
          • Betaglukan
          • B ve C vitaminleri
          • Bakır
          • Potasyum
          • Lif
          • Mineraller
          • Amino asitler
          • Ayrıca yağsızdır, düşük sodyum ve kalori miktarına sahiptir, kolesterol içermez. Bağışıklık Sistemini Güçlendirir

          Beta glukan adı verilen bir polisakarit lifi içerir. Maitake mantarındaki beta glukanlar, makrofajlar, T hücreleri, doğal öldürücü hücreler ve nötrofil gibi bazı bağışıklık sistemi hücrelerinin üretimini etkinleştirmek ve artırmak için çalışır. Bu hücreler bağışıklık sisteminin hastalığa karşı daha hızlı ve etkili bir şekilde savaşmasına yardımcı olabilir. Bu, hastalıklara karşı direncinizi artırabilir, vücudunuzun hücresel atıkları temizlemesine yardımcı olur ve doku hasarından kurtulmayı hızlandırabilir. Kanserle Mücadeleye Yardım Eder

          Maitake mantarındaki beta glukanlar, makrofajlar olarak adlandırılan beyaz kan hücrelerini harekete geçirmeye ve üretmeye yardımcı olur. Makrofajlar, vücutta tümör hücrelerini emmek ve yok etmek için çalışır. Bu, kemoterapinin daha etkili olmasına yardımcı olabilir. Ayrıca, bulantı, kusma ve saç dökülmesini azaltarak anti-kanser ilaçlarının yan etkilerini azalttığı gösterilmiştir.
          2013’te yapılan bir araştırma, göğüs kanserinin önlenmesi ve tedavisinde yararlı olabileceğini gösteriyor. Araştırmacılar, bu mantarın kanserli hücrelerin büyümesi ve çoğalmasıyla savaşabileceğini öne sürüyor. Farelerde tümör büyümesini bastırdığı gösterilmiştir. Ayrıca tümöre karşı savaşan hücrelerin sayısını artırabilir. Bu sonuç, oral yolla alındığında insanlarda kanser yönetiminde de etkili olabileceğini düşündürmektedir. Aynı zamanda kanserle savaşan bir proteinle beraber alındığında, proteinin etkinliğini artırmayı başardı. Kan Şekeri Seviyesini Düşürmeye Yardım Eder

          Keiko Kubo ve Hiroaki Nanba tarafından yapılan bir araştırmaya göre, bir kontrol grubuna kıyasla, maitake mantarı verilen farelerde kan glukoz seviyelerinde bir azalma gözlemlenmiştir. Araştırmacılar, mantarın insülin direncini ve duyarlılığını dengelemek için çalışabileceğine inanıyorlar. Kalp Sağlığını ve Kilo Kaybını Teşvik Ediyor

          Maitake mantarının tüketilmesi, kan basıncını düşürmeye, toplam kolesterol seviyelerini düşürmeye ve kalp sağlığını geliştirmeye yardımcı olabilecek kilonun korunmasına sebep olabilir. Mantarlar, kalori bakımından düşük, lif bakımında yüksektir. Bu, doygunluğu artırabilir. Kilo kaybı ile sonuçlanan, genel gıda alımını azaltmaya yardımcı olabilir. Yokota tarafından yapılan bir çalışmada, diyetlerinde başka hiçbir şeyi değiştirmeden, 30 kilolu yetişkine her gün maitake mantarı takviyesi verildi. 2 aylık çalışmanın sonunda, katılımcılar ortalama 3.5 ila 5 kilo verdiler. Kolesterolü Dengeler

          2013’teki bir çalışmada araştırmacılar, maitake tozunun farelerde kolesterol seviyelerini düşürdüğünü bulmuştur. Ayrıca, enerji sağlayan yağ asitlerini artırdığı da gösterildi. Bu nedenle, araştırmacılar bu mantar türünü tüketmenin, kan damarı ve arterleri sağlıklı tutmak için yardımcı olabileceğini düşünüyor. Tip 2 Diyabetle Mücadeleye Yardımcı Olur

          2015 araştırmasının sonuçları, tip 2 diyabetli sıçanlar üzerinde olumlu bir etkisi olabileceğini gösterdi. Çalışma sırasında, maitake mantarı tüketimi sıçanlarda glikoz düzeyleri üzerinde olumlu bir etkiye sahipti. Bu, mantarın insanlarda tip 2 diyabet tedavisi potansiyeline işaret eder. Aşağıdaki sorunların tedavisinde de yararlı olabilir:

          • Soğuk algınlığı ve grip virüsleri
          • Yüksek veya düşük tansiyon
          • Bağışıklık fonksiyonu
          • Kemoterapinin yan etkileri Yemek Düzenine Nasıl Ekleyebilirsiniz?

          Sağlığınızı artırmak için maitake kullanıyorsanız, normalde mantar eklediğiniz herhangi bir yemeğe ekleyebilirsiniz. Kızartmalara, salata, makarna, pizza, omlet veya çorbalara eklenebilir. Mantarı tereyağında kızartabilir ya da ızgara yapabilirsiniz. Maitake güçlü bir tada sahiptir, bu yüzden yiyeceğe fazlasını eklemeden önce tadına bakın.

          Taze maitake alıyorsanız, raf ömrünü artırmak için hepsini satın alın. Buzdolabında bir kağıt içerisinde ya da kese kağıdında saklayın. Çiğken dondurucuda saklayabilirsiniz, böylece taze tutabilirsiniz. Maitake ayrıca bir sıvı konsantresi olarak veya kapsül formunda alınabilir. Bir takviye olarak almaya karar verirseniz, mantarın özütü olan maitake D-Fraction bulmaya çalışın. Doğru dozaj yaşınıza, kilonuza ve sağlık durumunuza bağlıdır. Aynı zamanda belirli bir markanın gerçek gücüne de bağlıdır. Kullanmadan önce talimatları dikkatlice okuduğunuzdan emin olun.

          Yüksek doz almadan önce daima doktorunuza danışın ve reaksiyonları dikkatlice takip edin. Alışılmadık bir semptom veya rahatsızlık yaşamaya başlarsanız, kullanmaya devam etmeyin ve doktorunuza danışın. Fark edilebilir bir semptom hissetmeniz birkaç hafta veya ay sürebilir. C vitamini ile alınmasının faydalarını artırdığı söylenir. Risk Faktörleri

          Bayat olmadığı sürece yani taze ise kolay sindirilebilir. Ancak bayatsa mantarın dayanıklılığı sindirimi zorlaştırabilir. Mantarı pişirmek sindirilebilirliğini artırabilir. Alerjik reaksiyon ve mide rahatsızlığı nadir olmakla birlikte, görülmesi mümkündür. İyi tolere edilir.

          Şeker hastalığınız varsa, yemeden önce doktorunuza danışmalısınız. Maitake kan şekeriniz üzerinde etkili olabilir. Ayrıca tansiyonunuzu düşürebilir, bu yüzden hipotansiyonunuz varsa seçenekleri doktorunuzla konuştuğunuzdan emin olun. Herhangi bir ameliyattan sonraki iki hafta içinde veya kanama bozukluğunuz varsa yememelisiniz. Hamileyseniz, emziriyorsanız veya otoimmün bir hastalığınız varsa, kullanmadan önce doktorunuza danışın.

          Yorum yap

          Hazırlanıyor...
          X